AT1G64210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G16750 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT2G18310 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT5G55950 | Nucleotide/sugar transporter family protein;(source:Araport11) |
AT5G02890 | Encodes a protein with similarity to transferases in plants and fungi. |
AT1G67590 | Remorin family protein;(source:Araport11) |
AT1G74205 | Natural antisense transcript overlaps with AT1G74210;(source:Araport11) |
AT5G66120 | 3-dehydroquinate synthase;(source:Araport11) |
AT1G11850 | transmembrane protein;(source:Araport11) |
AT2G16676 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT3G15630 | plant/protein;(source:Araport11) |
AT2G22650 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
AT3G05900 | neurofilament protein-like protein;(source:Araport11) |
AT5G03230 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
AT3G51100 | altered inheritance of mitochondria protein;(source:Araport11) |
AT5G65260 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G02500 | mental retardation GTPase activating protein;(source:Araport11) |
AT4G29530 | Encodes a thiamin monophosphate phosphatase. Knockouts show no visible defects either in morphology or thiamin, ThMP and ThDP levels suggesting that Arabidopsis at least one other source of ThMPase activity. |
AT1G09980 | Putative serine esterase family protein;(source:Araport11) |
AT5G63710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G39985 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT4G03420 | hypothetical protein (DUF789);(source:Araport11) |
AT1G07580 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT2G16080 | pseudogene of Polynucleotidyl transferase;(source:Araport11) |
AT3G61930 | hypothetical protein;(source:Araport11) |
AT5G13140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT2G03110 | putative RNA-binding protein;(source:Araport11) |
AT1G73920 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G60940 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT4G31875 | hypothetical protein;(source:Araport11) |
AT1G31355 | pseudogene of Translation protein SH3-like family protein;(source:Araport11) |
AT3G11395 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
AT2G28360 | SIT4 phosphatase-associated family protein;(source:Araport11) |
AT5G51400 | PLAC8 family protein;(source:Araport11) |
AT1G70780 | hypothetical protein;(source:Araport11) |
AT5G24879 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G67240 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.5e-23 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT1G11785 | transmembrane protein;(source:Araport11) |
AT4G31248 | Natural antisense transcript overlaps with AT4G31250;(source:Araport11) |
AT5G18590 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G19730 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G35110 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT5G28970.1);(source:TAIR10) |
AT2G37520 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
AT3G06890 | transmembrane protein;(source:Araport11) |
AT4G39200 | Ribosomal protein S25 family protein;(source:Araport11) |
AT1G75050 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT5G02440 | 60S ribosomal protein L36;(source:Araport11) |
AT4G03038 | other_RNA;(source:Araport11) |
AT5G53910 | RING/U-box superfamily protein;(source:Araport11) |
AT4G03460 | Ankyrin repeat family protein;(source:Araport11) |
AT3G13500 | hypothetical protein;(source:Araport11) |
AT3G02710 | Encodes a protein with a putative role in mRNA splicing. |
AT3G24518 | Natural antisense transcript overlaps with AT3G24520;(source:Araport11) |
AT3G27845 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G35730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT1G56140 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
AT1G49140 | NADH dehydrogenase ubiquinone 1 beta subcomplex subunit 10-B-like protein (Complex I subunit NDUFS6);(source:Araport11) |
AT3G13690 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT5G04830 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
AT1G59880 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT2G30230 | 6,7-dimethyl-8-ribityllumazine synthase;(source:Araport11) |
AT1G17410 | Nucleoside diphosphate kinase family protein;(source:Araport11) |
AT4G18490 | hypothetical protein;(source:Araport11) |
AT2G30720 | Thioesterase/thiol ester dehydrase-isomerase superfamily protein;(source:Araport11) |
AT2G19660 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G24730 | manganese-dependent ADP-ribose/CDP-alcohol diphosphatase-like protein;(source:Araport11) |
AT3G63240 | DNAse I-like superfamily protein;(source:Araport11) |
AT3G46690 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G75180 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
AT3G11210 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT3G60935 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.9e-127 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
AT1G32360 | Zinc finger (CCCH-type) family protein;(source:Araport11) |
AT2G31560 | signal transducer/transcription protein, putative (DUF1685);(source:Araport11) |
AT4G27610 | intracellular protein transporter;(source:Araport11) |
AT5G18990 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G67785 | hypothetical protein;(source:Araport11) |
AT2G42020 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT1G67238 | other_RNA;(source:Araport11) |
AT1G04680 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G35690 | hypothetical protein (DUF241);(source:Araport11) |
AT5G11420 | Encodes a DUF642 cell wall protein. |
AT3G54680 | proteophosphoglycan-like protein;(source:Araport11) |
AT3G46668 | None;(source:Araport11) |
AT3G52980 | Zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein;(source:Araport11) |
AT5G21100 | Plant L-ascorbate oxidase;(source:Araport11) |
AT3G06070 | hypothetical protein;(source:Araport11) |
AT1G08950 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT4G35500 | Protein kinase superfamily protein;(source:Araport11) |
AT5G19050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G38030 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
AT4G40020 | Myosin heavy chain-related protein;(source:Araport11) |
AT2G27420 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT4G09625 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 9.1e-76 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT4G04560 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-94 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT3G51238 | Natural antisense transcript overlaps with AT3G51240;(source:Araport11) |
AT3G61540 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G53050 | Protein kinase superfamily protein;(source:Araport11) |
AT3G46183 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-230 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT5G37710 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G05975 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G13250 | RING finger protein;(source:Araport11) |
AT1G33415 | Natural antisense transcript overlaps with AT1G33420 and AT1G33430;(source:Araport11) |
AT2G37750 | hypothetical protein;(source:Araport11) |
AT5G41390 | PLAC8 family protein;(source:Araport11) |
AT5G11070 | hypothetical protein;(source:Araport11) |
AT3G22845 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT5G19440 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase |
AT1G63855 | Putative methyltransferase family protein;(source:Araport11) |
AT1G05170 | Galactosyltransferase family protein;(source:Araport11) |
AT1G32660 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G32440 | Ubiquitin system component Cue protein;(source:Araport11) |
AT3G60180 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G77840 | Translation initiation factor IF2/IF5;(source:Araport11) |
AT1G77260 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G38850 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT5G24640 | hypothetical protein;(source:Araport11) |
AT1G61900 | hypothetical protein;(source:Araport11) |
AT4G30130 | DUF630 family protein (DUF630 and DUF632);(source:Araport11) |
AT5G48040 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT4G01860 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT2G34360 | MATE efflux family protein;(source:Araport11) |
AT3G14920 | Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A protein;(source:Araport11) |
AT1G80150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G51180 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT1G28580 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G73470 | hypothetical protein;(source:Araport11) |
AT1G15590 | E3 ubiquitin-protein ligase;(source:Araport11) |
AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
AT2G34100 | nonsense-mediated mRNA decay-like protein;(source:Araport11) |
AT1G69130 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT3G09730 | POLAR LOCALIZATION DURING ASYMMETRIC DIVISION AND protein;(source:Araport11) |
AT1G67720 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G28200 | C2H2-type zinc finger family protein;(source:Araport11) |
AT3G04920 | Ribosomal protein S24e family protein;(source:Araport11) |
AT2G43210 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G58410 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT3G30390 | Encodes a putative amino acid transporter. |
AT5G05320 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT4G10080 | transmembrane protein;(source:Araport11) |
AT4G15970 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT4G30240 | Syntaxin/t-SNARE family protein;(source:Araport11) |
AT2G16660 | Major facilitator superfamily protein;(source:Araport11) |
AT3G12350 | F-box family protein;(source:Araport11) |
AT5G12010 | nuclease;(source:Araport11) |
AT5G22820 | ARM repeat superfamily protein;(source:Araport11) |
AT1G17620 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G02930 | Encodes a microtubule-associated protein. |
AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
AT1G80870 | Protein kinase superfamily protein;(source:Araport11) |
AT3G57000 | nucleolar essential protein-like protein;(source:Araport11) |
AT5G66270 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT4G17650 | Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11) |
AT5G04980 | DNAse I-like superfamily protein;(source:Araport11) |
AT4G23970 | hypothetical protein;(source:Araport11) |
AT5G43190 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G20790 | F-box family protein;(source:Araport11) |
AT5G02650 | hypothetical protein;(source:Araport11) |
AT4G32270 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT2G38090 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT1G07210 | Ribosomal protein S18;(source:Araport11) |
AT1G10350 | DNAJ heat shock family protein;(source:Araport11) |
AT5G58150 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G26290 | hypothetical protein;(source:Araport11) |
AT2G33280 | Major facilitator superfamily protein;(source:Araport11) |
AT5G41100 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G77560 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
AT2G34460 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G02370 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G50270 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G15150 | MATE efflux family protein;(source:Araport11) |
AT5G64550 | loricrin-like protein;(source:Araport11) |
AT4G01210 | glycosyl transferase family 1 protein;(source:Araport11) |
AT5G08680 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
AT2G38646 | hypothetical protein;(source:Araport11) |
AT4G11355 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT1G04985 | triacylglycerol lipase-like protein;(source:Araport11) |
AT1G05380 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger protein;(source:Araport11) |
AT1G26300 | BSD domain-containing protein;(source:Araport11) |
AT3G01980 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G19000 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G76980 | patatin-like phospholipase domain protein;(source:Araport11) |
AT3G08636 | hypothetical protein;(source:Araport11) |
AT1G20460 | NADH-ubiquinone oxidoreductase chain;(source:Araport11) |
AT4G38950 | ATP binding microtubule motor family protein;(source:Araport11) |
AT5G19500 | Encodes a putative amino acid transporter that localizes to the chloroplast inner envelope membrane. |
AT2G03040 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT5G57887 | transmembrane protein;(source:Araport11) |
AT5G53150 | DnaJ heat shock amino-terminal domain protein;(source:Araport11) |
AT3G11800 | Expp1 protein;(source:Araport11) |
AT1G33102 | hypothetical protein;(source:Araport11) |
AT5G40180 | Pmr5/Cas1p GDSL/SGNH-like acyl-esterase family protein;(source:Araport11) |
AT2G34110 | hypothetical protein;(source:Araport11) |
AT3G61826 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G14680 | early endosome antigen;(source:Araport11) |
AT5G19870 | transmembrane epididymal protein (DUF716);(source:Araport11) |
AT1G69480 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT1G05615 | B3 domain protein (DUF313);(source:Araport11) |
AT1G56400 | F-box family protein;(source:Araport11) |
AT5G19490 | Histone superfamily protein;(source:Araport11) |
AT4G01670 | hypothetical protein;(source:Araport11) |
AT4G10955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G55640 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G26580 | ELM2 domain protein;(source:Araport11) |
AT3G49410 | Transcription factor IIIC, subunit 5;(source:Araport11) |
AT4G36980 | CLK4-associating serine/arginine-rich protein;(source:Araport11) |
AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G15530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G16730 | Encodes a microtubule-associated protein. The mRNA is cell-to-cell mobile. |
AT5G62280 | DUF1442 family protein (DUF1442);(source:Araport11) |
AT3G44820 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT1G64050 | hypothetical protein;(source:Araport11) |
AT2G39960 | Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11) |
AT5G40690 | histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11) |
AT3G46630 | DCL protein (DUF3223);(source:Araport11) |
AT3G23605 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT2G35736 | hypothetical protein;(source:Araport11) |
AT3G29762 | pseudogene of DNA-directed RNA polymerase family protein;(source:Araport11) |
AT1G02480 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT3G18170 | Glycosyltransferase family 61 protein;(source:Araport11) |
AT5G05220 | hypothetical protein;(source:Araport11) |
AT4G01460 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G52770 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G27210 | hypothetical protein;(source:Araport11) |
AT1G52855 | hypothetical protein;(source:Araport11) |
AT5G52620 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT2G40004 | transmembrane protein;(source:Araport11) |
AT1G45170 | outer envelope pore 24B-like protein;(source:Araport11) |
AT5G20190 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
AT1G16170 | ephrin-A3 protein;(source:Araport11) |
AT5G65535 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
AT1G02475 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT3G61840 | auxin response factor, putative (DUF688);(source:Araport11) |
AT1G15825 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G15420 | Ubiquitin fusion degradation UFD1 family protein;(source:Araport11) |
AT2G14910 | MAR-binding filament-like protein;(source:Araport11) |
AT5G59050 | G patch domain protein;(source:Araport11) |
AT3G51870 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT4G16162 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G13800 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
AT4G36032 | Natural antisense transcript overlaps with AT4G36030;(source:Araport11) |
AT5G23235 | pseudogene of DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT2G05290 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G41570.1);(source:TAIR10) |
AT3G60961 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G33840 | Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial;(source:Araport11) |
AT2G18860 | Syntaxin/t-SNARE family protein;(source:Araport11) |
AT2G19130 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G49170 | hypothetical protein;(source:Araport11) |
AT2G16460 | coiled-coil 90B-like protein (DUF1640);(source:Araport11) |
AT5G38060 | carboxypeptidase;(source:Araport11) |
AT1G79290 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
AT5G67140 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G56880 | VQ motif-containing protein;(source:Araport11) |
AT5G16375 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT1G15165 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G19010 | hypothetical protein;(source:Araport11) |
AT2G41000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT4G23040 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT2G40660 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT2G27315 | egg cell-secreted-like protein (DUF1278);(source:Araport11) |
AT1G03940 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G22910 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G30010 | ATP-dependent RNA helicase;(source:Araport11) |
AT5G57150 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G64020 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT3G11825 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT3G58180 | ARM repeat superfamily protein;(source:Araport11) |
AT3G58150 | Optic atrophy 3 protein (OPA3);(source:Araport11) |
AT5G43590 | Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein;(source:Araport11) |
AT1G45163 | transmembrane protein;(source:Araport11) |
AT4G27652 | hypothetical protein;(source:Araport11) |
AT5G05965 | cell wall RBR3-like protein;(source:Araport11) |
AT3G21791 | Pseudogene of AT3G21790; UDP-glucoronosyl/UDP-glucosyl transferase family protein |
AT1G19410 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT1G76954 | Encodes a defensin-like (DEFL) family protein. |
AT4G30470 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G37610 | Eukaryotic porin family protein;(source:Araport11) |
AT3G24830 | Ribosomal protein L13 family protein;(source:Araport11) |
AT3G51230 | chalcone-flavanone isomerase family protein;(source:Araport11) |
AT3G15200 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G34315 | avirulence induced family protein;(source:Araport11) |
AT3G05280 | Integral membrane Yip1 family protein;(source:Araport11) |
AT5G38035 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.9e-71 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G21430 | Papain family cysteine protease;(source:Araport11) |
AT5G58090 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT1G02350 | protoporphyrinogen oxidase-like protein;(source:Araport11) |
AT1G69030 | BSD domain-containing protein;(source:Araport11) |
AT1G27200 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT1G28920 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G65570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G21970 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT2G34450 | HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
AT4G28085 | transmembrane protein;(source:Araport11) |
AT2G40008 | Natural antisense transcript overlaps with AT2G40010;(source:Araport11) |
AT2G15920 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G10030 | aspartate/glutamate/uridylate kinase family protein;(source:Araport11) |
AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G02575 | transmembrane protein;(source:Araport11) |
AT1G03590 | Protein phosphatase 2C family protein;(source:Araport11) |
AT4G24380 | dihydrofolate reductase;(source:Araport11) |
AT2G42780 | transcription elongation factor B polypeptide;(source:Araport11) |
AT5G17350 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT1G59690 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G23070 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT5G38050 | RNA polymerase II transcription elongation factor;(source:Araport11) |
AT3G59110 | Protein kinase superfamily protein;(source:Araport11) |
AT5G05795 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
AT2G48000 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G27180 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT1G78070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G51650 | stress response NST1-like protein;(source:Araport11) |
AT1G52200 | PLAC8 family protein;(source:Araport11) |
AT5G02960 | Ribosomal protein S12/S23 family protein;(source:Araport11) |
AT4G30570 | Glucose-1-phosphate adenylyltransferase family protein;(source:Araport11) |
AT2G17210 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G48200 | transmembrane protein;(source:Araport11) |
AT2G02600 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT5G25240 | stress induced protein;(source:Araport11) |
AT2G22100 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G32340 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G23030 | MATE efflux family protein;(source:Araport11) |
AT5G60240 | hypothetical protein;(source:Araport11) |
AT4G11020 | hypothetical protein;(source:Araport11) |
AT3G26580 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G51130 | transmembrane protein;(source:Araport11) |
AT2G35920 | RNA helicase family protein;(source:Araport11) |
AT5G52840 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
AT1G69000 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT1G04210 | Encodes a putative Raf-related kinase. |
AT3G18060 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT4G13500 | transmembrane protein;(source:Araport11) |
AT1G72800 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G23890 | NHL domain-containing protein;(source:Araport11) |
AT1G77910 | transmembrane protein;(source:Araport11) |
AT3G04850 | Tesmin/TSO1-like CXC domain-containing protein;(source:Araport11) |
AT1G52191 | Thioesterase superfamily protein;(source:Araport11) |
AT4G30990 | ARM repeat superfamily protein;(source:Araport11) |
AT3G14595 | Ribosomal protein L18ae family;(source:Araport11) |
AT3G02460 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT4G33100 | protein phosphatase;(source:Araport11) |
AT5G62340 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G14830 | epstein-barr nuclear antigen;(source:Araport11) |
AT4G17690 | Peroxidase superfamily protein;(source:Araport11) |
AT4G28915 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT3G19900 | hypothetical protein;(source:Araport11) |
AT1G22580 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 32%25 identity and 1.1e-13 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
AT2G42960 | Protein kinase superfamily protein;(source:Araport11) |
AT1G53440 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
AT1G12440 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT2G02880 | mucin-like protein;(source:Araport11) |
AT3G18815 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
AT5G39560 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G66780 | MATE efflux family protein;(source:Araport11) |
AT4G12450 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT4G08360 | KOW domain-containing protein;(source:Araport11) |
AT5G18780 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G11940 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT5G64230 | 1,8-cineole synthase;(source:Araport11) |
AT3G56250 | hypothetical protein;(source:Araport11) |
AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT5G42770 | Maf-like protein;(source:Araport11) |
AT5G14580 | polyribonucleotide nucleotidyltransferase;(source:Araport11) |
AT1G49032 | hypothetical protein;(source:Araport11) |
AT4G00752 | UBX domain-containing protein;(source:Araport11) |
AT3G61870 | plant/protein;(source:Araport11) |
AT1G79520 | Cation efflux family protein;(source:Araport11) |
AT2G03750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G70350 | hypothetical protein;(source:Araport11) |
AT5G09976 | hypothetical protein;(source:Araport11) |
AT2G47150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G11175 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT5G51840 | junctophilin-like protein;(source:Araport11) |
AT1G54020 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G57070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G72740 | Single Myb Histone (SMH) gene family member. Contains terminal acidic SANT domain. |
AT3G56270 | WEB family protein (DUF827);(source:Araport11) |
AT1G33500 | tropomyosin;(source:Araport11) |
AT2G27830 | hypothetical protein;(source:Araport11) |
AT4G14310 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G60350 | hypothetical protein;(source:Araport11) |
AT2G22890 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
AT5G51900 | Cytochrome P450 family protein;(source:Araport11) |
AT5G13090 | hypothetical protein;(source:Araport11) |
AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT5G24600 | TRP-like ion channel protein (Protein of unknown function, DUF599);(source:Araport11) |
AT3G22180 | DHHC-type zinc finger family protein;(source:Araport11) |
AT3G05165 | Major facilitator superfamily protein;(source:Araport11) |
AT2G44500 | O-fucosyltransferase family protein;(source:Araport11) |
AT3G50690 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G39600 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G60010 | PADRE protein down-regulated after infection by S. sclerotiorun. |
AT4G39840 | cell wall integrity/stress response component-like protein;(source:Araport11) |
AT4G21630 | Subtilase family protein;(source:Araport11) |
AT4G25070 | caldesmon-like protein;(source:Araport11) |
AT3G25940 | TFIIB zinc-binding protein;(source:Araport11) |
AT3G45252 | Encodes a ECA1 gametogenesis related family protein |
AT2G20835 | hypothetical protein;(source:Araport11) |
AT4G38710 | glycine-rich protein;(source:Araport11) |
AT2G26340 | hypothetical protein;(source:Araport11) |
AT2G03850 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT3G56080 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G30850 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT1G50575 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT3G06450 | HCO3- transporter family;(source:Araport11) |
AT5G57010 | calmodulin-binding family protein;(source:Araport11) |
AT2G31730 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G12850 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT2G36040 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30610.1);(source:TAIR10) |
AT2G23780 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
AT1G50290 | hypothetical protein;(source:Araport11) |
AT1G64010 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT3G11070 | Outer membrane OMP85 family protein;(source:Araport11) |
AT5G67245 | hypothetical protein;(source:Araport11) |
AT1G54420 | hypothetical protein;(source:Araport11) |
AT3G02340 | RING/U-box superfamily protein;(source:Araport11) |
AT4G17760 | PCNA domain-containing protein;(source:Araport11) |
AT2G30600 | BTB/POZ domain-containing protein;(source:Araport11) |
AT2G37140 | Terpenoid synthases superfamily protein;(source:Araport11) |
AT1G17660 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT4G30150 | Urb2/Npa2 family protein;(source:Araport11) |
AT3G52240 | transcriptional regulator ATRX;(source:Araport11) |
AT2G33710 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT4G26130 | cotton fiber protein;(source:Araport11) |
AT2G24550 | major centromere autoantigen B-like protein;(source:Araport11) |
AT5G57610 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
AT5G53680 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G18930 | RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11) |
AT5G20800 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, predicted non-LTR reverse ranscriptase sequence fragments;(source:TAIR10) |
AT5G02230 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G64500 | Major facilitator superfamily protein |
AT3G21210 | zinc ion binding protein;(source:Araport11) |
AT3G04040 | transmembrane protein;(source:Araport11) |
AT3G52072 | Natural antisense transcript overlaps with AT3G52070;(source:Araport11) |
AT1G13635 | DNA glycosylase superfamily protein;(source:Araport11) |
AT3G06150 | cytochrome P450 family protein;(source:Araport11) |
AT1G43910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G77480 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G05980 | hypothetical protein;(source:Araport11) |
AT1G69526 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G14090 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G04430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G22440 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT1G13650 | hypothetical protein;(source:Araport11) |
AT3G09860 | actin T1-like protein;(source:Araport11) |
AT5G39900 | Small GTP-binding protein;(source:Araport11) |
AT1G07870 | Protein kinase superfamily protein;(source:Araport11) |
AT3G57010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT2G33170 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
AT4G17540 | dynamin;(source:Araport11) |
AT3G12345 | FKBP-type peptidyl-prolyl cis-trans isomerase;(source:Araport11) |
AT1G31790 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G50335 | hypothetical protein;(source:Araport11) |
AT4G38540 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT5G54855 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT5G25590 | DNA ligase (DUF630 and DUF632);(source:Araport11) |
AT5G07670 | RNI-like superfamily protein;(source:Araport11) |
AT1G10750 | carboxyl-terminal peptidase, putative (DUF239);(source:Araport11) |
AT4G22360 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
AT2G17140 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G26490 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
AT5G07730 | transmembrane protein;(source:Araport11) |
AT5G54040 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G27965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.5e-26 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
AT5G49743 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G20770 | coiled-coil protein;(source:Araport11) |
AT1G71695 | Peroxidase superfamily protein;(source:Araport11) |
AT3G49890 | hypothetical protein;(source:Araport11) |
AT3G15590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G04640 | glycine-rich protein;(source:Araport11) |
AT2G22070 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT3G47570 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G43390 | hypothetical protein;(source:Araport11) |
AT3G62285 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT5G47818 | pseudogene of WPP domain interacting protein 1;(source:Araport11) |
AT5G45740 | Ubiquitin domain-containing protein;(source:Araport11) |
AT3G63360 | Encodes a defensin-like (DEFL) family protein. |
AT2G38000 | chaperone protein dnaJ-like protein;(source:Araport11) |
AT1G55240 | proteinase inhibitor I4, serpin (DUF716);(source:Araport11) |
AT1G28590 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G54940 | Translation initiation factor SUI1 family protein;(source:Araport11) |
AT3G07310 | phosphoserine aminotransferase, putative (DUF760);(source:Araport11) |
AT1G63290 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT5G59970 | Histone superfamily protein;(source:Araport11) |
AT5G45590 | Ribosomal protein L35;(source:Araport11) |
AT4G00893 | F-box/kelch-repeat protein;(source:Araport11) |
AT3G50780 | BTB/POZ domain protein;(source:Araport11) |
AT5G67390 | glycosyltransferase-like protein;(source:Araport11) |
AT4G14620 | hypothetical protein (DUF506);(source:Araport11) |
AT1G14890 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G69420 | DHHC-type zinc finger family protein;(source:Araport11) |
AT3G63390 | hypothetical protein;(source:Araport11) |
AT5G37410 | hypothetical protein (DUF577);(source:Araport11) |
AT4G06744 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G52280 | Myosin heavy chain-related protein;(source:Araport11) |
AT1G25430 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.0e-45 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G21300 | ATP binding microtubule motor family protein;(source:Araport11) |
AT4G19460 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G37660 | Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein;(source:Araport11) |
AT2G25200 | hypothetical protein (DUF868);(source:Araport11) |
AT5G56190 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G22960 | FAM63A-like protein (DUF544);(source:Araport11) |
AT4G37190 | plasma membrane, autoregulation-binding site, misato segment II, myosin-like, tubulin/FtsZ protein;(source:Araport11) |
AT1G12650 | rRNA biogenesis RRP36-like protein;(source:Araport11) |
AT5G23330 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
AT4G26965 | NADH:ubiquinone oxidoreductase, 17.2kDa subunit;(source:Araport11) |
AT4G17940 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G73885 | AT-rich interactive domain protein;(source:Araport11) |
AT3G15110 | transmembrane protein;(source:Araport11) |
AT4G14530 | agamous-like MADS-box protein;(source:Araport11) |
AT4G29103 | transmembrane protein;(source:Araport11) |
AT3G52220 | leukocyte immunoglobulin-like receptor family A protein;(source:Araport11) |
AT1G25500 | Plasma-membrane choline transporter family protein;(source:Araport11) |
AT1G49030 | PLAC8 family protein;(source:Araport11) |
AT4G16680 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G80610 | hypothetical protein;(source:Araport11) |
AT5G44450 | alpha amino-terminal protein methyltransferase;(source:Araport11) |
AT4G10130 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT5G19230 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
AT1G48090 | calcium-dependent lipid-binding family protein;(source:Araport11) |
AT4G34380 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G17240 | structural maintenance of chromosomes protein;(source:Araport11) |
AT4G30970 | hypothetical protein;(source:Araport11) |
AT1G29980 | choice-of-anchor C domain protein, putative (Protein of unknown function, DUF642);(source:Araport11) |
AT5G59020 | hepatocyte growth factor activator, putative (DUF3527);(source:Araport11) |
AT5G04550 | type-1 restriction enzyme mjaxp r protein (DUF668);(source:Araport11) |
AT1G08315 | ARM repeat superfamily protein;(source:Araport11) |
AT5G23710 | DNA binding / DNA-directed RNA polymerase;(source:Araport11) |
AT3G62475 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.3e-55 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
AT2G15910 | CSL zinc finger domain-containing protein;(source:Araport11) |
AT4G00090 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G41640 | Glycosyltransferase family 61 protein;(source:Araport11) |
AT3G01311 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
AT4G15955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G63850 | BTB/POZ domain-containing protein;(source:Araport11) |
AT5G05790 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT3G27090 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
AT5G12440 | CCCH-type zinc fingerfamily protein with RNA-binding domain-containing protein;(source:Araport11) |
AT1G64590 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT1G19397 | transmembrane protein;(source:Araport11) |
AT3G52330 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT4G05071 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G29570 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
AT5G19150 | AT5G19150 is a dehydratase that converts (S)-NAD(P)HX to NAD(P)H. |
AT1G61170 | hypothetical protein;(source:Araport11) |
AT5G44710 | 37S ribosomal protein S27;(source:Araport11) |
AT3G60450 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT5G09580 | heat shock protein;(source:Araport11) |
AT5G66060 | 2-oxoglutarate-dependent dioxygenase |
AT4G39615 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT5G09655 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT1G16790 | ribosomal protein-like protein;(source:Araport11) |
AT1G64850 | Calcium-binding EF hand family protein;(source:Araport11) |
AT1G33250 | beta-1,3-n-acetylglucosaminyltransferase radical fringe protein, putative (DUF604);(source:Araport11) |
AT1G15180 | MATE efflux family protein;(source:Araport11) |
AT2G36325 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G27415 | hypothetical protein;(source:Araport11) |
AT3G21050 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-18 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G26430 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT1G48745 | hypothetical protein;(source:Araport11) |
AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G20720 | amino-terminal region of chorein;(source:Araport11) |
AT2G36440 | hypothetical protein;(source:Araport11) |
AT5G48200 | hypothetical protein;(source:Araport11) |
AT2G16520 | RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11) |
AT5G54585 | hypothetical protein;(source:Araport11) |
AT3G19390 | Granulin repeat cysteine protease family protein;(source:Araport11) |
AT4G32610 | copper ion binding protein;(source:Araport11) |
AT4G32080 | hypothetical protein;(source:Araport11) |
AT4G25660 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
AT5G59900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G24880 | chromo domain cec-like protein;(source:Araport11) |
AT5G52815 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
AT2G30990 | arginine N-methyltransferase, putative (DUF688);(source:Araport11) |
AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
AT2G39870 | hypothetical protein;(source:Araport11) |
AT1G75970 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT1G35570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
AT4G28260 | acyl-UDP-N-acetylglucosamine O-acyltransferase;(source:Araport11) |
AT3G49550 | hypothetical protein;(source:Araport11) |
AT1G77290 | Glutathione S-transferase family protein;(source:Araport11) |
AT5G16920 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
AT1G50659 | other_RNA;(source:Araport11) |
AT3G22072 | Natural antisense transcript overlaps with AT3G22070;(source:Araport11) |
AT2G47115 | protein rolling protein;(source:Araport11) |
AT5G64850 | sorbin/SH3 domain protein;(source:Araport11) |
AT1G44780 | translation initiation factor;(source:Araport11) |
AT1G54355 | Natural antisense transcript overlaps with AT1G54350;(source:Araport11) |
AT4G24100 | Protein kinase superfamily protein |
AT3G14560 | Its transcript is targeted by miR824. |
AT5G64572 | Natural antisense transcript overlaps with AT5G64570;(source:Araport11) |
AT2G36580 | Pyruvate kinase family protein;(source:Araport11) |
AT5G49950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G23460 | Adaptin family protein;(source:Araport11) |
AT2G40350 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
AT4G09965 | hypothetical protein;(source:Araport11) |
AT4G19670 | RING/U-box superfamily protein;(source:Araport11) |
AT4G05160 | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At4g05160 preferentially activates fatty acids with medium chain length (C6:0 and C7:0) as well as even-numbered long-chain fatty acids (C14:0, C16:0 and C18:0). At4g05160 was also able to catalyze the conversion of OPC-6:0 to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis. |
AT2G44400 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G39270 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G43230 | RING/FYVE/PHD-type zinc finger family protein;(source:Araport11) |
AT3G48710 | DEK domain-containing chromatin associated protein;(source:Araport11) |
AT5G34852 | pseudogene of Intron maturase;(source:Araport11) |
AT3G51642 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT2G16340 | hypothetical protein;(source:Araport11) |
AT4G30170 | Peroxidase family protein;(source:Araport11) |
AT2G15720 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.4e-35 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT1G02810 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT3G44510 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G22930 | enabled-like protein (DUF1635);(source:Araport11) |
AT3G04930 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT4G21580 | oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
AT5G65380 | MATE efflux family protein;(source:Araport11) |
AT5G08580 | Calcium-binding EF hand family protein;(source:Araport11) |
AT2G18070 | hypothetical protein;(source:Araport11) |
AT1G03510 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G17098 | Natural antisense transcript overlaps with AT4G17100;(source:Araport11) |
AT5G67020 | hypothetical protein;(source:Araport11) |
AT5G13100 | Gap junction beta-4 protein;(source:Araport11) |
AT3G05675 | BTB/POZ domain-containing protein;(source:Araport11) |
AT4G23730 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT4G21926 | hypothetical protein;(source:Araport11) |
AT5G40945 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
AT5G35205 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-36 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G62900 | PADRE protein down-regulated after infection by S. sclerotiorum. |
AT1G63410 | LURP-one-like protein (DUF567);(source:Araport11) |
AT2G15830 | hypothetical protein;(source:Araport11) |
AT1G66830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G05937 | hypothetical protein;(source:Araport11) |
AT1G05562 | Natural antisense transcript overlaps with AT1G05560;(source:Araport11) |
AT1G26950 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT5G33360.1);(source:TAIR10) |
AT3G13223 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G67300 | Major facilitator superfamily protein;(source:Araport11) |
AT5G61090 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT2G30150 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G35030 | Protein kinase superfamily protein;(source:Araport11) |
AT2G40820 | stomatal closure actin-binding-like protein;(source:Araport11) |
AT2G23910 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G34190 | Xanthine/uracil permease family protein;(source:Araport11) |
AT1G78840 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G41675 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT2G39520 | hypothetical protein;(source:Araport11) |
AT3G52470 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G47020 | MraZ;(source:Araport11) |
AT4G19191 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G10260 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-19 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT4G05053 | pseudogene of ATRCY1 (arginine-rich cyclin) |
AT3G24542 | Beta-galactosidase related protein;(source:Araport11) |
AT2G28140 | enabled-like protein (DUF1635);(source:Araport11) |
AT1G03560 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT4G21437 | unknown pseudogene |
AT1G14460 | AAA-type ATPase family protein;(source:Araport11) |
AT4G29700 | Alkaline-phosphatase-like family protein;(source:Araport11) |
AT3G46186 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT5G53750 | CBS domain-containing protein;(source:Araport11) |
AT1G28685 | Natural antisense transcript overlaps with AT1G28680;(source:Araport11) |
AT3G23910 | reverse transcriptase-like protein;(source:Araport11) |
AT2G36090 | F-box family protein;(source:Araport11) |
AT4G25770 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G12640 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G70505 | transmembrane protein;(source:Araport11) |
AT3G03702 | Natural antisense transcript overlaps with AT3G03700;(source:Araport11) |
AT3G54366 | Unknown gene The mRNA is cell-to-cell mobile. |
AT5G57700 | BNR/Asp-box repeat family protein;(source:Araport11) |
AT1G53770 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G15730 | Cobalamin biosynthesis CobW-like protein;(source:Araport11) |
AT5G46770 | hypothetical protein;(source:Araport11) |
AT1G33170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G15170 | MATE efflux family protein;(source:Araport11) |
AT2G28400 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT2G21930 | A paternally expressed imprinted gene. |
AT3G02510 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT4G33700 | CBS domain protein (DUF21);(source:Araport11) |
AT3G08490 | delta-latroinsectotoxin-Lt1a protein;(source:Araport11) |
AT2G17705 | methionine-S-oxide reductase;(source:Araport11) |
AT3G18150 | RNI-like superfamily protein;(source:Araport11) |
AT1G61260 | cotton fiber (DUF761);(source:Araport11) |
AT5G07315 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT1G59570 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT3G18860 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT1G50890 | ARM repeat superfamily protein;(source:Araport11) |
AT3G60540 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
AT5G40645 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
AT4G35660 | selection/upkeep of intraepithelial T-cells protein, putative (DUF241);(source:Araport11) |
AT4G38640 | Plasma-membrane choline transporter family protein;(source:Araport11) |
AT3G48275 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
AT1G26660 | Prefoldin chaperone subunit family protein;(source:Araport11) |
AT1G22065 | hypothetical protein;(source:Araport11) |
AT3G46650 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G26520 | transmembrane protein;(source:Araport11) |
AT1G63400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G09505 | pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10) |
AT1G03280 | Transcription factor TFIIE, alpha subunit;(source:Araport11) |
AT5G65520 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G65205 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G26110 | bromodomain protein (DUF761);(source:Araport11) |
AT4G04692 | pseudogene of expressed protein;(source:Araport11) |
AT1G77765 | transmembrane protein;(source:Araport11) |
AT4G37700 | hypothetical protein;(source:Araport11) |
AT5G12060 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G43270 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G46195 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 8.8e-38 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G43220 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G36680 | Modifier of rudimentary (Mod(r)) protein;(source:Araport11) |
AT1G65710 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT5G49960 | ion channel protein;(source:Araport11) |
AT5G07800 | Flavin-binding monooxygenase family protein;(source:Araport11) |
AT2G15695 | peptide methionine sulfoxide reductase (Protein of unknown function DUF829, transmembrane 53);(source:Araport11) |
AT1G72820 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G71015 | PADRE protein. |
AT2G19700 | hypothetical protein;(source:Araport11) |
AT5G18245 | Natural antisense transcript overlaps with AT5G18240;(source:Araport11) |
AT5G23610 | DYAD protein;(source:Araport11) |
AT1G54110 | Membrane fusion protein Use1;(source:Araport11) |
AT1G18930 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G72060 | serine-type endopeptidase inhibitor;(source:Araport11) |
AT5G48500 | pathogenic type III effector avirulence factor Avr AvrRpt-cleavage: cleavage site protein;(source:Araport11) |
AT1G01770 | propionyl-CoA carboxylase;(source:Araport11) |
AT3G07055 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
AT3G12470 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT1G01400 | hypothetical protein;(source:Araport11) |
AT2G46360 | hypothetical protein;(source:Araport11) |
AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
AT3G60200 | hypothetical protein;(source:Araport11) |
AT5G15940 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G17280 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT1G76070 | hypothetical protein;(source:Araport11) |
AT5G59400 | PGR5-like A protein;(source:Araport11) |
AT2G05810 | ARM repeat superfamily protein;(source:Araport11) |
AT3G11290 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT3G25960 | Pyruvate kinase family protein;(source:Araport11) |
AT4G34920 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT5G44590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G60260 | hypothetical protein;(source:Araport11) |
AT5G64880 | transmembrane protein;(source:Araport11) |
AT1G29240 | transcription initiation factor TFIID subunit, putative (DUF688);(source:Araport11) |
AT1G22900 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT1G76580 | Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;(source:Araport11) |
AT5G47455 | hypothetical protein;(source:Araport11) |
AT1G24130 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G49115 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G21910 | MATE efflux family protein;(source:Araport11) |
AT1G24640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-37 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G61829 | transmembrane protein;(source:Araport11) |
AT4G20250 | hypothetical protein;(source:Araport11) |
AT5G35735 | Auxin-responsive family protein;(source:Araport11) |
AT1G33230 | TMPIT-like protein;(source:Araport11) |
AT1G18440 | Peptidyl-tRNA hydrolase family protein;(source:Araport11) |
AT3G16680 | DNA binding / DNA-directed RNA polymerase;(source:Araport11) |
AT4G03405 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
AT4G33910 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G08600 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT3G15290 | 3-hydroxyacyl-CoA dehydrogenase family protein;(source:Araport11) |
AT4G22350 | Ubiquitin C-terminal hydrolases superfamily protein;(source:Araport11) |
AT3G62160 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G01710 | acyl-CoA thioesterase II;(source:Araport11) |
AT1G79970 | hypothetical protein;(source:Araport11) |
AT1G78865 | other_RNA;(source:Araport11) |
AT4G16100 | heat shock protein, putative (DUF789);(source:Araport11) |
AT5G05435 | Natural antisense transcript overlaps with AT5G05430;(source:Araport11) |
AT4G14345 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
AT5G35560 | DENN (AEX-3) domain-containing protein;(source:Araport11) |
AT4G39580 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G04525 | pre-tRNA tRNA-Arg (anticodon: CCG);(source:Araport11, TAIR10) |
AT5G27710 | T-box protein;(source:Araport11) |
AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G02330 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G02550 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT5G02970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G14910 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G63135 | transcription termination factor;(source:Araport11) |
AT2G23321 | hypothetical protein;(source:Araport11) |
AT3G15585 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT4G21620 | glycine-rich protein;(source:Araport11) |
AT5G42740 | Sugar isomerase (SIS) family protein;(source:Araport11) |
AT4G36970 | Remorin family protein;(source:Araport11) |
AT1G28570 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT1G77790 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
AT2G19825 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G57510 | cotton fiber protein;(source:Araport11) |
AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT1G53760 | K+-H+ exchange-like protein;(source:Araport11) |
AT2G43340 | hypothetical protein (DUF1685);(source:Araport11) |
AT4G36120 | filament-like protein (DUF869);(source:Araport11) |
AT1G52325 | Initiation factor eIF-4 gamma, MA3;(source:Araport11) |
AT3G57450 | hypothetical protein;(source:Araport11) |
AT4G32390 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT2G21700 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
AT4G03100 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
AT1G68580 | Agenet and bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
AT1G13145 | pseudogene of expressed protein;(source:Araport11) |
AT2G46995 | hypothetical protein;(source:Araport11) |
AT5G66455 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
AT3G21790 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G10490 | GNAT acetyltransferase (DUF699);(source:Araport11) |
AT4G33370 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT2G36410 | transcriptional activator (DUF662);(source:Araport11) |
AT5G53960 | Mid-1-related chloride channel domain-containing protein;(source:Araport11) |
AT3G59300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G14410 | Nucleotide/sugar transporter family protein |
AT4G27875 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
AT2G40980 | Protein kinase superfamily protein;(source:Araport11) |
AT4G28180 | hypothetical protein;(source:Araport11) |
AT3G02910 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT5G03560 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G53740 | hypothetical protein;(source:Araport11) |
AT1G14450 | NADH dehydrogenase (ubiquinone)s;(source:Araport11) |
AT1G22830 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G75230 | DNA glycosylase superfamily protein;(source:Araport11) |
AT5G43450 | encodes a protein whose sequence is similar to ACC oxidase |
AT1G12760 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT2G47380 | Cytochrome c oxidase subunit Vc family protein;(source:Araport11) |
AT3G04300 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT4G39952 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G17787 | cylicin;(source:Araport11) |
AT1G27752 | Ubiquitin system component Cue protein;(source:Araport11) |
AT5G39060 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.3e-252 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G41890 | curculin-like (mannose-binding) lectin family protein / PAN domain-containing protein;(source:Araport11) |
AT5G09445 | hypothetical protein;(source:Araport11) |
AT5G62400 | transmembrane protein;(source:Araport11) |
AT5G11620 | SWIM zinc finger family protein / mitogen-activated protein kinase kinase kinase (MAPKKK)-like protein;(source:Araport11) |
AT1G16320 | plant/protein (DUF2358);(source:Araport11) |
AT4G02540 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G42040 | WRC protein;(source:Araport11) |
AT5G19120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G39404 | other_RNA;(source:Araport11) |
AT5G42895 | Encodes a ECA1 gametogenesis related family protein |
AT3G26742 | hypothetical protein;(source:Araport11) |
AT1G15405 | other_RNA;(source:Araport11) |
AT5G57815 | Cytochrome c oxidase, subunit Vib family protein;(source:Araport11) |
AT3G25030 | RING/U-box superfamily protein;(source:Araport11) |
AT3G14600 | Ribosomal protein L18ae/LX family protein;(source:Araport11) |
AT3G06437 | pseudogene of hypothetical protein;(source:Araport11) |
AT2G38790 | hypothetical protein;(source:Araport11) |
AT4G11350 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
AT4G36230 | transmembrane protein;(source:Araport11) |
AT1G61350 | ARM repeat superfamily protein;(source:Araport11) |
AT5G45630 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT1G07040 | plant/protein;(source:Araport11) |
AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
AT4G21110 | G10 family protein;(source:Araport11) |
AT5G07215 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-34 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G25720 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT1G01225 | NC domain-containing protein-like protein;(source:Araport11) |
AT4G10400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT2G19650 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G17600 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G20030 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT5G03550 | MATH domain/coiled-coil protein;(source:Araport11) |
AT4G18230 | UDP-N-acetylglucosamine transferase subunit ALG14-like protein;(source:Araport11) |
AT5G57650 | eukaryotic translation initiation factor-like protein;(source:Araport11) |
AT5G67411 | GRAS family transcription factor;(source:Araport11) |
AT5G47620 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G14290 | Mitochondrial ribosomal protein L37;(source:Araport11) |
AT3G13510 | carboxyl-terminal peptidase, putative (DUF239);(source:Araport11) |
AT5G43910 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
AT5G48430 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G18050 | GPI-anchored protein;(source:Araport11) |
AT1G03810 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT1G26270 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
AT5G05200 | Protein kinase superfamily protein;(source:Araport11) |
AT5G54130 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
AT2G34760 | pseudogene of tubulin beta-9 chain;(source:Araport11) |
AT3G46700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G65305 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
AT2G03240 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT5G65207 | hypothetical protein;(source:Araport11) |
AT5G44020 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT5G24820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G51350 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G72070 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G01540 | Protein kinase superfamily protein;(source:Araport11) |
AT1G61890 | MATE efflux family protein;(source:Araport11) |
AT5G66631 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G34500 | Protein kinase superfamily protein;(source:Araport11) |
AT5G66330 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G57220 | Glycosyl transferase family 4 protein;(source:Araport11) |
AT3G51530 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G80250 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT3G49200 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT3G05905 | Natural antisense transcript overlaps with AT3G05900;(source:Araport11) |
AT3G57360 | tRNA-splicing endonuclease subunit;(source:Araport11) |
AT1G19430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G01710 | methyltransferase;(source:Araport11) |
AT3G04250 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G30320 | Remorin family protein;(source:Araport11) |
AT4G06534 | transmembrane protein;(source:Araport11) |
AT2G46250 | myosin heavy chain-like protein;(source:Araport11) |
AT1G35830 | VQ motif-containing protein;(source:Araport11) |
AT4G21870 | HSP20-like chaperone |
AT3G45256 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT1G58400 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT1G33780 | electron transporter, putative (DUF179);(source:Araport11) |
AT2G44020 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT2G24390 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT4G23490 | fringe-like protein (DUF604);(source:Araport11) |
AT3G45820 | hypothetical protein;(source:Araport11) |
AT3G15350 | G14 enzyme |
AT4G15240 | glycosyltransferase (DUF604);(source:Araport11) |
AT1G72852 | Natural antisense transcript overlaps with AT1G72850;(source:Araport11) |
AT3G56670 | F-box/associated interaction domain protein;(source:Araport11) |
AT1G70360 | F-box family protein;(source:Araport11) |
AT3G07565 | histone H2A deubiquitinase (DUF3755);(source:Araport11) |
AT5G14730 | Unknown protein, expression induced by IDL7 and stress. |
AT5G01881 | transmembrane protein;(source:Araport11) |
AT1G12830 | nucleolin;(source:Araport11) |
AT1G53780 | 26S proteasome regulatory complex ATPase;(source:Araport11) |
AT2G31985 | lipoprotein (DUF1264);(source:Araport11) |
AT5G26642 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G36905.1);(source:TAIR10) |
AT1G61370 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G47740 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
AT4G24090 | homer protein;(source:Araport11) |
AT5G45470 | transmembrane protein, putative (DUF594);(source:Araport11) |
AT5G63180 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G13640 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
AT5G48610 | myb-like protein X;(source:Araport11) |
AT4G17440 | chromogranin (DUF1639);(source:Araport11) |
AT1G30814 | hypothetical protein;(source:Araport11) |
AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G26280 | TRAF-like family protein;(source:Araport11) |
AT5G55856 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G10095 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
AT4G12731 | hypothetical protein;(source:Araport11) |
AT2G16690 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G41570.1);(source:TAIR10) |
AT5G15780 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT1G61050 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
AT4G38310 | Galactosyl transferase GMA12/MNN10 family protein;(source:Araport11) |
AT3G23510 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
AT1G33490 | E3 ubiquitin-protein ligase;(source:Araport11) |
AT1G75170 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT3G04020 | hypothetical protein;(source:Araport11) |
AT2G32179 | Natural antisense transcript overlaps with AT2G32180;(source:Araport11) |
AT3G11880 | transmembrane protein, putative (Protein of unknown function DUF2359, transmembrane);(source:Araport11) |
AT5G24320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G31940 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
AT3G27340 | Myb domain protein;(source:Araport11) |
AT5G64110 | Peroxidase superfamily protein;(source:Araport11) |
AT4G30500 | transmembrane protein (DUF788);(source:Araport11) |
AT4G32420 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT5G10750 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
AT3G63445 | Natural antisense transcript overlaps with AT3G63440;(source:Araport11) |
AT3G11930 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT2G41270 | pseudogene of strictosidine synthase-like 2;(source:Araport11) |
AT1G50325 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G27510 | 2-isopropylmalate synthase;(source:Araport11) |
AT3G04010 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G14760 | transmembrane protein;(source:Araport11) |
AT5G14080 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G69430 | Son of sevenless protein;(source:Araport11) |
AT5G66675 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT5G58610 | PHD finger transcription factor;(source:Araport11) |
AT3G13340 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G23880 | hypothetical protein;(source:Araport11) |
AT4G01410 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT1G70209 | hypothetical protein;(source:Araport11) |
AT2G29620 | dentin sialophosphoprotein;(source:Araport11) |
AT5G15260 | ribosomal protein L34e superfamily protein;(source:Araport11) |
AT4G00750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G02465 | hypothetical protein;(source:Araport11) |
AT1G22930 | T-complex protein 11;(source:Araport11) |
AT4G36010 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT3G60164 | Pseudogene of AT3G60966; protein binding / zinc ion binding |
AT2G04050 | MATE efflux family protein;(source:Araport11) |
AT4G37820 | transmembrane protein;(source:Araport11) |
AT2G34930 | disease resistance family protein / LRR family protein;(source:Araport11) |
AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT2G47480 | DUF3511 domain protein, putative (DUF3511);(source:Araport11) |
AT3G50400 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G15010 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
AT2G15950 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT1G12510 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT3G56200 | Encodes a putative amino acid transporter. The mRNA is cell-to-cell mobile. |
AT1G24080 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT3G05160 | Major facilitator superfamily protein;(source:Araport11) |
AT5G40640 | transmembrane protein;(source:Araport11) |
AT2G27520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G06410 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT2G25250 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT3G06530 | ARM repeat superfamily protein;(source:Araport11) |
AT3G21040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.7e-20 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G63420 | O-glucosyltransferase-like protein (DUF821);(source:Araport11) |
AT2G22760 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G17280 | oxidoreductase-like protein, amino-terminal protein;(source:Araport11) |
AT1G63870 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT2G13660 | hypothetical protein;(source:Araport11) |
AT5G54830 | DOMON domain-containing protein / dopamine beta-monooxygenase N-terminal domain-containing protein;(source:Araport11) |
AT1G06475 | transmembrane protein;(source:Araport11) |
AT3G15520 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT1G03515 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT5G18950 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G50000 | methyltransferase;(source:Araport11) |
AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G22790 | hypothetical protein;(source:Araport11) |
AT1G22110 | structural constituent of ribosome;(source:Araport11) |
AT3G26750 | HECT-like ubiquitin-conjugating enzyme (E2)-binding protein;(source:Araport11) |
AT4G23860 | PHD finger protein-like protein;(source:Araport11) |
AT5G19190 | hypothetical protein;(source:Araport11) |
AT5G61820 | stress up-regulated Nod 19 protein;(source:Araport11) |
AT1G76185 | NADH-ubiquinone oxidoreductase chain;(source:Araport11) |
AT4G17450 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-306 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G33475 | SNARE-like superfamily protein;(source:Araport11) |
AT1G51538 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
AT2G37440 | DNAse I-like superfamily protein;(source:Araport11) |
AT5G26200 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G20690 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
AT1G51380 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT5G66535 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT2G42150 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT1G12845 | transmembrane protein;(source:Araport11) |
AT3G07790 | DGCR14-like protein;(source:Araport11) |
AT4G27870 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
AT5G65660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G50520 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT4G00305 | RING/U-box superfamily protein;(source:Araport11) |
AT1G19480 | DNA glycosylase superfamily protein;(source:Araport11) |
AT1G73970 | obscurin-like protein;(source:Araport11) |
AT1G79300 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
AT5G26270 | transmembrane protein;(source:Araport11) |
AT3G42580 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G12100.1);(source:TAIR10) |
AT2G25780 | hypothetical protein (DUF1677);(source:Araport11) |
AT3G15470 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G27610 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
AT5G60720 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT2G24285 | zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT3G17020 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT1G11820 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G27325 | hydrolases, acting on ester bond;(source:Araport11) |
AT4G18500 | hypothetical protein;(source:Araport11) |
AT2G20830 | folic acid binding / transferase;(source:Araport11) |
AT2G42970 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G80960 | F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT1G50660 | actin cytoskeleton-regulatory complex pan-like protein;(source:Araport11) |
AT3G46450 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
AT1G50570 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G01050 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G16010 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein;(source:Araport11) |
AT4G15930 | Dynein light chain type 1 family protein;(source:Araport11) |
AT4G13180 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G12010 | C18orf8;(source:Araport11) |
AT2G45990 | ribosomal RNA small subunit methyltransferase G;(source:Araport11) |
AT1G53080 | Legume lectin family protein;(source:Araport11) |
AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G61540 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11) |
AT5G11475 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT4G17080 | Histone H3 K4-specific methyltransferase SET7/9 family protein;(source:Araport11) |
AT1G28650 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G35510 | O-fucosyltransferase family protein;(source:Araport11) |
AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT1G23050 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G39710 | Encodes a Cysteine-rich peptide (CRP) family protein |
AT4G38290 | hemolysin-III related integral membrane protein;(source:Araport11) |
AT3G17770 | Dihydroxyacetone kinase;(source:Araport11) |
AT1G64140 | WRKY transcription factor;(source:Araport11) |
AT5G03285 | other_RNA;(source:Araport11) |
AT4G27620 | intracellular protein transporter;(source:Araport11) |
AT4G17612 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT5G05520 | Outer membrane OMP85 family protein;(source:Araport11) |
AT1G02110 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
AT2G21130 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT2G18876 | Encodes a microtubule-associated protein. |
AT2G40450 | BTB/POZ domain-containing protein;(source:Araport11) |
AT1G61740 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT3G20200 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT4G32765 | pre-tRNA tRNA-Ser (anticodon: CGA);(source:Araport11, TAIR10) |
AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
AT2G30060 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
AT1G14730 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
AT5G42092 | Natural antisense transcript overlaps with AT5G42090;(source:Araport11) |
AT5G06685 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT2G15960 | Unknown protein. Expression decreased in response to proline. |
AT1G77730 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
AT1G33030 | O-methyltransferase family protein;(source:Araport11) |
AT1G35220 | FAM91 carboxy-terminus protein;(source:Araport11) |
AT1G10410 | CW14 protein (DUF1336);(source:Araport11) |
AT4G35985 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
AT5G04860 | splicing factor 3A subunit;(source:Araport11) |
AT3G27330 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT5G02435 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT1G21990 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT2G43990 | GPI-anchored adhesin-like protein;(source:Araport11) |
AT1G57720 | Translation elongation factor EF1B, gamma chain;(source:Araport11) |
AT2G37540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G76220 | hypothetical protein (DUF241);(source:Araport11) |
AT5G49170 | hypothetical protein;(source:Araport11) |
AT3G09690 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G22430 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
AT5G03250 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT5G17760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G62280 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G14315 | transmembrane protein;(source:Araport11) |
AT5G41870 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G38710 | AMMECR1 family;(source:Araport11) |
AT2G04340 | cytoplasmic dynein 2 light intermediate chain;(source:Araport11) |
AT5G11660 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT1G78265 | Natural antisense transcript overlaps with AT1G78270;(source:Araport11) |
AT3G51950 | Contains single CCCH domain. |
AT1G11170 | lysine ketoglutarate reductase trans-splicing-like protein (DUF707);(source:Araport11) |
AT3G48070 | RING/U-box superfamily protein;(source:Araport11) |
AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
AT3G52660 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G25205 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.0e-33 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G42290 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G71235 | hypothetical protein;(source:Araport11) |
AT2G45590 | Protein kinase superfamily protein;(source:Araport11) |
AT3G06870 | proline-rich family protein;(source:Araport11) |
AT2G48030 | DNAse I-like superfamily protein;(source:Araport11) |
AT2G46600 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT3G54880 | zinc finger protein;(source:Araport11) |
AT2G22795 | hypothetical protein;(source:Araport11) |
AT4G15765 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT1G55230 | proteinase inhibitor I4, serpin (DUF716);(source:Araport11) |
AT4G39570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G73770 | coiled-coil protein;(source:Araport11) |
AT3G26730 | RING/U-box superfamily protein;(source:Araport11) |
AT4G12270 | Copper amine oxidase family protein;(source:Araport11) |
AT5G42840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G38820 | DNA-directed RNA polymerase subunit beta-beta protein, putative (DUF506);(source:Araport11) |
AT3G12410 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G15880 | golgin family A protein;(source:Araport11) |
AT3G01450 | ARM repeat superfamily protein;(source:Araport11) |
AT2G44735 | transmembrane protein;(source:Araport11) |
AT5G61445 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT5G07740 | actin binding protein;(source:Araport11) |
AT4G31890 | ARM repeat superfamily protein;(source:Araport11) |
AT2G47020 | Peptide chain release factor 1;(source:Araport11) |
AT2G25690 | DUF581 family protein, putative (DUF581);(source:Araport11) |
AT2G30710 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT1G05135 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167. |
AT3G62400 | cytochrome C oxidase subunit;(source:Araport11) |
AT1G61200 | homeobox-leucine zipper protein-like protein;(source:Araport11) |
AT3G10770 | Single-stranded nucleic acid binding R3H protein;(source:Araport11) |
AT5G05430 | RNA-binding protein;(source:Araport11) |
AT5G13980 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
AT3G48240 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT2G02870 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G05080 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G65860 | ankyrin repeat family protein;(source:Araport11) |
AT1G10740 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G01715 | pseudogene of RNI-like superfamily protein;(source:Araport11) |
AT5G65120 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
AT5G47970 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT3G42150 | transmembrane protein;(source:Araport11) |
AT3G52285 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT2G13665 | Natural antisense transcript overlaps with AT2G13660;(source:Araport11) |
AT5G54970 | hypothetical protein;(source:Araport11) |
AT1G60560 | SWIM zinc finger family protein;(source:Araport11) |
AT1G21670 | DPP6 amino-terminal domain protein;(source:Araport11) |
AT4G01090 | Hypothetical protein; participates in wound-induced lateral root development. |
AT5G23700 | coiled-coil protein;(source:Araport11) |
AT5G25040 | Major facilitator superfamily protein;(source:Araport11) |
AT4G33440 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G35070 | transmembrane protein;(source:Araport11) |
AT4G30800 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT5G15240 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT2G44280 | Major facilitator superfamily protein;(source:Araport11) |
AT5G01380 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G55110 | Stigma-specific Stig1 family protein;(source:Araport11) |
AT1G28350 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
AT1G20300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G46680 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G04600 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
AT1G12320 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
AT1G08985 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT4G17200 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G16235 | Natural antisense transcript overlaps with AT5G16230;(source:Araport11) |
AT3G59200 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G25360 | hypothetical protein;(source:Araport11) |
AT3G47080 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G46540 | ENTH/VHS family protein;(source:Araport11) |
AT2G31981 | hypothetical protein;(source:Araport11) |
AT3G24927 | pseudogene of expressed protein;(source:Araport11) |
AT5G54860 | Major facilitator superfamily protein;(source:Araport11) |
AT3G26720 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
AT5G67220 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
AT3G53170 | LOW protein: PPR containing protein;(source:Araport11) |
AT2G47710 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT4G04790 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G66900 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G30380 | Encodes a Plant Natriuretic Peptide (PNP). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. |
AT3G23145 | ATP binding / aminoacyl-tRNA ligase/ nucleotide binding protein;(source:Araport11) |
AT5G43065 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.5e-20 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G52980 | ER-based factor for assembly of V-ATPase;(source:Araport11) |
AT2G25737 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT1G11440 | hypothetical protein;(source:Araport11) |
AT4G25580 | CAP160 protein;(source:Araport11) |
AT4G22190 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT4G11670 | DNA topoisomerase 4 subunit B (DUF810);(source:Araport11) |
AT5G61800 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G03290 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT3G15550 | trichohyalin;(source:Araport11) |
AT1G01840 | AP2-like ethylene-responsive transcription factor SNZ;(source:Araport11) |
AT5G49746 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-20 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT5G67488 | Natural antisense transcript overlaps with AT5G67490;(source:Araport11) |
AT1G16290 | transglycosylase;(source:Araport11) |
AT1G27110 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G00755 | F-box family protein;(source:Araport11) |
AT3G51400 | hypothetical protein (DUF241);(source:Araport11) |
AT1G17545 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G05060 | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein |
AT1G55525 | other_RNA;(source:Araport11) |
AT1G29640 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT1G78040 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT4G11450 | bromo-adjacent domain protein, putative (DUF3527);(source:Araport11) |
AT3G12650 | transmembrane protein;(source:Araport11) |
AT2G18721 | hypothetical protein;(source:Araport11) |
AT2G41190 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT5G50995 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT1G26921 | hypothetical protein;(source:Araport11) |
AT5G41640 | Mutants have decreased tolerance to osmotic stress. |
AT4G36390 | Methylthiotransferase;(source:Araport11) |
AT4G37570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G52410.1);(source:TAIR10) |
AT5G19850 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G28040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT3G26890 | meiosis chromosome segregation family protein;(source:Araport11) |
AT4G23515 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT1G02470 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT3G03700 | Plasma-membrane choline transporter family protein;(source:Araport11) |
AT1G73210 | hypothetical protein (DUF789);(source:Araport11) |
AT3G54363 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G03113 | transmembrane protein;(source:Araport11) |
AT3G10974 | hypothetical protein;(source:Araport11) |
AT3G22970 | hypothetical protein (DUF506);(source:Araport11) |
AT2G20940 | transmembrane protein, putative (DUF1279);(source:Araport11) |
AT1G79120 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT3G52480 | transmembrane protein;(source:Araport11) |
AT2G34730 | myosin heavy chain-like protein;(source:Araport11) |
AT5G03705 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
AT2G45040 | Matrixin family protein;(source:Araport11) |
AT5G43180 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
AT4G02480 | AAA-type ATPase family protein;(source:Araport11) |
AT1G27480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G80630 | RNI-like superfamily protein;(source:Araport11) |
AT4G35810 | 2-oxoglutarate-dependent dioxygenase |
AT1G55340 | hypothetical protein (DUF1639);(source:Araport11) |
AT4G39790 | bZIP transcription factor, putative (DUF630 and DUF632);(source:Araport11) |
AT1G49580 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
AT5G41730 | Protein kinase family protein;(source:Araport11) |
AT2G34123 | Encodes a defensin-like (DEFL) family protein. |
AT1G12020 | hypothetical protein;(source:Araport11) |
AT2G46735 | death domain associated protein;(source:Araport11) |
AT2G33690 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
AT1G15030 | Encodes a Cysteine-rich peptide (CRP) family protein |
AT1G67480 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G19460 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G27700 | zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein;(source:Araport11) |
AT1G69400 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G28330 | F-box family protein-like protein;(source:Araport11) |
AT3G50910 | netrin receptor DCC;(source:Araport11) |
AT5G18630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G29660 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
AT1G21790 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT1G72620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G05950 | hypothetical protein;(source:Araport11) |
AT2G20725 | CAAX amino terminal protease family protein;(source:Araport11) |
AT1G62420 | DUF506 family protein (DUF506);(source:Araport11) |
AT1G14990 | transmembrane protein;(source:Araport11) |
AT1G18410 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G79480 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT2G26370 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G17616 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G14910 | Rab3 GTPase-activating protein non-catalytic subunit;(source:Araport11) |
AT2G18320 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G42235 | Encodes a defensin-like (DEFL) family protein. |
AT4G13030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G25840 | DUF1677 family protein (DUF1677);(source:Araport11) |
AT5G18770 | F-box/FBD-like domains containing protein;(source:Araport11) |
AT2G46150 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G60310 | acyl-CoA synthetase family protein;(source:Araport11) |
AT3G11720 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT5G12043 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G03170 | hypothetical protein;(source:Araport11) |
AT5G16900 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G66130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G12835 | hypothetical protein;(source:Araport11) |
AT3G10970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G19540 | NmrA-like negative transcriptional regulator family protein;(source:Araport11) |
AT5G44065 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G01330 | Protein kinase superfamily protein;(source:Araport11) |
AT5G64430 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT4G21745 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
AT3G28193 | transmembrane protein;(source:Araport11) |
AT3G50825 | snoRNA;(source:Araport11) |
AT3G61825 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
AT5G03360 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
AT1G26860 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01700.1);(source:TAIR10) |
AT1G25400 | transmembrane protein;(source:Araport11) |
AT1G51540 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G65560 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G20515 | Natural antisense transcript overlaps with AT1G20520;(source:Araport11) |
AT3G22104 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G26085 | CAAX amino terminal protease family protein;(source:Araport11) |
AT1G06470 | Nucleotide/sugar transporter family protein;(source:Araport11) |
AT5G66050 | Wound-responsive family protein;(source:Araport11) |
AT3G15534 | hypothetical protein;(source:Araport11) |
AT5G65650 | sugar transporter, putative (DUF1195);(source:Araport11) |
AT4G32290 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G31010 | Protein kinase superfamily protein;(source:Araport11) |
AT1G80450 | VQ motif-containing protein;(source:Araport11) |
AT1G10050 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
AT3G61898 | transmembrane protein;(source:Araport11) |
AT3G11415 | other_RNA;(source:Araport11) |
AT1G76020 | Thioredoxin superfamily protein;(source:Araport11) |
AT1G69520 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G56210 | ARM repeat superfamily protein;(source:Araport11) |
AT2G01667 | hypothetical protein;(source:Araport11) |
AT3G55795 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT3G61750 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
AT4G26940 | Galactosyltransferase family protein;(source:Araport11) |
AT4G30993 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT2G20250 | hypothetical protein;(source:Araport11) |
AT5G18470 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
AT4G19110 | Protein kinase superfamily protein;(source:Araport11) |
AT1G62050 | Ankyrin repeat family protein;(source:Araport11) |
AT4G26580 | RING/U-box superfamily protein;(source:Araport11) |
AT3G44516 | Pseudogene of AT1G31990; unknown protein |
AT1G72110 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT2G17350 | beta-mannosyltransferase-like protein;(source:Araport11) |
AT5G20310 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT2G19850 | transcription repressor;(source:Araport11) |
AT1G32920 | hypothetical protein;(source:Araport11) |
AT1G64410 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G52960.1);(source:TAIR10) |
AT1G75760 | ER lumen protein retaining receptor family protein;(source:Araport11) |
AT2G21500 | RING/U-box superfamily protein;(source:Araport11) |
AT1G69523 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G18370 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT3G03341 | cold-regulated protein;(source:Araport11) |
AT5G27705 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-58 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT1G15830 | hypothetical protein;(source:Araport11) |
AT1G32928 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
AT1G15810 | S15/NS1, RNA-binding protein;(source:Araport11) |
AT2G16710 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
AT1G57730 | RING/U-box superfamily protein;(source:Araport11) |
AT2G40860 | protein kinase family protein / protein phosphatase 2C ( PP2C) family protein;(source:Araport11) |
AT1G79060 | TPRXL;(source:Araport11) |
AT1G13195 | RING/U-box superfamily protein;(source:Araport11) |
AT5G03900 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
AT3G44950 | glycine-rich protein;(source:Araport11) |
AT5G10455 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT5G03870 | Glutaredoxin family protein;(source:Araport11) |
AT1G20820 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT4G02370 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
AT5G60290 | hypothetical protein;(source:Araport11) |
AT5G59060 | reverse transcriptase family protein;(source:Araport11) |
AT5G12190 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G61755 | pre-tRNA tRNA-Ala (anticodon: CGC);(source:Araport11, TAIR10) |
AT2G36885 | translation initiation factor;(source:Araport11) |
AT5G54870 | inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11) |
AT1G52800 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G63290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G16510 | YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein;(source:Araport11) |
AT1G36050 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
AT3G47010 | Glycosyl hydrolase family protein;(source:Araport11) |
AT5G56800 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT4G32480 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
AT3G62710 | Glycosyl hydrolase family protein;(source:Araport11) |
AT1G78800 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G32740 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT3G24255 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT1G52550 | transmembrane protein;(source:Araport11) |
AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G38200 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
AT3G62470 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G06220 | LETM1-like protein;(source:Araport11) |
AT1G80020 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.0e-62 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G56690 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G13970 | midasin-like protein;(source:Araport11) |
AT1G79190 | ARM repeat superfamily protein;(source:Araport11) |
AT1G73750 | alpha/beta hydrolase family protein;(source:Araport11) |
AT3G17640 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G26500 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G08610 | NADH dehydrogenase ubiquinone 1 alpha subcomplex subunit;(source:Araport11) |
AT1G02380 | transmembrane protein;(source:Araport11) |
AT1G15740 | Leucine-rich repeat family protein;(source:Araport11) |
AT3G52070 | RNA/RNP complex-1-interacting phosphatase;(source:Araport11) |
AT1G80570 | RNI-like superfamily protein;(source:Araport11) |
AT1G33615 | None;(source:Araport11) |
AT1G52540 | Protein kinase superfamily protein;(source:Araport11) |
AT4G16980 | arabinogalactan-protein family;(source:Araport11) |
AT3G46387 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-41 P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi|2443320|dbj|BAA22288.1| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10) |
AT5G09630 | LisH/CRA/RING-U-box domains-containing protein;(source:Araport11) |
AT3G45090 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G07710 | hypothetical protein;(source:Araport11) |
AT3G50900 | hypothetical protein;(source:Araport11) |
AT1G22230 | nucleolar GTP-binding protein;(source:Araport11) |
AT1G31240 | Bromodomain transcription factor;(source:Araport11) |
AT4G37440 | hypothetical protein;(source:Araport11) |
AT3G17450 | hAT dimerization domain-containing protein;(source:Araport11) |
AT5G41780 | myosin heavy chain-like protein;(source:Araport11) |
AT3G51640 | stress response NST1-like protein;(source:Araport11) |
AT4G28811 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G01350 | Zinc finger (CCCH-type/C3HC4-type RING finger) family protein;(source:Araport11) |
AT2G23390 | acyl-CoA;(source:Araport11) |
AT1G71828 | Potential natural antisense gene, locus overlaps with AT1G71830 |
AT3G11280 | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
AT5G50990 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G10100 | transposable_element_gene;(source:Araport11);similar to ASY2, DNA binding [Arabidopsis thaliana] (TAIR:AT4G32200.1);(source:TAIR10) |
AT3G50230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G45860 | hypothetical protein;(source:Araport11) |
AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
AT2G36540 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G30940 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
AT4G24350 | Phosphorylase superfamily protein;(source:Araport11) |
AT1G01830 | ARM repeat superfamily protein;(source:Araport11) |
AT2G43240 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT2G35850 | transmembrane protein;(source:Araport11) |
AT3G28570 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G14185 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
AT3G23600 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G15090 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT1G79990 | coatomer subunit beta-2;(source:Araport11) |
AT1G15970 | DNA glycosylase superfamily protein;(source:Araport11) |
AT3G15780 | transmembrane protein;(source:Araport11) |
AT3G07460 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT3G56300 | Cysteinyl-tRNA synthetase, class Ia family protein;(source:Araport11) |
AT3G16175 | Thioesterase superfamily protein;(source:Araport11) |
AT5G64501 | pseudogene of pyrophosphorylase 6;(source:Araport11) |
AT1G63720 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G21440 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G09740 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT1G09220 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G50250 | transmembrane protein;(source:Araport11) |
AT3G03430 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT4G15080 | DHHC-type zinc finger family protein;(source:Araport11) |
AT5G59940 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G44478 | Cyclophilin;(source:Araport11) |
AT4G31075 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
AT2G23348 | transmembrane protein;(source:Araport11) |
AT1G02360 | Chitinase family protein;(source:Araport11) |
AT3G05300 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
AT5G18940 | Mo25 family protein;(source:Araport11) |
AT3G51090 | coiled-coil 90B-like protein (DUF1640);(source:Araport11) |
AT5G66568 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT1G69300 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT1G72480 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT3G07570 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
AT4G25170 | Uncharacterized conserved protein (UCP012943);(source:Araport11) |
AT5G60190 | Encodes a protein that can cleave residues from the C-terminus of RUB1 to prepare it for conjugation to target proteins. |
AT1G02550 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G20220 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT1G06860 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT5G25210 | hypothetical protein;(source:Araport11) |
AT3G01690 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G24780 | hypothetical protein;(source:Araport11) |
AT4G21215 | transmembrane protein;(source:Araport11) |
AT2G24380 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
AT2G37680 | glucose-induced degradation-like protein;(source:Araport11) |
AT5G19070 | SNARE associated Golgi protein family;(source:Araport11) |
AT5G10560 | Glycosyl hydrolase family protein;(source:Araport11) |
AT1G66190 | hypothetical protein;(source:Araport11) |
AT4G22233 | Natural antisense transcript overlaps with AT4G22235;(source:Araport11) |
AT5G14495 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT4G39140 | RING/U-box superfamily protein;(source:Araport11) |
AT3G47341 | transmembrane protein;(source:Araport11) |
AT1G76170 | 2-thiocytidine tRNA biosynthesis protein, TtcA;(source:Araport11) |
AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
AT2G38800 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT2G37480 | hypothetical protein;(source:Araport11) |
AT3G23760 | transferring glycosyl group transferase;(source:Araport11) |
AT5G62080 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G45745 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
AT2G37975 | Yos1-like protein;(source:Araport11) |
AT3G49540 | hypothetical protein;(source:Araport11) |
AT1G01440 | hypothetical protein (DUF3133);(source:Araport11) |
AT1G18415 | Natural antisense transcript overlaps with AT1G18420;(source:Araport11) |
AT1G80850 | DNA glycosylase superfamily protein;(source:Araport11) |
AT4G01110 | late embryogenesis abundant hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G31510 | major centromere autoantigen B-like protein;(source:Araport11) |
AT5G01070 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT5G59600 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G49270 | extensin-like protein;(source:Araport11) |
AT2G44030 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G63900 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
AT5G45020 | Glutathione S-transferase family protein;(source:Araport11) |
AT1G11655 | hypothetical protein;(source:Araport11) |
AT1G29560 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT3G07350 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
AT2G23790 | calcium uniporter (DUF607);(source:Araport11) |
AT3G27390 | transmembrane protein;(source:Araport11) |
AT2G47485 | hypothetical protein;(source:Araport11) |
AT5G46710 | PLATZ transcription factor family protein;(source:Araport11) |
AT1G66110 | hypothetical protein (DUF577);(source:Araport11) |
AT1G11380 | PLAC8 family protein;(source:Araport11) |
AT1G56145 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
AT1G54230 | Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
AT3G62725 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-41 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G09850 | D111/G-patch domain-containing protein;(source:Araport11) |
AT3G19790 | hypothetical protein;(source:Araport11) |
AT5G01750 | LURP-one-like protein (DUF567);(source:Araport11) |
AT3G43850 | hypothetical protein;(source:Araport11) |
AT4G27840 | SNARE-like superfamily protein;(source:Araport11) |
AT3G03855 | Annotated as pseudogene of disease resistance protein.Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
AT5G08350 | Mutants have decreased tolerance to cold and oxidative stress. Gene expression induced by drought and ABA. |
AT3G59340 | solute carrier family 35 protein (DUF914);(source:Araport11) |
AT1G55152 | hypothetical protein;(source:Araport11) |
AT1G01305 | hypothetical protein;(source:Araport11) |
AT2G41570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G16690.1);(source:TAIR10) |
AT3G45050 | transmembrane protein;(source:Araport11) |
AT1G79980 | pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10) |
AT1G11700 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT1G32700 | PLATZ transcription factor family protein;(source:Araport11) |
AT1G77370 | Glutaredoxin family protein;(source:Araport11) |
AT1G54680 | translation initiation factor 3 subunit I;(source:Araport11) |
AT3G04350 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
AT2G39920 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT1G69910 | Protein kinase superfamily protein;(source:Araport11) |
AT5G67150 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G02180 | ferredoxin-like protein;(source:Araport11) |
AT1G71970 | hypothetical protein;(source:Araport11) |
AT5G16380 | autophagy-like protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT3G58000 | VQ motif-containing protein;(source:Araport11) |
AT5G02385 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT5G48480 | Lactoylglutathione lyase / glyoxalase I family protein;(source:Araport11) |
AT2G36030 | hypothetical protein;(source:Araport11) |
AT2G44040 | Dihydrodipicolinate reductase, bacterial/plant;(source:Araport11) |
AT1G63860 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G04030 | eisosome protein;(source:Araport11) |
AT2G47500 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
AT3G15055 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
AT3G46600 | GRAS family transcription factor;(source:Araport11) |
AT3G53370 | S1FA-like DNA-binding protein;(source:Araport11) |
AT4G24231 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G53350 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT1G49740 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT1G75070 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT3G13370 | formin-like protein;(source:Araport11) |
AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT4G39380 | TSL-kinase interacting-like protein;(source:Araport11) |
AT3G13335 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT2G27900 | coiled-coil protein;(source:Araport11) |
AT4G37175 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT3G54400 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G60150 | NADH dehydrogenase ubiquinone 1 alpha subcomplex assembly factor-like protein (DUF498/DUF598);(source:Araport11) |
AT1G65720 | transmembrane protein;(source:Araport11) |
AT1G14710 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G31330 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
AT1G01300 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G27720 | Major facilitator superfamily protein;(source:Araport11) |
AT4G12735 | Encodes a peroxisomal protein. |
AT2G41745 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 28%25 identity and 4.7e-24 P-value to GP|20279456|gb|AAM18736.1|AC092548_14|AC092548 putative reverse transcriptase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT1G09440 | Protein kinase superfamily protein;(source:Araport11) |
AT4G39590 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G49900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G54625 | Natural antisense transcript overlaps with AT3G54630;(source:Araport11) |
AT2G30362 | Natural antisense transcript overlaps with AT2G30360;(source:Araport11) |
AT1G55840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT5G61520 | Major facilitator superfamily protein;(source:Araport11) |
AT3G21215 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G56920 | DHHC-type zinc finger family protein;(source:Araport11) |
AT3G15548 | transmembrane protein;(source:Araport11) |
AT2G23370 | cyclin delta-3;(source:Araport11) |
AT2G18180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G50910 | hypothetical protein;(source:Araport11) |
AT1G52360 | Coatomer, beta subunit;(source:Araport11) |
AT1G08940 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT5G59530 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT5G07572 | hypothetical protein;(source:Araport11) |
AT4G19470 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G45095 | hypothetical protein;(source:Araport11) |
AT5G45480 | transmembrane protein, putative (DUF594);(source:Araport11) |
AT4G16180 | transmembrane protein;(source:Araport11) |
AT1G69290 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G66540 | U3 small nucleolar ribonucleoprotein;(source:Araport11) |
AT4G38545 | Natural antisense transcript overlaps with AT4G38530 and AT4G38540;(source:Araport11) |
AT1G26900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G26590 | C2H2-like zinc finger protein;(source:Araport11) |
AT2G31945 | transmembrane protein;(source:Araport11) |
AT4G05018 | transmembrane protein;(source:Araport11) |
AT5G01030 | enolase, putative (DUF3527);(source:Araport11) |
AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
AT1G01240 | transmembrane protein;(source:Araport11) |
AT5G44286 | snoRNA;(source:Araport11) |
AT5G64540 | mucin-like protein;(source:Araport11) |
AT5G44250 | peptidase, S9A/B/C family, catalytic domain protein (Protein of unknown function DUF829, transmembrane 53);(source:Araport11) |
AT2G34185 | hypothetical protein;(source:Araport11) |
AT3G51730 | saposin B domain-containing protein;(source:Araport11) |
AT1G52600 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
AT3G22550 | NAD(P)H-quinone oxidoreductase subunit, putative (DUF581);(source:Araport11) |
AT1G05960 | ARM repeat superfamily protein;(source:Araport11) |
AT5G42830 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G61185 | Encodes a defensin-like (DEFL) family protein. |
AT1G17390 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G36905.1);(source:TAIR10) |
AT1G58170 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT1G21480 | Exostosin family protein;(source:Araport11) |
AT1G36622 | transmembrane protein;(source:Araport11) |
AT4G14500 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT2G45710 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
AT4G39195 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT4G37895 | Natural antisense transcript overlaps with AT4G37890;(source:Araport11) |
AT3G05625 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G30505 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G17270 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
AT4G31520 | SDA1 family protein;(source:Araport11) |
AT2G30945 | None;(source:Araport11) |
AT4G35530 | phosphatidylinositolglycan-like protein;(source:Araport11) |
AT5G24610 | cyclic AMP-responsive element-binding protein;(source:Araport11) |
AT3G60760 | hypothetical protein;(source:Araport11) |
AT5G02370 | ATP binding microtubule motor family protein;(source:Araport11) |
AT3G62070 | hypothetical protein;(source:Araport11) |
AT2G21780 | hypothetical protein;(source:Araport11) |
AT4G23820 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G47180 | Plant VAMP (vesicle-associated membrane protein) family protein;(source:Araport11) |
AT5G61940 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT2G30984 | Natural antisense transcript overlaps with AT2G30985;(source:Araport11) |
AT5G09960 | sorbin/SH3 domain protein;(source:Araport11) |
AT4G20300 | Serine/Threonine-kinase, putative (DUF1639);(source:Araport11) |
AT2G36220 | hypothetical protein;(source:Araport11) |
AT5G40720 | C3H4 type zinc finger protein (DUF23);(source:Araport11) |
AT3G25930 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT1G48680 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-298 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G25433 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
AT2G34610 | cotton fiber protein;(source:Araport11) |
AT2G42760 | DUF1685 family protein;(source:Araport11) |
AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT2G04250 | pseudogene of ribonuclease H;(source:Araport11) |
AT3G24180 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
AT1G80865 | hypothetical protein;(source:Araport11) |
AT3G51720 | WEB family protein (DUF827);(source:Araport11) |
AT2G27500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT3G27420 | bromodomain testis-specific protein;(source:Araport11) |
AT4G25400 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G25820 | Exostosin family protein;(source:Araport11) |
AT1G69610 | zinc finger FYVE domain protein, putative (DUF1666);(source:Araport11) |
AT4G36052 | Natural antisense transcript overlaps with AT4G36050;(source:Araport11) |
AT1G07280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G47815 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-38 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G01680 | Ankyrin repeat family protein;(source:Araport11) |
AT1G24160 | triadin;(source:Araport11) |
AT5G23760 | Copper transport protein family;(source:Araport11) |
AT3G02270 | Trimeric LpxA-like enzyme;(source:Araport11) |
AT2G47410 | WD40 domain-containing protein;(source:Araport11) |
AT4G16745 | Exostosin family protein;(source:Araport11) |
AT5G01110 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT5G37400 | hypothetical protein (DUF577);(source:Araport11) |
AT5G47225 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
AT5G39070 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.9e-50 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G24165 | hypothetical protein;(source:Araport11) |
AT2G33180 | hypothetical protein;(source:Araport11) |
AT5G10460 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G06800 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
AT3G02750 | Protein phosphatase 2C family protein;(source:Araport11) |
AT4G36925 | transmembrane protein;(source:Araport11) |
AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
AT3G47560 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G23201 | GCK domain protein;(source:Araport11) |
AT1G02816 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
AT3G11560 | LETM1-like protein;(source:Araport11) |
AT1G72600 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G23340 | RNI-like superfamily protein;(source:Araport11) |
AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT5G14370 | CCT motif family protein;(source:Araport11) |
AT3G52100 | RING/FYVE/PHD zinc finger-containing protein. Part of emdomembrane trafficking system. |
AT3G12915 | Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11) |
AT3G18230 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT1G53180 | hypothetical protein;(source:Araport11) |
AT5G02080 | phosphopantothenate-cysteine ligase-like protein;(source:Araport11) |
AT4G10280 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT2G31585 | other_RNA;(source:Araport11) |
AT5G49850 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT3G44380 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G02840 | ARM repeat superfamily protein;(source:Araport11) |
AT3G56810 | hypothetical protein;(source:Araport11) |
AT3G02125 | pinin-like protein;(source:Araport11) |
AT4G12115 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT3G09595 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
AT1G75490 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
AT1G52370 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
AT1G19650 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT2G05540 | Glycine-rich protein family;(source:Araport11) |
AT5G20110 | Dynein light chain type 1 family protein;(source:Araport11) |
AT3G05190 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein;(source:Araport11) |
AT3G24612 | snoRNA;(source:Araport11) |
AT3G54190 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G19300 | methyltransferase C9orf114 protein;(source:Araport11) |
AT5G44255 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.5e-09 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT5G11550 | ARM repeat superfamily protein;(source:Araport11) |
AT5G49280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G18700 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT2G38830 | Ubiquitin-conjugating enzyme/RWD-like protein;(source:Araport11) |
AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
AT5G58390 | Peroxidase superfamily protein;(source:Araport11) |
AT3G19440 | Pseudouridine synthase family protein;(source:Araport11) |
AT3G20820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G12220 | hypothetical protein;(source:Araport11) |
AT1G75810 | transmembrane protein;(source:Araport11) |
AT5G67550 | transmembrane protein;(source:Araport11) |
AT4G32440 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
AT1G73066 | Leucine-rich repeat family protein;(source:Araport11) |
AT1G20070 | hypothetical protein;(source:Araport11) |
AT1G01630 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT2G36780 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G11640 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT1G49500 | transcription initiation factor TFIID subunit 1b-like protein;(source:Araport11) |
AT5G62910 | RING/U-box superfamily protein;(source:Araport11) |
AT3G11320 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT2G29995 | PSY3-like protein;(source:Araport11) |
AT1G18290 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT2G18720 | Translation elongation factor EF1A/initiation factor IF2gamma family protein;(source:Araport11) |
AT2G17860 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT3G28200 | Peroxidase superfamily protein;(source:Araport11) |
AT4G04820 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G24930.1);(source:TAIR10) |
AT1G56220 | Dormancy/auxin associated family protein;(source:Araport11) |
AT2G32520 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G22120 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G32291 | Pseudogene of AT2G31470; F-box family protein |
AT5G27730 | heparan-alpha-glucosaminide N-acetyltransferase-like protein (DUF1624);(source:Araport11) |
AT1G64600 | copper ion binding / methyltransferase;(source:Araport11) |
AT2G16595 | Translocon-associated protein (TRAP), alpha subunit;(source:Araport11) |
AT5G16360 | NC domain-containing protein-like protein;(source:Araport11) |
AT4G37020 | initiation factor 4A-like protein;(source:Araport11) |
AT4G03340 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G03990 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
AT5G08240 | transmembrane protein;(source:Araport11) |
AT3G61820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G01710 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
AT5G06540 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G66890 | 50S ribosomal-like protein;(source:Araport11) |
AT5G18460 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
AT5G48605 | Encodes a defensin-like (DEFL) family protein. |
AT1G11320 | GDSL esterase/lipase;(source:Araport11) |
AT3G56050 | Protein kinase family protein;(source:Araport11) |
AT1G68526 | hypothetical protein;(source:Araport11) |
AT2G32235 | hypothetical protein;(source:Araport11) |
AT4G28940 | Phosphorylase superfamily protein;(source:Araport11) |
AT4G30670 | Putative membrane lipoprotein;(source:Araport11) |
AT4G15790 | uveal autoantigen with coiled-coil/ankyrin;(source:Araport11) |
AT1G67790 | sieve element occlusion protein;(source:Araport11) |
AT3G11285 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
AT3G52710 | hypothetical protein;(source:Araport11) |
AT1G57980 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT3G17120 | transmembrane protein;(source:Araport11) |
AT5G04840 | bZIP protein;(source:Araport11) |
AT3G12150 | alpha/beta hydrolase family protein;(source:Araport11) |
AT4G08860 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT2G27870.1);(source:TAIR10) |
AT1G12330 | cyclin-dependent kinase-like protein;(source:Araport11) |
AT2G33360 | cadherin EGF LAG seven-pass G-type receptor, putative (DUF3527);(source:Araport11) |
AT5G15805 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT5G04250 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT4G33130 | rho GTPase-activating protein;(source:Araport11) |
AT3G57350 | Nucleoporin interacting component (Nup93/Nic96-like) family protein;(source:Araport11) |
AT3G14075 | Mono-/di-acylglycerol lipase, N-terminal;(source:Araport11) |
AT1G65000 | F-box only protein;(source:Araport11) |
AT5G21070 | Fe(3+) dicitrate transport system permease;(source:Araport11) |
AT2G31018 | hypothetical protein;(source:Araport11) |
AT3G19340 | aminopeptidase (DUF3754);(source:Araport11) |
AT5G22850 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G02515 | hypothetical protein;(source:Araport11) |
AT1G23330 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G75190 | hypothetical protein;(source:Araport11) |
AT4G33467 | hypothetical protein;(source:Araport11) |
AT1G05980 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
AT3G25870 | hypothetical protein;(source:Araport11) |
AT1G07590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G02450 | Ribosomal protein L36e family protein;(source:Araport11) |
AT1G15175 | Natural antisense transcript overlaps with AT1G15170;(source:Araport11) |
AT4G13400 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT5G58800 | Quinone reductase family protein;(source:Araport11) |
AT3G21030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-16 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT4G38870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G27200 | Cupredoxin superfamily protein;(source:Araport11) |
AT5G60460 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
AT1G02630 | Nucleoside transporter family protein;(source:Araport11) |
AT4G39900 | adenine deaminase;(source:Araport11) |
AT3G12685 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
AT3G51644 | hypothetical protein;(source:Araport11) |
AT1G09590 | Translation protein SH3-like family protein;(source:Araport11) |
AT1G27290 | transmembrane protein;(source:Araport11) |
AT4G26288 | hypothetical protein;(source:Araport11) |
AT4G04690 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G63295 | Remorin family protein;(source:Araport11) |
AT3G50790 | esterase/lipase/thioesterase family protein;(source:Araport11) |
AT1G12460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G10980 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-44 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT4G28550 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT2G33630 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G06620 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
AT4G39610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT4G23960 | F-box family protein;(source:Araport11) |
AT5G40670 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
AT2G21510 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT3G55430 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G56275 | pseudogene of expressed protein;(source:Araport11) |
AT4G09750 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G30680 | Initiation factor eIF-4 gamma, MA3;(source:Araport11) |
AT2G33320 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT4G02715 | flocculation FLO11-like protein;(source:Araport11) |
AT1G07100 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
AT5G01090 | Concanavalin A-like lectin family protein;(source:Araport11) |
AT4G24805 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT3G06455 | ubiquitin family protein;(source:Araport11) |
AT4G12070 | hypothetical protein;(source:Araport11) |
AT4G15960 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G12730 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G57840 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091) |
AT1G17147 | VQ motif-containing protein;(source:Araport11) |
AT1G09421 | Natural antisense transcript overlaps with AT1G09420;(source:Araport11) |
AT3G24615 | Encodes a Z43 snoRNA. Gb: AJ240080 |
AT5G40275 | other_RNA;(source:Araport11) |
AT1G30130 | DUF1365 family protein;(source:Araport11) |
AT5G16810 | Protein kinase superfamily protein;(source:Araport11) |
AT3G08660 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT1G04700 | PB1 domain-containing protein tyrosine kinase;(source:Araport11) |
AT2G15980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G46220 | DUF2358 family protein (DUF2358);(source:Araport11) |
AT1G18940 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
AT1G53220 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
AT1G18270 | ketose-bisphosphate aldolase class-II family protein;(source:Araport11) |
AT1G75560 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT1G15120 | Ubiquinol-cytochrome C reductase hinge protein;(source:Araport11) |
AT4G20790 | Leucine-rich repeat protein kinase family protein |
AT1G34630 | transmembrane protein;(source:Araport11) |
AT4G34910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G49950 | GRAS family transcription factor;(source:Araport11) |
AT1G55820 | lysine-specific demethylase, putative (DUF1296);(source:Araport11) |
AT5G15430 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT4G32105 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G20520 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
AT1G31850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G37520 | Peroxidase superfamily protein;(source:Araport11) |
AT1G51400 | Photosystem II 5 kD protein;(source:Araport11) |
AT3G25950 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT5G21105 | Plant L-ascorbate oxidase;(source:Araport11) |
AT3G47000 | Glycosyl hydrolase family protein;(source:Araport11) |
AT4G38690 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT3G62550 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT3G20555 | hypothetical protein;(source:Araport11) |
AT5G35320 | DBH-like monooxygenase;(source:Araport11) |
AT4G31960 | hypothetical protein;(source:Araport11) |
AT3G47540 | Chitinase family protein;(source:Araport11) |
AT1G03520 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT4G18501 | hypothetical protein;(source:Araport11) |
AT2G33175 | transmembrane protein;(source:Araport11) |
AT5G04390 | C2H2-type zinc finger family protein;(source:Araport11) |
AT3G11510 | Ribosomal protein S11 family protein;(source:Araport11) |
AT3G24670 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G49790 | Carbohydrate-binding protein;(source:Araport11) |
AT1G25375 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
AT2G23520 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT2G41380 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G04855 | hypothetical protein;(source:Araport11) |
AT5G15640 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT5G59350 | transmembrane protein;(source:Araport11) |
AT5G46270 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G21570 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT3G62245 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
AT3G11325 | Phospholipid/glycerol acyltransferase family protein;(source:Araport11) |
AT2G40230 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G06570 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G24350 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
AT1G04200 | dyggve-melchior-clausen syndrome protein;(source:Araport11) |
AT3G22100 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G03700 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
AT5G39895 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT3G46385 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G24810 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT1G77200 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT5G53440 | LOW protein: zinc finger CCCH domain protein;(source:Araport11) |
AT5G49100 | vitellogenin-like protein;(source:Araport11) |
AT1G16040 | phosphatidylinositol-glycan biosynthesis class F-like protein;(source:Araport11) |
AT1G73120 | F-box/RNI superfamily protein;(source:Araport11) |
AT4G32160 | Phox (PX) domain-containing protein;(source:Araport11) |
AT4G36648 | other_RNA;(source:Araport11) |
AT1G76065 | LYR family of Fe/S cluster biogenesis protein;(source:Araport11) |
AT2G44730 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
AT2G36320 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT4G32930 | hypothetical protein;(source:Araport11) |
AT1G17670 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT1G20040 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
AT2G46308 | transmembrane protein;(source:Araport11) |
AT1G54670 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
AT5G17847 | hypothetical protein;(source:Araport11) |
AT2G25800 | elongation factor Ts (DUF810);(source:Araport11) |
AT3G12970 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT3G01590 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT5G62140 | ATP-dependent Clp protease ATP-binding subunit;(source:Araport11) |
AT2G38350 | hypothetical protein;(source:Araport11) |
AT5G64180 | tropomyosin;(source:Araport11) |
AT5G65015 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
AT4G24810 | similar to ABC1 family protein, contains InterPro domain ABC1 protein (InterPro:IPR004147) |
AT4G36945 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT4G22235 | Encodes a defensin-like (DEFL) family protein. |
AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT2G30985 | hypothetical protein;(source:Araport11) |
AT4G26950 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT2G40110 | Yippee family putative zinc-binding protein;(source:Araport11) |
AT5G22044 | pseudogene of zinc finger (C3HC4-type RING finger) protein |
AT5G41740 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT2G14080 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G34415 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
AT4G27657 | hypothetical protein;(source:Araport11) |
AT3G02832 | other_RNA;(source:Araport11) |
AT1G64420 | pre-tRNA tRNA-Ala (anticodon: CGC);(source:Araport11, TAIR10) |
AT4G12590 | ER membrane protein complex subunit-like protein (Protein of unknown function DUF106, transmembrane);(source:Araport11) |
AT5G60978 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
AT5G59140 | BTB/POZ domain-containing protein;(source:Araport11) |
AT1G61100 | disease resistance protein (TIR class);(source:Araport11) |
AT4G24565 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT4G03010 | RNI-like superfamily protein;(source:Araport11) |
AT1G71110 | transmembrane protein;(source:Araport11) |
AT4G18150 | Serine/Threonine-kinase, putative (DUF1296);(source:Araport11) |
AT5G44060 | embryo sac development arrest protein;(source:Araport11) |
AT2G43235 | phosphoribosylformylglycinamidine synthase;(source:Araport11) |
AT2G32970 | G1/S-specific cyclin-E protein;(source:Araport11) |
AT5G07430 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G26692 | Natural antisense transcript overlaps with AT2G26690;(source:Araport11) |
AT5G02000 | hypothetical protein;(source:Araport11) |
AT5G02815 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
AT3G52230 | hypothetical protein;(source:Araport11) |
AT2G47680 | zinc finger (CCCH type) helicase family protein;(source:Araport11) |
AT3G07670 | Rubisco methyltransferase family protein;(source:Araport11) |
AT5G53270 | Seed maturation protein;(source:Araport11) |
AT2G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G50020 | tubulin alpha-6 chain;(source:Araport11) |
AT3G10780 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT3G23330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G30100 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT1G03730 | pyrroline-5-carboxylate reductase;(source:Araport11) |
AT5G47229 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G52720 | hypothetical protein;(source:Araport11) |
AT5G60590 | DHBP synthase RibB-like alpha/beta domain-containing protein;(source:Araport11) |
AT4G14000 | Putative methyltransferase family protein;(source:Araport11) |
AT1G63430 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G35360 | ubiquitin family protein;(source:Araport11) |
AT4G25410 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G01542 | Natural antisense transcript overlaps with AT5G01540;(source:Araport11) |
AT4G34140 | D111/G-patch domain-containing protein;(source:Araport11) |
AT5G04750 | F1F0-ATPase inhibitor protein;(source:Araport11) |
AT4G37250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G17230 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT2G34186 | hypothetical protein;(source:Araport11) |
AT4G25835 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G13410 | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase;(source:Araport11) |
AT5G61190 | putative endonuclease or glycosyl hydrolase with C2H2-type zinc finger domain-containing protein;(source:Araport11) |
AT5G63063 | Encodes a Plant thionin family protein |
AT5G66530 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT1G12450 | SNARE associated Golgi protein family;(source:Araport11) |
AT5G59490 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G75530 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
AT3G06780 | glycine-rich protein;(source:Araport11) |
AT3G11773 | Thioredoxin superfamily protein;(source:Araport11) |
AT1G78350 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 9.0e-42 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT3G12590 | hypothetical protein;(source:Araport11) |
AT1G04780 | Ankyrin repeat family protein;(source:Araport11) |
AT2G42320 | nucleolar protein gar2-like protein;(source:Araport11) |
AT5G50130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
AT5G10320 | ATP synthase subunit B;(source:Araport11) |
AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
AT5G45650 | subtilase family protein;(source:Araport11) |
AT1G33450 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G04780.2);(source:TAIR10) |
AT4G18070 | suppressor;(source:Araport11) |
AT4G26650 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G29452 | hypothetical protein;(source:Araport11) |
AT3G57380 | Glycosyltransferase family 61 protein;(source:Araport11) |
AT1G25275 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
AT1G26773 | hypothetical protein;(source:Araport11) |
AT1G27670 | transmembrane protein;(source:Araport11) |
AT3G61670 | extra-large G-like protein, putative (DUF3133);(source:Araport11) |
AT5G14440 | Surfeit locus protein 2 (SURF2);(source:Araport11) |
AT3G15900 | homoserine O-acetyltransferase;(source:Araport11) |
AT5G16210 | HEAT repeat-containing protein;(source:Araport11) |
AT4G36750 | Quinone reductase family protein;(source:Araport11) |
AT3G19895 | RING/U-box superfamily protein;(source:Araport11) |
AT5G13770 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT3G01705 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT4G03115 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
AT1G66820 | glycine-rich protein;(source:Araport11) |
AT4G19865 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G52710 | Rubredoxin-like superfamily protein;(source:Araport11) |
AT2G25964 | hypothetical protein;(source:Araport11) |
AT5G41401 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G55820 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
AT2G17845 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G79660 | ephrin-A3 protein;(source:Araport11) |
AT1G60610 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT4G33905 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT3G59680 | Serine/Threonine-kinase;(source:Araport11) |
AT1G27000 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
AT5G46060 | spastin, putative (Protein of unknown function, DUF599);(source:Araport11) |
AT1G15430 | hypothetical protein (DUF1644);(source:Araport11) |
AT3G27350 | transcriptional regulator ATRX-like protein;(source:Araport11) |
AT1G03580 | pseudogene of MATH domain/coiled-coil protein;(source:Araport11) |
AT3G62580 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT3G09320 | DHHC-type zinc finger family protein;(source:Araport11) |
AT3G06770 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G37100 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT5G64505 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT4G09580 | SNARE associated Golgi protein family;(source:Araport11) |
AT5G19860 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT5G21090 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G13390 | translocase subunit seca;(source:Araport11) |
AT2G36430 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT5G62290 | nucleotide-sensitive chloride conductance regulator (ICln) family protein;(source:Araport11) |
AT5G25940 | early nodulin-like protein;(source:Araport11) |
AT4G25690 | stress response NST1-like protein;(source:Araport11) |
AT4G00695 | Spc97/Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
AT5G47710 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
AT1G07885 | hypothetical protein;(source:Araport11) |
AT1G34230 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0041J06.18, blastp match of 33%25 identity and 2.8e-10 P-value to GP|27818010|dbj|BAC55773.1||AP005176 OSJNBb0041J06.18 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT2G17710 | Big1;(source:Araport11) |
AT3G25597 | transmembrane protein;(source:Araport11) |
AT4G22530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G19130 | GPI transamidase component family protein / Gaa1-like family protein;(source:Araport11) |
AT3G10750 | FBD domain family;(source:Araport11) |
AT3G47090 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G80170 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G56260 | Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase;(source:Araport11) |
AT2G31590 | hypothetical protein;(source:Araport11) |
AT3G28500 | 60S acidic ribosomal protein family;(source:Araport11) |
AT2G44430 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT5G63630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G62540 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G35732 | hypothetical protein;(source:Araport11) |
AT1G12990 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT4G12690 | DUF868 family protein (DUF868);(source:Araport11) |
AT1G50040 | formin-like protein, putative (DUF1005);(source:Araport11) |
AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
AT4G29780 | Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes. |
AT5G03880 | Thioredoxin family protein;(source:Araport11) |
AT4G28830 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G22560 | sulfated surface-like glycoprotein;(source:Araport11) |
AT3G27590 | reverse transcriptase family protein;(source:Araport11) |
AT5G06755 | hypothetical protein;(source:Araport11) |
AT1G34620 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.5e-75 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT4G36460 | transmembrane protein;(source:Araport11) |
AT3G59926 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT1G26650 | Son of sevenless protein;(source:Araport11) |
AT1G27330 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
AT5G56747 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-45 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G67880 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G76470 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G56700 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
AT2G38465 | hypothetical protein;(source:Araport11) |
AT5G16140 | Peptidyl-tRNA hydrolase family protein;(source:Araport11) |
AT1G51200 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT1G09480 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase The mRNA is cell-to-cell mobile. |
AT1G31130 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
AT1G22040 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G02210 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
AT2G21180 | transmembrane protein;(source:Araport11) |
AT1G28310 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT4G17430 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G03290 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
AT1G44790 | ChaC-like family protein;(source:Araport11) |
AT2G26500 | cytochrome b6f complex subunit (petM);(source:Araport11) |
AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT3G49925 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT1G56660 | MAEBL domain protein;(source:Araport11) |
AT5G48540 | receptor-like protein kinase-related family protein;(source:Araport11) |
AT4G38330 | hemolysin-III integral membrane-like protein;(source:Araport11) |
AT5G09760 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G56240 | hapless protein;(source:Araport11) |
AT5G43440 | encodes a protein whose sequence is similar to ACC oxidase |
AT5G35310 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-24 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT4G01023 | RING/U-box superfamily protein;(source:Araport11) |
AT4G24590 | RING finger protein;(source:Araport11) |
AT5G21020 | transmembrane protein;(source:Araport11) |
AT1G69060 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G09520 | hypothetical protein;(source:Araport11) |
AT5G59070 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G07820 | Histone superfamily protein;(source:Araport11) |
AT1G01180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G17560 | Ribosomal protein L19 family protein;(source:Araport11) |
AT4G25290 | DNA photolyase;(source:Araport11) |
AT5G66755 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT3G51450 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT1G18191 | Pseudogene of AT1G18200; AtRABA6b (Arabidopsis Rab GTPase homolog A6b); GTP binding |
AT2G29060 | GRAS family transcription factor;(source:Araport11) |
AT1G70010 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.2e-289 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G69360 | T-box transcription factor, putative (DUF863);(source:Araport11) |
AT3G13277 | other_RNA;(source:Araport11) |
AT3G61080 | Protein kinase superfamily protein;(source:Araport11) |
AT1G48080 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT1G32049 | pseudogene of RPB1a;(source:Araport11) |
AT4G13110 | BSD domain-containing protein;(source:Araport11) |
AT3G20898 | hypothetical protein;(source:Araport11) |
AT5G43790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
AT4G35880 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G07290 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G61830 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G14180 | RING/U-box superfamily protein;(source:Araport11) |
AT5G23665 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
AT3G02820 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT3G18215 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
AT3G25580 | Thioredoxin superfamily protein;(source:Araport11) |
AT3G27570 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
AT3G10035 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
AT1G48070 | Thioredoxin superfamily protein;(source:Araport11) |
AT1G12310 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT3G27825 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G07760 | formin homology 2 domain-containing protein / FH2 domain-containing protein;(source:Araport11) |
AT5G57060 | 60S ribosomal L18a-like protein;(source:Araport11) |
AT5G15853 | hypothetical protein;(source:Araport11) |
AT4G35720 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
AT1G45010 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT1G52615 | other_RNA;(source:Araport11) |
AT3G19200 | hypothetical protein;(source:Araport11) |
AT5G19970 | GRAS family transcription factor family protein;(source:Araport11) |
AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
AT4G15590 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-50 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G54020 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G14890 | potassium transporter;(source:Araport11) |
AT4G35750 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
AT4G21520 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G53840 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G03400 | A single copy gene that encodes a protein with sequence similarity to tomato E8 (ACC oxidase, the last step in ethylene biosynthesis) involved in ethylene synthesis and fruit ripening in tomato. This gene is not induced by ethylene in siliques. The transcript is found in siliques, etiolated seedlings, leaves, stems and flowers. |
AT3G16415 | pseudogene of myrosinase-binding protein 2;(source:Araport11) |
AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
AT4G16190 | Papain family cysteine protease;(source:Araport11) |
AT4G36790 | Major facilitator superfamily protein;(source:Araport11) |
AT2G34985 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
AT5G55640 | Na-translocating NADH-quinone reductase subunit A;(source:Araport11) |
AT1G09410 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT1G55675 | transmembrane protein;(source:Araport11) |
AT3G03040 | F-box/RNI-like superfamily protein. Idenfitied in GWAS as locus involved in response to the defense molecule, allyl glucosinolate. |
AT5G60030 | hypothetical protein;(source:Araport11) |
AT1G54575 | hypothetical protein;(source:Araport11) |
AT1G27100 | Actin cross-linking protein;(source:Araport11) |
AT1G68140 | zinc finger/BTB domain protein, putative (DUF1644);(source:Araport11) |
AT5G50361 | hypothetical protein;(source:Araport11) |
AT1G01940 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT5G44290 | Protein kinase superfamily protein;(source:Araport11) |
AT5G59732 | Natural antisense transcript overlaps with AT5G59730. The RNA is cell-to-cell mobile. |
AT2G20724 | Annotated as pseudogene of unknown protein.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
AT4G31070 | PPR superfamily protein;(source:Araport11) |
AT4G19450 | Major facilitator superfamily protein;(source:Araport11) |
AT2G19840 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-301 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G10290 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT5G04235 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.2e-38 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G29654 | transmembrane protein;(source:Araport11) |
AT1G60970 | SNARE-like superfamily protein;(source:Araport11) |
AT1G03687 | DTW domain-containing protein;(source:Araport11) |
AT4G01865 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT2G42955 | F-box/LRR protein;(source:Araport11) |
AT1G30200 | F-box family protein;(source:Araport11) |
AT5G52430 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G38420 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G21755 | Natural antisense transcript overlaps with AT3G21760;(source:Araport11) |
AT5G47660 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G37860 | SPT2 chromatin protein;(source:Araport11) |
AT3G57980 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT2G30560 | Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. The current predicted structure is not well supported (T8, one *). The predicted proteins can be found in doi.org/10.1007/s00425-005-0174-z |
AT3G46920 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
AT1G14600 | Homeodomain-like superfamily protein;(source:Araport11) |
AT3G03240 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G48745 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
AT4G10140 | transmembrane protein;(source:Araport11) |
AT2G40113 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT5G03050 | knotted 1-binding protein;(source:Araport11) |
AT2G47850 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT2G30840 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
AT5G39080 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT2G28080 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G10970 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT1G77500 | DUF630 family protein, putative (DUF630 and DUF632);(source:Araport11) |
AT1G79540 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G16565 | threonyl and alanyl tRNA synthetase second additional domain-containing protein;(source:Araport11) |
AT4G25620 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G62710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G09520 | Cofactor-independent phosphoglycerate mutase;(source:Araport11) |
AT3G20900 | transmembrane protein;(source:Araport11) |
AT1G21695 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G60960 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G67365 | Natural antisense transcript overlaps with AT1G67370;(source:Araport11) |
AT2G04690 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
AT4G19860 | Encodes a cytosolic calcium-independent phospholipase A. |
AT3G01085 | Protein kinase superfamily protein;(source:Araport11) |
AT5G51390 | hypothetical protein;(source:Araport11) |
AT1G61440 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G70450 | Its expression is enriched in root hair cells (compared to non-root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in root hair cells relative to non-root hair cells. |
AT1G29630 | 5-3 exonuclease family protein;(source:Araport11) |
AT3G11150 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT2G31800 | Integrin-linked protein kinase family;(source:Araport11) |
AT5G49710 | RING finger protein;(source:Araport11) |
AT1G45403 | membrane protein;(source:Araport11) |
AT5G66820 | transmembrane protein;(source:Araport11) |
AT3G52105 | DIS3-exonuclease-like protein;(source:Araport11) |
AT1G08592 | Natural antisense transcript overlaps with AT1G08590;(source:Araport11) |
AT5G51470 | Auxin-responsive GH3 family protein;(source:Araport11) |
AT5G59055 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT1G74830 | myosin-binding protein, putative (Protein of unknown function, DUF593);(source:Araport11) |
AT5G10570 | Encodes a myo-inositol hexakisphosphate kinase. |
AT3G06868 | vitellogenin-like protein;(source:Araport11) |
AT1G18210 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT2G47200 | hypothetical protein;(source:Araport11) |
AT5G65340 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT5G09443 | Natural antisense transcript overlaps with AT5G09445;(source:Araport11) |
AT1G75480 | pseudogene of gamma-glutamyl hydrolase 1;(source:Araport11) |
AT5G10946 | hypothetical protein;(source:Araport11) |
AT1G21780 | BTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B. |
AT2G22080 | transmembrane protein;(source:Araport11) |
AT2G42370 | hypothetical protein;(source:Araport11) |
AT3G59695 | Natural antisense transcript overlaps with AT3G59690;(source:Araport11) |
AT5G18310 | ubiquitin hydrolase;(source:Araport11) |
AT5G05090 | Homeodomain-like superfamily protein;(source:Araport11) |
AT2G44410 | RING/U-box superfamily protein;(source:Araport11) |
AT5G41110 | meiosis chromosome segregation family protein;(source:Araport11) |
AT2G42365 | Natural antisense transcript overlaps with AT2G42360 and AT2G42370;(source:Araport11) |
AT4G19160 | transglutaminase family protein;(source:Araport11) |
AT2G27660 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G60075 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT1G26290 | hypothetical protein;(source:Araport11) |
AT5G05800 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT5G59385 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT3G06680 | Ribosomal L29e protein family;(source:Araport11) |
AT5G62330 | hypothetical protein;(source:Araport11) |
AT1G66330 | senescence-associated family protein;(source:Araport11) |
AT5G09450 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G33590 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G32900 | Peptidyl-tRNA hydrolase II (PTH2) family protein;(source:Araport11) |
AT4G01740 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G52780 | PII, uridylyltransferase (DUF2921);(source:Araport11) |
AT1G15260 | LOW protein: ATP-dependent RNA helicase-like protein;(source:Araport11) |
AT1G09580 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT5G50330 | Protein kinase superfamily protein;(source:Araport11) |
AT2G15800 | transposable_element_gene;(source:Araport11) |
AT1G04000 | hypothetical protein;(source:Araport11) |
AT2G18970 | hypothetical protein;(source:Araport11) |
AT1G34010 | hypothetical protein;(source:Araport11) |
AT1G75200 | flavodoxin family protein / radical SAM domain-containing protein;(source:Araport11) |
AT2G31740 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G08320 | E2F-associated phosphoprotein;(source:Araport11) |
AT5G48790 | LOW PSII ACCUMULATION protein (DUF1995);(source:Araport11) |
AT1G33420 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT5G59945 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT3G53270 | Small nuclear RNA activating complex (SNAPc), subunit SNAP43 protein;(source:Araport11) |
AT2G01310 | hypothetical protein;(source:Araport11) |
AT2G42770 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT2G47690 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
AT5G37017 | Pseudogene of AT5G16486 |
AT4G09890 | mediator of RNA polymerase II transcription subunit, putative (DUF3511);(source:Araport11) |
AT3G61962 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G22608 | hypothetical protein;(source:Araport11) |
AT2G44200 | pre-mRNA splicing factor domain-containing protein;(source:Araport11) |
AT4G38550 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT1G73050 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
AT3G62650 | hypothetical protein;(source:Araport11) |
AT1G02813 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
AT3G14800 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.1e-83 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
AT4G23493 | hypothetical protein;(source:Araport11) |
AT3G17030 | Nucleic acid-binding proteins superfamily;(source:Araport11) |
AT2G31820 | Ankyrin repeat family protein;(source:Araport11) |
AT3G23085 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.1e-91 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G02360 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT5G44345 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G61530 | small G protein family protein / RhoGAP family protein;(source:Araport11) |
AT4G03410 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT1G71240 | chromosome-partitioning protein, putative (DUF639);(source:Araport11) |
AT4G35510 | PHD finger-like protein;(source:Araport11) |
AT3G15480 | fiber (DUF1218);(source:Araport11) |
AT1G26990 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-294 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G23080 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT4G19140 | exopolysaccharide production negative regulator;(source:Araport11) |
AT5G56790 | Protein kinase superfamily protein;(source:Araport11) |
AT2G42730 | F-box/FBD/LRR protein;(source:Araport11) |
AT5G02090 | hypothetical protein;(source:Araport11) |
AT4G35850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G41810 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
AT4G28088 | Low temperature and salt responsive protein family;(source:Araport11) |
AT2G18690 | transmembrane protein;(source:Araport11) |
AT3G62000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G20950 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT4G10360 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
AT2G27360 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G02050 | Mitochondrial glycoprotein family protein;(source:Araport11) |
AT1G45160 | Protein kinase superfamily protein;(source:Araport11) |
AT4G23205 | other_RNA;(source:Araport11) |
AT3G15578 | hypothetical protein;(source:Araport11) |
AT5G13810 | Glutaredoxin family protein;(source:Araport11) |
AT3G45955 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
AT5G13560 | structural maintenance of chromosomes protein;(source:Araport11) |
AT2G15300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G29950 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT1G74780 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
AT1G45040 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT3G07195 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
AT2G31990 | Exostosin family protein;(source:Araport11) |
AT1G71710 | DNAse I-like superfamily protein;(source:Araport11) |
AT4G36170 | hypothetical protein;(source:Araport11) |
AT5G01790 | hypothetical protein;(source:Araport11) |
AT3G50350 | membrane insertase, putative (DUF1685);(source:Araport11) |
AT3G51980 | ARM repeat superfamily protein;(source:Araport11) |
AT5G05985 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
AT2G16670 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-190 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
AT4G18660 | delay of germination protein;(source:Araport11) |
AT1G45150 | alpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase;(source:Araport11) |
AT3G52535 | Natural antisense transcript overlaps with AT3G52540;(source:Araport11) |
AT4G33666 | hypothetical protein;(source:Araport11) |
AT5G13760 | Plasma-membrane choline transporter family protein;(source:Araport11) |
AT5G23250 | Succinyl-CoA ligase, alpha subunit;(source:Araport11) |
AT1G35430 | transmembrane protein;(source:Araport11) |
AT2G44370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G38120 | ARM repeat superfamily protein;(source:Araport11) |
AT1G16515 | transmembrane protein;(source:Araport11) |
AT1G53710 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT1G17090 | transmembrane protein;(source:Araport11) |
AT1G18340 | basal transcription factor complex subunit-like protein;(source:Araport11) |
AT1G19340 | Methyltransferase MT-A70 family protein;(source:Araport11) |
AT5G55960 | transmembrane protein C9orf5 protein;(source:Araport11) |
AT5G47310 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
AT2G37530 | forkhead box protein G1;(source:Araport11) |
AT2G35840 | Sucrose-6F-phosphate phosphohydrolase family protein;(source:Araport11) |
AT2G03020 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
AT3G52700 | hypothetical protein;(source:Araport11) |
AT3G04650 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT5G26146 | Natural antisense transcript overlaps with AT5G26150;(source:Araport11) |
AT5G14430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G44910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT2G01580 | transmembrane protein;(source:Araport11) |
AT5G57885 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT3G12390 | Nascent polypeptide-associated complex (NAC), alpha subunit family protein;(source:Araport11) |
AT5G45430 | Protein kinase superfamily protein;(source:Araport11) |
AT4G21213 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G74790 | catalytics;(source:Araport11) |
AT5G42440 | Protein kinase superfamily protein;(source:Araport11) |
AT1G75800 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT4G37530 | Peroxidase superfamily protein;(source:Araport11) |
AT1G54290 | Translation initiation factor SUI1 family protein;(source:Araport11) |
AT5G01215 | Natural antisense transcript overlaps with AT5G01210;(source:Araport11) |
AT5G22460 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G58640 | Selenoprotein, Rdx type;(source:Araport11) |
AT3G11402 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G50900 | ARM repeat superfamily protein;(source:Araport11) |
AT5G02480 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT2G46620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G25590 | micronuclear linker histone polyprotein-like protein;(source:Araport11) |
AT3G19850 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT5G55530 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G06270 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G24890 | stress response NST1-like protein;(source:Araport11) |
AT1G36730 | Translation initiation factor IF2/IF5;(source:Araport11) |
AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT3G19680 | hypothetical protein (DUF1005);(source:Araport11) |
AT1G06590 | anaphase-promoting complex subunit;(source:Araport11) |
AT1G01080 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G02010 | Protein kinase superfamily protein;(source:Araport11) |
AT2G46730 | pseudogene of galacturonosyltransferase-like protein;(source:Araport11) |
AT4G09970 | transmembrane protein;(source:Araport11) |
AT5G48657 | defense protein-like protein;(source:Araport11) |
AT1G73490 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G26440 | transmembrane protein, putative (DUF707);(source:Araport11) |
AT3G56010 | transmembrane protein;(source:Araport11) |
AT3G28695 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT1G73655 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT1G25460 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G04680 | Ankyrin repeat family protein;(source:Araport11) |
AT1G20250 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT3G04854 | hypothetical protein;(source:Araport11) |
AT4G16748 | other_RNA;(source:Araport11) |
AT3G07470 | DUF538 protein |
AT3G07320 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT5G25770 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G48040 | Protein phosphatase 2C family protein;(source:Araport11) |
AT2G44660 | ALG6, ALG8 glycosyltransferase family;(source:Araport11) |
AT5G14350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G01650 | Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11) |
AT1G61667 | serine protease, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT4G33140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT3G60380 | cotton fiber protein;(source:Araport11) |
AT3G02715 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT3G57930 | rho GTPase-activating gacO-like protein;(source:Araport11) |
AT1G15270 | Translation machinery associated TMA7;(source:Araport11) |
AT1G26160 | Metal-dependent phosphohydrolase;(source:Araport11) |
AT5G16650 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G06440 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT3G43660 | The gene encodes a putative nodulin-like21 protein. |
AT4G35670 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G63020 | hypothetical protein (DUF3049);(source:Araport11) |
AT4G27654 | transmembrane protein;(source:Araport11) |
AT2G33855 | transmembrane protein;(source:Araport11) |
AT1G66490 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G28295 | hypothetical protein;(source:Araport11) |
AT1G54740 | FANTASTIC four-like protein (DUF3049);(source:Araport11) |
AT4G33310 | hypothetical protein;(source:Araport11) |
AT4G23620 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11) |
AT1G64290 | F-box protein-like protein;(source:Araport11) |
AT2G29510 | hypothetical protein (DUF3527);(source:Araport11) |
AT1G55200 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT3G29760 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G13310 | hypothetical protein;(source:Araport11) |
AT5G65470 | O-fucosyltransferase family protein;(source:Araport11) |
AT4G21460 | Ribosomal protein S24/S35;(source:Araport11) |
AT1G65820 | microsomal glutathione s-transferase;(source:Araport11) |
AT3G22121 | Natural antisense transcript overlaps with AT3G22120. The RNA is cell-to-cell mobile. |
AT5G19340 | hypothetical protein;(source:Araport11) |
AT4G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G01740 | Unknown gene, induced by abiotic stress treatments. |
AT1G26730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT5G35370 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G34412 | EKC/KEOPS complex subunit tprkb-like protein;(source:Araport11) |
AT5G05250 | hypothetical protein;(source:Araport11) |
AT3G48140 | B12D protein;(source:Araport11) |
AT1G12380 | hypothetical protein;(source:Araport11) |
AT4G16146 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
AT2G23110 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
AT2G18969 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
AT1G76720 | eukaryotic translation initiation factor 2 (eIF-2) family protein;(source:Araport11) |
AT5G54760 | Translation initiation factor SUI1 family protein;(source:Araport11) |
AT3G04360 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G17400 | F-box family protein;(source:Araport11) |
AT5G12040 | Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein;(source:Araport11) |
AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G06010 | basic leucine zipper/W2 domain protein;(source:Araport11) |
AT3G06760 | Drought-responsive family protein;(source:Araport11) |
AT1G12500 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT5G01210 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT2G46580 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
AT5G27035 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.6e-16 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT5G39785 | hypothetical protein (DUF1666);(source:Araport11) |
AT1G64430 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G24570 | hypothetical protein;(source:Araport11) |
AT1G80280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G19200 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
AT5G44283 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
AT4G27595 | Encodes a microtubule-associated protein. |
AT3G22070 | proline-rich family protein;(source:Araport11) |
AT5G55045 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT2G41550 | Rho termination factor;(source:Araport11) |
AT1G54985 | pseudogene of receptor like protein 13;(source:Araport11) |
AT3G51340 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G15359 | hypothetical protein;(source:Araport11) |
AT4G01600 | GRAM domain family protein;(source:Araport11) |
AT4G20100 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
AT2G40095 | Alpha/beta hydrolase related protein;(source:Araport11) |
AT1G13990 | plant/protein;(source:Araport11) |
AT5G01420 | Glutaredoxin family protein;(source:Araport11) |
AT4G00085 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT1G01800 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G55840 | PPR superfamily protein;(source:Araport11) |
AT5G65290 | LMBR1-like membrane protein;(source:Araport11) |
AT4G30390 | UDP-arabinopyranose mutase;(source:Araport11) |
AT2G37950 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G50620 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G16930 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT4G09630 | transmembrane protein (DUF616);(source:Araport11) |
AT1G23440 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
AT5G48270 | DUF868 family protein (DUF868);(source:Araport11) |
AT4G00520 | Acyl-CoA thioesterase family protein;(source:Araport11) |
AT4G08240 | histone-lysine N-methyltransferase;(source:Araport11) |
AT2G47844 | hypothetical protein;(source:Araport11) |
AT5G16220 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT3G59930 | Encodes a defensin-like (DEFL) family protein. |
AT2G16250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G22820 | hypothetical protein;(source:Araport11) |
AT1G45165 | Expressed protein;(source:Araport11) |
AT5G02580 | argininosuccinate lyase;(source:Araport11) |
AT3G61700 | helicase with zinc finger protein;(source:Araport11) |
AT5G15420 | hypothetical protein;(source:Araport11) |
AT1G35513 | pseudogene of isochorismate synthase-related / isochorismate mutase-related |
AT4G24204 | RING/U-box superfamily protein;(source:Araport11) |
AT5G43455 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT4G00895 | ATPase, F1 complex, OSCP/delta subunit protein;(source:Araport11) |
AT3G22520 | spindle assembly abnormal protein;(source:Araport11) |
AT2G40250 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT5G19570 | transmembrane protein;(source:Araport11) |
AT5G18640 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G13710 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G16100 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT1G15002 | Natural antisense transcript overlaps with AT1G15000;(source:Araport11) |
AT2G41400 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT1G03610 | plant/protein (DUF789);(source:Araport11) |
AT5G14770 | PPR repeat protein;(source:Araport11) |
AT1G52347 | None;(source:Araport11) |
AT1G71070 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT3G20710 | F-box family protein;(source:Araport11) |
AT1G78260 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G04810 | 26S proteasome regulatory complex, non-ATPase subcomplex, Rpn2/Psmd1 subunit;(source:Araport11) |
AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G42110 | hypothetical protein;(source:Araport11) |
AT4G37022 | hypothetical protein;(source:Araport11) |
AT3G16200 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
AT5G47860 | Gut esterase (DUF1350);(source:Araport11) |
AT3G03440 | ARM repeat superfamily protein;(source:Araport11) |
AT2G19930 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
AT4G36660 | polyol transporter, putative (DUF1195);(source:Araport11) |
AT4G05150 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT1G71910 | hypothetical protein;(source:Araport11) |
AT3G10530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G18900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G15242 | other_RNA;(source:Araport11) |
AT2G46060 | transmembrane protein-like protein;(source:Araport11) |
AT2G36835 | hypothetical protein;(source:Araport11) |
AT3G50270 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G46260 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G59020 | ARM repeat superfamily protein;(source:Araport11) |
AT2G05812 | Natural antisense transcript overlaps with AT2G05810;(source:Araport11) |
AT5G58510 | Rab3 GTPase-activating protein catalytic protein;(source:Araport11) |
AT4G38552 | Natural antisense transcript overlaps with AT4G38550;(source:Araport11) |
AT1G01870 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
AT1G06002 | Natural antisense transcript overlaps with AT1G06000;(source:Araport11) |
AT1G21590 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT2G45685 | Natural antisense transcript overlaps with AT2G45680;(source:Araport11) |
AT3G14880 | transcription factor-like protein;(source:Araport11) |
AT1G79740 | hAT transposon superfamily;(source:Araport11) |
AT3G20260 | DUF1666 family protein (DUF1666);(source:Araport11) |
AT1G27470 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT5G14450 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G49100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G12740 | HhH-GPD base excision DNA repair family protein;(source:Araport11) |
AT1G51720 | Amino acid dehydrogenase family protein;(source:Araport11) |
AT2G45720 | ARM repeat superfamily protein;(source:Araport11) |
AT2G25770 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT2G45030 | Translation elongation factor EFG/EF2 protein;(source:Araport11) |
AT5G43000 | hypothetical protein;(source:Araport11) |
AT2G19340 | Oligosaccharyltransferase complex/magnesium transporter family protein;(source:Araport11) |
AT3G10915 | Reticulon family protein;(source:Araport11) |
AT1G01448 | Natural antisense transcript overlaps with AT1G01450;(source:Araport11) |
AT3G23880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G66340 | hypothetical protein;(source:Araport11) |
AT5G49900 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
AT5G35970 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G37420 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT3G07900 | O-fucosyltransferase family protein;(source:Araport11) |
AT5G61570 | Protein kinase superfamily protein;(source:Araport11) |
AT5G62890 | Xanthine/uracil permease family protein;(source:Araport11) |
AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT3G04140 | Ankyrin repeat family protein;(source:Araport11) |
AT3G14172 | GPI-anchored adhesin-like protein;(source:Araport11) |
AT1G27030 | hypothetical protein;(source:Araport11) |
AT1G24530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G08230 | Codes for a H+-driven, high affinity gamma-aminobutyric acid (GABA) transporter. Localized at the plasma membrane. In planta, AtGAT1 expression was highest in flowers and under conditions of elevated GABA concentrations such as wounding or senescence. |
AT5G09700 | pseudogene of glycosyl hydrolase family 3 protein |
AT3G27520 | cryptic loci regulator;(source:Araport11) |
AT1G36380 | transmembrane protein;(source:Araport11) |
AT4G26095 | Natural antisense transcript overlaps with AT4G26090;(source:Araport11) |
AT3G07200 | RING/U-box superfamily protein;(source:Araport11) |
AT1G61650 | pseudogene of chromomethylase 1;(source:Araport11) |
AT5G41940 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT4G39270 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G69485 | Ribosomal L32p protein family;(source:Araport11) |
AT1G76460 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
AT5G07260 | START (StAR-related lipid-transfer) lipid-binding domain-containing protein;(source:Araport11) |
AT1G16870 | mitochondrial 28S ribosomal protein S29-like protein;(source:Araport11) |
AT5G06865 | Natural antisense transcript overlaps with AT5G06860;(source:Araport11) |
AT5G45472 | Potential natural antisense gene, locus overlaps with AT5G45470 |
AT3G09165 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 6.7e-75 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G45023 | other_RNA;(source:Araport11) |
AT3G06240 | F-box family protein;(source:Araport11) |
AT5G23750 | Remorin family protein;(source:Araport11) |
AT3G06433 | pseudogene of nodulin MtN3 family protein |
AT1G64710 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
AT1G20890 | caveolin-1 protein;(source:Araport11) |
AT2G15730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G24580 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
AT5G39970 | catalytics;(source:Araport11) |
AT1G18610 | Galactose oxidase/kelch repeat superfamily protein, induced by calcium. |
AT5G01850 | Protein kinase superfamily protein;(source:Araport11) |
AT5G13070 | MSF1-like family protein;(source:Araport11) |
AT1G77780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT2G17360 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
AT1G70870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT1G80290 | a member of the Glycosyltransferase Family 64 (according to CAZy Database) |
AT3G14960 | Galactosyltransferase family protein;(source:Araport11) |
AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
AT4G39150 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT4G24410 | hypothetical protein;(source:Araport11) |
AT1G15640 | transmembrane protein;(source:Araport11) |
AT1G79529 | Natural antisense transcript overlaps with AT1G79530;(source:Araport11) |
AT5G44418 | pseudogene of cytochrome P450;(source:Araport11) |
AT2G41170 | F-box family protein;(source:Araport11) |
AT4G33930 | Encodes a protein with 14.6% glycine residues, similar to hyphally regulated protein from Candida albicans, PIR2:S58135 |
AT5G58570 | transmembrane protein;(source:Araport11) |
AT5G03450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G54410 | hypothetical protein (DUF1163);(source:Araport11) |
AT5G01595 | Natural antisense transcript overlaps with AT5G01600;(source:Araport11) |
AT5G01800 | saposin B domain-containing protein;(source:Araport11) |
AT4G03435 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT4G24320 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT5G27750 | F-box/FBD-like domains containing protein;(source:Araport11) |
AT5G41612 | Natural antisense transcript overlaps with AT5G41610;(source:Araport11) |
AT5G11970 | ABC family ABC transporter, putative (DUF3511);(source:Araport11) |
AT3G15356 | Legume lectin family protein;(source:Araport11) |
AT4G26960 | hypothetical protein;(source:Araport11) |
AT2G34340 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT1G19485 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G46190 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT5G07322 | other_RNA;(source:Araport11) |
AT3G63450 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G22510 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G48190 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT1G71520 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT5G04238 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G18200 | encodes an adenylyltransferase |
AT2G34655 | hypothetical protein;(source:Araport11) |
AT1G05136 | hypothetical protein;(source:Araport11) |
AT2G28105 | replication factor-A carboxy-terminal domain protein;(source:Araport11) |
AT3G10986 | LURP-one-like protein (DUF567);(source:Araport11) |
AT2G46560 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT1G15757 | Encodes a defensin-like (DEFL) family protein. |
AT5G47380 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT3G15351 | P53/DNA damage-regulated protein;(source:Araport11) |
AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT4G14930 | Survival protein SurE-like phosphatase/nucleotidase;(source:Araport11) |
AT5G65445 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT2G16270 | transmembrane protein;(source:Araport11) |
AT1G61880 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT3G54000 | TIP41-like protein;(source:Araport11) |
AT2G40050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G10650 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT1G64610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G05530 | RING/U-box superfamily protein;(source:Araport11) |
AT2G47010 | calcium/calcium/calmodulin-dependent Serine/Threonine-kinase;(source:Araport11) |
AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
AT2G15990 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G33051 | Natural antisense transcript overlaps with AT2G33050;(source:Araport11) |
AT4G34630 | prostatic spermine-binding-like protein;(source:Araport11) |
AT1G44770 | elongation factor;(source:Araport11) |
AT1G74510 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G10625 | flowering-promoting factor-like protein;(source:Araport11) |
AT4G39970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G16740 | Ribosomal protein L20;(source:Araport11) |
AT3G02335 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT3G16190 | Isochorismatase family protein;(source:Araport11) |
AT1G14330 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G55090 | carbon-nitrogen hydrolase family protein;(source:Araport11) |
AT5G41680 | Protein kinase superfamily protein;(source:Araport11) |
AT5G07940 | dentin sialophosphoprotein-like protein;(source:Araport11) |
AT3G62010 | metal ion-binding protein;(source:Araport11) |
AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
AT3G24929 | hypothetical protein;(source:Araport11) |
AT5G03110 | protamine P1 family protein;(source:Araport11) |
AT1G49680 | mutator transposase MUDRA protein;(source:Araport11) |
AT4G02340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G52450 | MATE efflux family protein;(source:Araport11) |
AT1G55160 | WAS/WASL-interacting family protein;(source:Araport11) |
AT2G38260 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT1G70880 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT5G59960 | K-stimulated pyrophosphate-energized sodium pump protein;(source:Araport11) |
AT5G67510 | Translation protein SH3-like family protein;(source:Araport11) |
AT2G18240 | Rer1 family protein;(source:Araport11) |
AT1G54750 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G48440 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT1G54120 | hypothetical protein;(source:Araport11) |
AT3G05390 | S-adenosyl-L-methionine-dependent methyltransferase;(source:Araport11) |
AT2G20635 | protein kinase and Mad3-BUB1-I domain-containing protein;(source:Araport11) |
AT3G02760 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
AT5G67290 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
AT1G14230 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
AT3G27680 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT2G01755 | hypothetical protein;(source:Araport11) |
AT2G44920 | Encodes a pentapeptide-repeat protein (PRP) composed of 25 repeats capped by N- and C-terminal a-helices. Unlike other PRPs, At2g44920 consists exclusively of type II b-turns |
AT2G36895 | D-tagatose-1,6-bisphosphate aldolase subunit;(source:Araport11) |
AT3G47550 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT3G52920 | transcriptional activator (DUF662);(source:Araport11) |
AT2G19940 | Putative N-acetyl-gamma-glutamyl-phosphate reductase;(source:Araport11) |
AT2G23100 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G15580 | RING/U-box superfamily protein;(source:Araport11) |
AT1G68500 | hypothetical protein;(source:Araport11) |
AT5G08670 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
AT4G27020 | inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11) |
AT4G03310 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.4e-90 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G29280 | pseudogene of tropinone reductase;(source:Araport11) |
AT5G62130 | Per1-like family protein;(source:Araport11) |
AT2G25970 | KH domain-containing protein;(source:Araport11) |
AT5G03668 | Natural antisense transcript overlaps with AT5G03670;(source:Araport11) |
AT4G16105 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
AT4G17580 | Bax inhibitor-1 family protein;(source:Araport11) |
AT5G43535 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT3G27600 | SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11) |
AT3G20015 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G12900 | DNA double-strand break repair RAD50 ATPase;(source:Araport11) |
AT2G33400 | FK506-binding nuclear-like protein;(source:Araport11) |
AT5G61200 | myosin heavy chain-like protein;(source:Araport11) |
AT3G19002 | Natural antisense transcript overlaps with AT3G19000;(source:Araport11) |
AT2G47100 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
AT5G15190 | hypothetical protein;(source:Araport11) |
AT3G19560 | F-box family protein;(source:Araport11) |
AT1G79260 | nitrobindin heme-binding domain protein;(source:Araport11) |
AT4G21740 | transmembrane protein;(source:Araport11) |
AT3G50840 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G62430 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT5G03700 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
AT4G28290 | hypothetical protein;(source:Araport11) |
AT4G19440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G46080 | Protein kinase superfamily protein;(source:Araport11) |
AT3G62640 | DUF3511 domain protein (DUF3511);(source:Araport11) |
AT1G15350 | DUF4050 family protein;(source:Araport11) |
AT5G45490 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G77550 | tubulin-tyrosine ligase;(source:Araport11) |
AT4G05060 | PapD-like superfamily protein;(source:Araport11) |
AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G11000 | hypothetical protein (DUF868);(source:Araport11) |
AT3G45310 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT1G77770 | forkhead box protein, putative (DUF1644);(source:Araport11) |
AT5G50090 | PADRE protein. |
AT1G78250 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
AT5G26960 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G12000 | SNARE associated Golgi protein family;(source:Araport11) |
AT5G66564 | snoRNA;(source:Araport11) |
AT2G22200 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT3G18560 | hypothetical protein;(source:Araport11) |
AT5G67200 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G22821 | Natural antisense transcript overlaps with AT2G22820. The RNA is cell-to-cell mobile. |
AT1G53860 | Encodes a protein that is highly methylated in a WT DML background. |
AT4G24290 | MAC/Perforin domain-containing protein;(source:Araport11) |
AT2G16610 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 6.1e-89 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
AT1G10640 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G51140 | DnaJ (DUF3353);(source:Araport11) |
AT1G04990 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT3G10120 | PADRE protein down-regulated after infection by S. sclerotiorum. |
AT3G52670 | FBD;(source:Araport11) |
AT3G03010 | Peptidyl-tRNA hydrolase II (PTH2) family protein;(source:Araport11) |
AT4G01870 | tolB protein-like protein;(source:Araport11) |
AT1G16310 | Cation efflux family protein which affects ABA-JA crosstalk and susceptibility to Mamestra brassicae herbivory. |
AT1G09460 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT4G39838 | Natural antisense transcript overlaps with AT4G39840;(source:Araport11) |
AT2G39440 | ribonuclease H2 subunit C-like protein;(source:Araport11) |
AT3G19030 | transcription initiation factor TFIID subunit 1b-like protein;(source:Araport11) |
AT3G53640 | Protein kinase superfamily protein;(source:Araport11) |
AT1G76240 | DUF241 domain protein (DUF241);(source:Araport11) |
AT4G29710 | Alkaline-phosphatase-like family protein;(source:Araport11) |
AT2G27310 | F-box family protein;(source:Araport11) |
AT5G43830 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT5G51580 | hypothetical protein;(source:Araport11) |
AT1G75960 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT1G72810 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
AT1G15450 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT3G11890 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT1G06645 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G51210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G13505 | Natural antisense transcript overlaps with AT4G13510;(source:Araport11) |
AT2G38250 | Homeodomain-like superfamily protein;(source:Araport11) |
AT2G10940 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G53233 | Natural antisense transcript overlaps with AT1G53230;(source:Araport11) |
AT4G30780 | ATP-dependent DNA helicase;(source:Araport11) |
AT3G26430 | Encodes a functioning member of the GDS(L) lipase family with preference for long chain substrates that does not hydrolyze choline esters. |
AT5G57670 | Protein kinase superfamily protein;(source:Araport11) |
AT5G14120 | Major facilitator superfamily protein;(source:Araport11) |
AT1G53450 | epstein-barr nuclear antigen;(source:Araport11) |
AT5G54865 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT5G60250 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT5G49215 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G57910 | ribosomal RNA small subunit methyltransferase G;(source:Araport11) |
AT4G33380 | dimethylallyl, adenosine tRNA methylthiotransferase;(source:Araport11) |
AT1G28660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G07720 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G32265 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
AT5G46170 | F-box family protein;(source:Araport11) |
AT3G19970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G49400 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G25707 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G13470 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G24255.1);(source:TAIR10) |
AT1G52590 | Putative thiol-disulfide oxidoreductase DCC;(source:Araport11) |
AT1G51350 | ARM repeat superfamily protein;(source:Araport11) |
AT5G17930 | MIF4G domain-containing protein / MA3 domain-containing protein;(source:Araport11) |
AT4G39360 | hypothetical protein;(source:Araport11) |
AT3G06435 | Expressed protein;(source:Araport11) |
AT3G45320 | transmembrane protein;(source:Araport11) |
AT3G63510 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
AT5G61450 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G78995 | hypothetical protein;(source:Araport11) |
AT1G54820 | Protein kinase superfamily protein;(source:Araport11) |
AT1G47606 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G58610 | ketol-acid reductoisomerase;(source:Araport11) |
AT1G55680 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G45638 | other_RNA;(source:Araport11) |
AT2G41178 | Natural antisense transcript overlaps with AT2G41180;(source:Araport11) |
AT3G07860 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G16180 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
AT1G80640 | Protein kinase superfamily protein;(source:Araport11) |
AT2G32150 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G54300 | hypothetical protein;(source:Araport11) |
AT4G13100 | RING/U-box superfamily protein;(source:Araport11) |
AT5G44415 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
AT1G48315 | Natural antisense transcript overlaps with AT1G48320;(source:Araport11) |
AT3G16555 | F-box and associated interaction domains-containing protein;(source:Araport11).SON1 paralog. |
AT5G45475 | other_RNA;(source:Araport11) |
AT4G34310 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G08250 | GRAS family transcription factor;(source:Araport11) |
AT4G27270 | Quinone reductase family protein;(source:Araport11) |
AT1G20310 | syringolide-induced protein;(source:Araport11) |
AT5G05210 | Surfeit locus protein 6;(source:Araport11) |
AT2G02370 | SNARE associated Golgi protein family;(source:Araport11) |
AT1G19396 | hypothetical protein;(source:Araport11) |
AT3G51250 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
AT2G20920 | chaperone (DUF3353);(source:Araport11) |
AT5G50170 | C2 calcium/lipid-binding and GRAM domain containing protein;(source:Araport11) |
AT3G59210 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT4G38700 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT1G18335 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT3G50570 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G23530 | ROH1, putative (DUF793);(source:Araport11) |
AT4G38280 | integral membrane hemolysin-III-like protein;(source:Araport11) |
AT3G26460 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT4G28800 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G66580 | PADRE protein. |
AT5G43185 | Expressed protein;(source:Araport11) |
AT1G76740 | hypothetical protein;(source:Araport11) |
AT3G60070 | Major facilitator superfamily protein;(source:Araport11) |
AT3G26935 | DHHC-type zinc finger family protein;(source:Araport11) |
AT1G63835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-17 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT2G26355 | Natural antisense transcript overlaps with AT2G26360. The RNA is cell-to-cell mobile. |
AT2G29670 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G19110 | inter-alpha-trypsin inhibitor heavy chain-like protein;(source:Araport11) |
AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT3G55870 | ADC synthase superfamily protein;(source:Araport11) |
AT2G29065 | GRAS family transcription factor;(source:Araport11) |
AT2G19350 | transmembrane protein (DUF872);(source:Araport11) |
AT1G06610 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT4G01960 | transmembrane protein;(source:Araport11) |
AT4G20365 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-254 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT2G20910 | pseudogene of ATPase;(source:Araport11) |
AT2G47370 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT1G22330 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G27090 | bZIP transcription factor (DUF630 and DUF632);(source:Araport11) |
AT2G42975 | myosin-G heavy chain-like protein;(source:Araport11) |
AT3G52110 | interferon-activable protein;(source:Araport11) |
AT5G22280 | peptidyl-prolyl cis-trans isomerase G;(source:Araport11) |
AT5G38840 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT1G10040 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G54950 | Aconitase family protein;(source:Araport11) |
AT3G56360 | hypothetical protein;(source:Araport11) |
AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G70160 | zinc finger MYND domain protein;(source:Araport11) |
AT5G54710 | Ankyrin repeat family protein;(source:Araport11) |
AT5G15845 | Natural antisense transcript overlaps with AT5G15850;(source:Araport11) |
AT3G10300 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G16170 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G45600 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G44470 | ribonuclease H superfamily polynucleotidyl transferase;(source:Araport11) |
AT5G03452 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT1G13930 | Involved in response to salt stress. Knockout mutants are hypersensitive to salt stress. The mRNA is cell-to-cell mobile. |
AT5G24318 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT4G19645 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT5G18130 | transmembrane protein;(source:Araport11) |
AT1G76700 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT3G12710 | DNA glycosylase superfamily protein;(source:Araport11) |
AT5G09975 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
AT1G05350 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G15260 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G49000 | transmembrane protein;(source:Araport11) |
AT3G13965 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT1G63810 | nucleolar protein;(source:Araport11) |
AT5G54480 | hypothetical protein (DUF630 and DUF632);(source:Araport11) |
AT2G02590 | small multi-drug export protein;(source:Araport11) |
AT5G41400 | RING/U-box superfamily protein;(source:Araport11) |
AT3G19035 | transmembrane protein;(source:Araport11) |
AT5G61997 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G39420 | spatacsin carboxy-terminus protein;(source:Araport11) |
AT1G75650 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
AT1G07800 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase., blastp match of 24%25 identity and 5.3e-10 P-value to GP|21450442|gb|AAM54146.1|AC104616_5|AC104616 putative reverse transcriptase. {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT1G12390 | Cornichon family protein;(source:Araport11) |
AT1G27300 | transmembrane protein;(source:Araport11) |
AT2G39130 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT1G64618 | other_RNA;(source:Araport11) |
AT1G21050 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT1G15650 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT2G22426 | hypothetical protein;(source:Araport11) |
AT5G49440 | hypothetical protein;(source:Araport11) |
AT1G67910 | hypothetical protein;(source:Araport11) |
AT1G54260 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
AT1G24650 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G32190 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G12230 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G15280 | hypothetical protein;(source:Araport11) |
AT3G45730 | hypothetical protein;(source:Araport11) |
AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
AT3G61545 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
AT3G26510 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT5G02430 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
AT3G26670 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT5G09300 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
AT4G14370 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G77750 | Ribosomal protein S13/S18 family;(source:Araport11) |
AT1G03570 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
AT4G30000 | Dihydropterin pyrophosphokinase / Dihydropteroate synthase;(source:Araport11) |
AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT2G22482 | other_RNA;(source:Araport11) |
AT3G13480 | nuclear polyadenylated RNA-binding protein;(source:Araport11) |
AT3G57780 | nucleolar-like protein;(source:Araport11) |
AT1G45230 | DCL protein (DUF3223);(source:Araport11) |
AT5G58375 | Methyltransferase-related protein;(source:Araport11) |
AT4G37480 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G60520 | zinc ion-binding protein;(source:Araport11) |
AT4G13530 | transmembrane protein;(source:Araport11) |
AT1G21326 | VQ motif-containing protein;(source:Araport11) |
AT1G09130 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
AT4G39560 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G29430 | coiled-coil protein (DUF572);(source:Araport11) |
AT1G71350 | eukaryotic translation initiation factor SUI1 family protein;(source:Araport11) |
AT1G21220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-26 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT4G32342 | hypothetical protein;(source:Araport11) |
AT4G10330 | glycine-rich protein;(source:Araport11) |
AT5G20390 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT5G62865 | hypothetical protein;(source:Araport11) |
AT1G62510 | Expressed in the root cortex. |
AT5G40680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G30090 | golgin family A protein;(source:Araport11) |
AT2G41082 | hypothetical protein;(source:Araport11) |
AT1G53460 | craniofacial development protein;(source:Araport11) |
AT2G18850 | SET domain-containing protein;(source:Araport11) |
AT1G14470 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G00500 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G27415 | hypothetical protein;(source:Araport11) |
AT5G61950 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT2G43780 | cytochrome oxidase assembly protein;(source:Araport11) |
AT1G08050 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT1G75210 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11) |
AT5G03710 | replication factor C large subunit;(source:Araport11) |
AT3G02700 | NC domain-containing protein-like protein;(source:Araport11) |
AT5G51980 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G15110 | Pectate lyase family protein;(source:Araport11) |
AT3G57400 | transmembrane protein;(source:Araport11) |
AT3G10415 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT1G06925 | endonuclease/glycosyl hydrolase;(source:Araport11) |
AT5G46780 | VQ motif-containing protein;(source:Araport11) |
AT1G52618 | hypothetical protein;(source:Araport11) |
AT2G02960 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT4G32030 | hypothetical protein;(source:Araport11) |
AT2G37830 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167. |
AT2G38390 | Peroxidase superfamily protein;(source:Araport11) |
AT5G23680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT4G12240 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT2G39950 | flocculation protein;(source:Araport11) |
AT5G11700 | ephrin type-B receptor;(source:Araport11) |
AT1G66880 | Protein kinase superfamily protein;(source:Araport11) |
AT4G31408 | None;(source:Araport11) |
AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
AT3G15760 | cytochrome P450 family protein;(source:Araport11) |
AT3G22980 | Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11) |
AT4G17765 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT2G19100 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.2e-33 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT5G14110 | peroxidase (DUF 3339);(source:Araport11) |
AT5G08180 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT5G05230 | RING/U-box superfamily protein;(source:Araport11) |
AT1G77250 | RING/FYVE/PHD-type zinc finger family protein;(source:Araport11) |
AT3G29240 | PPR containing protein (DUF179);(source:Araport11) |
AT2G35859 | Natural antisense transcript overlaps with AT2G35860;(source:Araport11) |
AT1G67310 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain;(source:Araport11) |
AT3G21770 | Peroxidase superfamily protein;(source:Araport11) |
AT1G74940 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
AT3G26100 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT5G13360 | Auxin-responsive GH3 family protein;(source:Araport11) |
AT2G27670 | hypothetical protein (Domain of unknown function DUF220);(source:Araport11) |
AT5G46325 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT1G77145 | transmembrane protein, putative (DUF506);(source:Araport11) |
AT1G69252 | other_RNA;(source:Araport11) |
AT5G58340 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
AT1G15800 | hypothetical protein;(source:Araport11) |
AT5G07620 | Protein kinase superfamily protein;(source:Araport11) |
AT5G58520 | Protein kinase superfamily protein;(source:Araport11) |
AT1G52790 | encodes a putative oxidoreductase, 2OG-Fe(II) oxygenase family protein, similar to GS-AOP loci (GI:16118889, GI:16118887, GI:16118891, GI:16118893); contains PF03171 2OG-Fe(II) oxygenase superfamily domain |
AT4G33540 | metallo-beta-lactamase family protein;(source:Araport11) |
AT4G17100 | poly(U)-specific endoribonuclease-B protein;(source:Araport11) |
AT4G27810 | hypothetical protein;(source:Araport11) |
AT5G25030 | ATP-binding protein (DUF2431);(source:Araport11) |
AT1G33600 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT2G18090 | PHD finger family protein / SWIB complex BAF60b domain-containing protein / GYF domain-containing protein;(source:Araport11) |
AT1G70600 | Ribosomal protein L18e/L15 superfamily protein;(source:Araport11) |
AT3G01830 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT1G27020 | plant/protein;(source:Araport11) |
AT1G14780 | MAC/Perforin domain-containing protein;(source:Araport11) |
AT1G70280 | NHL domain-containing protein;(source:Araport11) |
AT4G38300 | glycosyl hydrolase family 10 protein;(source:Araport11) |
AT3G51560 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT2G17723 | Encodes a defensin-like (DEFL) family protein. |
AT2G41250 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
AT4G25680 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
AT3G09590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
AT2G37160 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G65050 | TRAF-like superfamily protein;(source:Araport11) |
AT3G48380 | Peptidase C78, ubiquitin fold modifier-specific peptidase 1/ 2;(source:Araport11) |
AT1G68185 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G55535 | transmembrane protein;(source:Araport11) |
AT5G21222 | protein kinase family protein;(source:Araport11) |
AT3G09162 | hypothetical protein;(source:Araport11) |
AT1G71150 | cyclin-D1-binding protein;(source:Araport11) |
AT1G06050 | ENHANCED DISEASE RESISTANCE-like protein (DUF1336);(source:Araport11) |
AT4G33625 | vacuole protein;(source:Araport11) |
AT4G11800 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT5G66567 | snoRNA;(source:Araport11) |
AT5G27715 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT3G50650 | GRAS family transcription factor;(source:Araport11) |
AT2G29628 | hypothetical protein;(source:Araport11) |
AT1G55210 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT2G33490 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G16500 | filamentous hemagglutinin transporter;(source:Araport11) |
AT5G62770 | membrane-associated kinase regulator, putative (DUF1645);(source:Araport11) |
AT4G36370 | hypothetical protein;(source:Araport11) |
AT1G23052 | other_RNA;(source:Araport11) |
AT1G62045 | ankyrin repeat protein;(source:Araport11) |
AT1G74840 | Homeodomain-like superfamily protein;(source:Araport11) |
AT3G66652 | fip1 motif-containing protein;(source:Araport11) |
AT1G51550 | Kelch repeat-containing F-box family protein;(source:Araport11) |
AT3G05835 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
AT1G65830 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT5G41460 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
AT5G18920 | Cox19-like CHCH family protein;(source:Araport11) |
AT1G07728 | Natural antisense transcript overlaps with AT1G07725;(source:Araport11) |
AT5G38070 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT4G02630 | Protein kinase superfamily protein;(source:Araport11) |
AT3G14060 | hypothetical protein;(source:Araport11) |
AT4G36850 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
AT1G72690 | neurofilament heavy protein;(source:Araport11) |
AT1G29960 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
AT4G37240 | PADRE protein down-regulated after infection by S. sclerotiorun. |
AT3G11760 | structural maintenance of chromosomes flexible hinge domain protein;(source:Araport11) |
AT2G44210 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
AT1G47610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G30090 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G57760 | hypothetical protein;(source:Araport11) |
AT1G04960 | golgin family A protein (DUF1664);(source:Araport11) |
AT5G66053 | hypothetical protein;(source:Araport11) |
AT5G11500 | coiled-coil protein;(source:Araport11) |
AT2G31130 | hypothetical protein;(source:Araport11) |
AT3G05400 | Major facilitator superfamily protein;(source:Araport11) |
AT5G16980 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT1G14270 | CAAX amino terminal protease family protein;(source:Araport11) |
AT4G28330 | pyrroline-5-carboxylate reductase;(source:Araport11) |
AT5G56544 | pseudogene of arginyl-tRNA synthetase |
AT5G59230 | transcription factor-like protein;(source:Araport11) |
AT3G15890 | Protein kinase superfamily protein;(source:Araport11) |
AT3G05425 | hypothetical protein;(source:Araport11) |
AT3G03320 | RNA-binding ASCH domain protein;(source:Araport11) |
AT5G42265 | pseudogene of Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT1G06640 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
AT1G13940 | T-box transcription factor, putative (DUF863);(source:Araport11) |
AT3G50685 | anti-muellerian hormone type-2 receptor;(source:Araport11) |
AT5G15022 | Natural antisense transcript overlaps with AT5G15030;(source:Araport11) |
AT4G38650 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
AT1G15885 | hypothetical protein;(source:Araport11) |
AT4G04630 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT5G15030 | paired amphipathic helix Sin3-like protein;(source:Araport11) |
AT1G01310 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT2G43320 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G21187 | Natural antisense transcript overlaps with AT2G21185;(source:Araport11) |
AT5G59390 | XH/XS domain-containing protein;(source:Araport11) |
AT5G61910 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
AT1G64450 | Glycine-rich protein family;(source:Araport11) |
AT1G77670 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT3G60980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G40240 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G25230 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT1G72175 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232);(source:Araport11) |
AT4G20880 | ethylene-responsive nuclear protein / ethylene-regulated nuclear protein (ERT2);(source:Araport11) |
AT1G17350 | NADH:ubiquinone oxidoreductase intermediate-associated protein 30;(source:Araport11) |
AT3G03870 | transmembrane protein;(source:Araport11) |
AT1G11915 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
AT1G01170 | ozone-responsive stress-like protein (DUF1138);(source:Araport11) |
AT3G25716 | transmembrane protein;(source:Araport11) |
AT3G05940 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT1G50630 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
AT5G02025 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT3G07730 | hypothetical protein;(source:Araport11) |
AT2G44360 | ecotropic viral integration site protein;(source:Araport11) |
AT4G22730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
AT1G80580 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT1G27160 | valyl-tRNA synthetase / valine-tRNA ligase-like protein;(source:Araport11) |
AT4G10910 | hypothetical protein;(source:Araport11) |
AT3G03020 | hypothetical protein;(source:Araport11) |
AT2G17760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G13360 | hypothetical protein;(source:Araport11) |
AT2G42425 | other_RNA;(source:Araport11) |
AT3G06840 | hypothetical protein;(source:Araport11) |
AT1G62870 | hypothetical protein;(source:Araport11) |
AT5G04460 | RING/U-box superfamily protein;(source:Araport11) |
AT1G35255 | transmembrane protein;(source:Araport11) |
AT2G26360 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G12340 | Cornichon family protein;(source:Araport11) |
AT2G36026 | Ovate family protein;(source:Araport11) |
AT1G55280 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
AT4G13918 | Natural antisense transcript overlaps with AT4G13920;(source:Araport11) |
AT1G52330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G01250 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
AT5G47430 | DWNN domain, a CCHC-type zinc finger;(source:Araport11) |
AT4G36500 | hypothetical protein;(source:Araport11) |
AT2G42900 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
AT2G19910 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
AT5G57655 | xylose isomerase family protein;(source:Araport11) |
AT3G23530 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
AT1G08900 | Major facilitator superfamily protein;(source:Araport11) |
AT5G58110 | chaperone binding / ATPase activator;(source:Araport11) |
AT4G33960 | hypothetical protein;(source:Araport11) |
AT2G21690 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G29195 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT1G08890 | Major facilitator superfamily protein;(source:Araport11) |
AT3G60340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G59765 | None;(source:Araport11) |
AT1G66760 | MATE efflux family protein;(source:Araport11) |
AT3G02120 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G23575 | Transmembrane CLPTM1 family protein;(source:Araport11) |
AT1G70150 | zinc ion binding protein;(source:Araport11) |
AT5G52890 | AT hook motif-containing protein;(source:Araport11) |
AT3G54440 | glycoside hydrolase family 2 protein;(source:Araport11) |
AT5G24170 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
AT4G37170 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G55050 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
AT1G14170 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT5G67350 | hypothetical protein;(source:Araport11) |
AT5G15870 | glycosyl hydrolase family 81 protein;(source:Araport11) |
AT3G06750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G54170 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT3G16552 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT3G05180 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G16560 | Protein phosphatase 2C family protein;(source:Araport11) |
AT4G14240 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
AT1G22660 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
AT4G01350 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G07580 | hypothetical protein;(source:Araport11) |
AT4G11680 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT5G42070 | hypothetical protein;(source:Araport11) |
AT1G29650 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-28 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G27210 | ARM repeat superfamily protein;(source:Araport11) |
AT4G32110 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G77270 | hypothetical protein;(source:Araport11) |
AT1G69510 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
AT4G26860 | Putative pyridoxal phosphate-dependent enzyme, YBL036C type;(source:Araport11) |
AT1G69760 | suppressor SRP40-like protein;(source:Araport11) |
AT5G41030 | TCP family transcription factor;(source:Araport11) |
AT1G17680 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
AT5G64030 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G44569 | other_RNA;(source:Araport11) |
AT5G22340 | NF-kappa-B inhibitor-like protein;(source:Araport11) |
AT3G43610 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
AT4G11985 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT5G47445 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.6e-84 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G51000 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G41605 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G16200 | 50S ribosomal protein-like protein;(source:Araport11) |
AT2G29679 | hypothetical protein;(source:Araport11) |
AT1G08210 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G10720 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT1G76050 | Pseudouridine synthase family protein;(source:Araport11) |
AT1G19000 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G62305 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G22110 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
AT3G47490 | HNH endonuclease;(source:Araport11) |
AT2G22807 | Encodes a defensin-like (DEFL) family protein. |
AT5G08055 | Encodes a defensin-like (DEFL) family protein. |
AT3G46070 | C2H2-type zinc finger family protein;(source:Araport11) |
AT5G05480 | Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A protein;(source:Araport11) |
AT1G61610 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G16490 | ARM repeat superfamily protein;(source:Araport11) |
AT1G77880 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G05370 | Cytochrome b-c1 complex, subunit 8 protein;(source:Araport11) |
AT2G21670 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
AT5G08360 | Stu1, putative (DUF789);(source:Araport11) |
AT1G24440 | RING/U-box superfamily protein;(source:Araport11) |
AT2G19806 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.2e-19 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT1G51402 | hypothetical protein;(source:Araport11) |
AT2G30000 | PHF5-like protein;(source:Araport11) |
AT1G78060 | Glycosyl hydrolase family protein;(source:Araport11) |
AT3G47830 | DNA glycosylase superfamily protein;(source:Araport11) |
AT4G02555 | snoRNA;(source:Araport11) |
AT5G67170 | SEC-C motif-containing protein / OTU-like cysteine protease family protein;(source:Araport11) |
AT1G13920 | Remorin family protein;(source:Araport11) |
AT5G48420 | hypothetical protein;(source:Araport11) |
AT1G47860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G18490 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
AT5G45960 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G45830 | nuclear factor kappa-B-binding-like protein;(source:Araport11) |
AT3G51990 | Protein kinase superfamily protein;(source:Araport11) |
AT4G12580 | hypothetical protein;(source:Araport11) |
AT1G12790 | DNA ligase-like protein;(source:Araport11) |
AT1G72760 | Protein kinase superfamily protein;(source:Araport11) |
AT3G42570 | peroxidase family protein;(source:Araport11) |
AT5G52990 | SNARE-like superfamily protein;(source:Araport11) |
AT5G43140 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT3G16990 | heme oxygenase-like, multi-helical;(source:Araport11) |
AT1G17850 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
AT5G65910 | BSD domain-containing protein;(source:Araport11) |
AT2G47720 | hypothetical protein;(source:Araport11) |
AT5G43260 | chaperone protein dnaJ-like protein;(source:Araport11) |
AT4G21880 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G11673 | pseudogene of F-box family protein |
AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G35150 | General transcription factor 2-related zinc finger protein;(source:Araport11) |
AT1G01570 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
AT1G21722 | transmembrane protein;(source:Araport11) |
AT4G21420 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.9e-06 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
AT1G26558 | other_RNA;(source:Araport11) |
AT3G55240 | Overexpression leads to PEL (Pseudo-Etiolation in Light) phenotype. |
AT1G49975 | photosystem I reaction center subunit N;(source:Araport11) |
AT3G03130 | lisH domain-like protein;(source:Araport11) |
AT1G21770 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT3G11780 | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein;(source:Araport11) |
AT5G49525 | transmembrane protein;(source:Araport11) |
AT5G63490 | CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein;(source:Araport11) |
AT4G16970 | Protein kinase superfamily protein;(source:Araport11) |
AT1G77190 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT4G16765 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G32460 | hypothetical protein;(source:Araport11) |
AT2G24370 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT2G19572 | Potential natural antisense gene, locus overlaps with AT2G19570 |
AT3G61420 | BSD domain (BTF2-like transcription factors, Synapse-associated proteins and DOS2-like proteins);(source:Araport11) |
AT4G24760 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G20790 | transmembrane protein;(source:Araport11) |
AT2G47440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G21680 | hypothetical protein;(source:Araport11) |
AT5G01365 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT1G18430 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT3G22290 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
AT5G38890 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT2G39650 | cruciferin (DUF506);(source:Araport11) |
AT4G14230 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
AT4G11160 | Translation initiation factor 2, small GTP-binding protein;(source:Araport11) |
AT3G02315 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT2G39390 | Ribosomal L29 family protein;(source:Araport11) |
AT3G22530 | heat shock protein;(source:Araport11) |
AT1G68490 | translocase subunit seca;(source:Araport11) |
AT4G25390 | Protein kinase superfamily protein;(source:Araport11) |
AT1G07830 | ribosomal protein L29 family protein;(source:Araport11) |
AT3G45740 | hydrolase family protein / HAD-superfamily protein;(source:Araport11) |
AT1G68350 | cotton fiber protein;(source:Araport11) |
AT4G14490 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT3G57940 | GNAT acetyltransferase (DUF699);(source:Araport11) |
AT1G19310 | RING/U-box superfamily protein;(source:Araport11) |
AT3G07280 | None;(source:Araport11) |
AT1G04040 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT5G14590 | Isocitrate/isopropylmalate dehydrogenase family protein;(source:Araport11) |
AT4G32230 | hypothetical protein;(source:Araport11) |
AT5G20500 | Glutaredoxin family protein;(source:Araport11) |
AT1G17450 | B-block binding subunit of TFIIIC;(source:Araport11) |
AT5G52130 | hypothetical protein;(source:Araport11) |
AT2G18735 | other_RNA;(source:Araport11) |
AT1G27640 | Putative role in leaf development. Comparison of SALK_123839C to Columbia under normal growth conditions resulted in a trend toward increased leaf length in the mutant (P=0.13; median 22 for mutant,17 for Columbia) (Ann Stapleton and Delita Pardue, 2009, personal communication). |
AT1G21080 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT5G65676 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-191 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT2G24830 | zinc finger (CCCH-type) family protein / D111/G-patch domain-containing protein;(source:Araport11) |
AT1G21740 | DUF630 family protein, putative (DUF630 and DUF632);(source:Araport11) |
AT4G39955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G20885 | RING/U-box superfamily protein;(source:Araport11) |
AT5G07790 | hypothetical protein;(source:Araport11) |
AT3G56085 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT5G03905 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
AT3G26910 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G24355 | hypothetical protein;(source:Araport11) |
AT2G27870 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT2G22350.1);(source:TAIR10) |
AT5G08060 | furry;(source:Araport11) |
AT1G70740 | Protein kinase superfamily protein;(source:Araport11) |
AT2G39865 | transmembrane protein;(source:Araport11) |
AT1G70420 | DNA ligase-like protein, putative (DUF1645);(source:Araport11) |
AT5G49220 | hypothetical protein (DUF789);(source:Araport11) |
AT3G11230 | Yippee family putative zinc-binding protein;(source:Araport11) |
AT3G16210 | F-box family protein;(source:Araport11) |
AT1G31920 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G55450 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G48020 | hypothetical protein;(source:Araport11) |
AT5G01780 | 2-oxoglutarate-dependent dioxygenase family protein;(source:Araport11) |
AT3G30733 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
AT5G10745 | transmembrane protein;(source:Araport11) |
AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
AT3G30380 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G61270 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT4G35025 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G30900 | DNAse I-like superfamily protein;(source:Araport11) |
AT5G40710 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT5G44705 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
AT1G20100 | DNA ligase-like protein;(source:Araport11) |
AT2G01300 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
AT1G04570 | Similar to plastid solute transporters. |
AT1G18550 | ATP binding microtubule motor family protein;(source:Araport11) |
AT1G80245 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
AT2G44000 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT2G41231 | transmembrane protein;(source:Araport11) |
AT2G02520 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT4G18380 | F-box family protein;(source:Araport11) |
AT5G15340 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G40085 | Natural antisense transcript overlaps with AT4G40080;(source:Araport11) |
AT3G13270 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G14450.1);(source:TAIR10) |
AT3G25700 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G25280 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G51135 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
AT3G01360 | plant viral-response family protein (DUF716);(source:Araport11) |
AT4G31410 | E3 ubiquitin-protein ligase, putative (DUF1644);(source:Araport11) |
AT2G23690 | PADRE protein. |
AT1G55100 | transposable_element_gene;(source:Araport11);pseudogene, putative ATP synthase beta subunit;(source:TAIR10) |
AT1G22180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G72855 | Natural antisense transcript overlaps with AT1G72860;(source:Araport11) |
AT4G33940 | RING/U-box superfamily protein;(source:Araport11) |
AT4G31760 | peroxidase superfamily protein;(source:Araport11) |
AT5G57500 | Galactosyltransferase family protein;(source:Araport11) |
AT1G10660 | transmembrane protein;(source:Araport11) |
AT2G29270 | pseudogene of senescence-associated gene 13;(source:Araport11) |
AT1G33100 | MATE efflux family protein;(source:Araport11) |
AT3G17780 | B-cell receptor-associated-like protein;(source:Araport11) |
AT3G08680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G49900 | C2H2 type zinc finger transcription factor family;(source:Araport11) |
AT5G58530 | Glutaredoxin family protein;(source:Araport11) |
AT1G79160 | filamentous hemagglutinin transporter;(source:Araport11) |
AT3G12502 | Natural antisense transcript overlaps with AT3G12500;(source:Araport11) |
AT2G03550 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G14520 | DNA-directed RNA polymerase II-like protein;(source:Araport11) |
AT2G25950 | PITH domain protein (DUF1000);(source:Araport11) |
AT3G13650 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT3G47130 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G04540 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G07360 | Amidase family protein;(source:Araport11) |
AT4G23635 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
AT3G55790 | transmembrane protein;(source:Araport11) |
AT5G09620 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT5G51380 | RNI-like superfamily protein;(source:Araport11) |
AT1G67792 | Natural antisense transcript overlaps with AT1G67790;(source:Araport11) |
AT4G34975 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
AT1G26930 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G01500 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
AT1G18560 | BED zinc finger and hAT dimerization domain-containing protein;(source:Araport11) |
AT5G10770 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G71080 | RNA polymerase II transcription elongation factor;(source:Araport11) |
AT4G29310 | DUF1005 family protein (DUF1005);(source:Araport11) |
AT4G29680 | Alkaline-phosphatase-like family protein;(source:Araport11) |
AT1G07985 | Expressed protein;(source:Araport11) |
AT3G04130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G21680 | DPP6 N-terminal domain-like protein;(source:Araport11) |
AT5G08391 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
AT2G44010 | hypothetical protein;(source:Araport11) |
AT2G32560 | F-box family protein;(source:Araport11) |
AT5G15320 | ATP synthase E chain;(source:Araport11) |
AT2G18210 | hypothetical protein;(source:Araport11) |
AT3G27416 | transmembrane protein;(source:Araport11) |
AT3G13275 | transmembrane protein;(source:Araport11) |
AT4G22850 | SNARE associated Golgi protein family;(source:Araport11) |
AT2G45315 | Natural antisense transcript overlaps with AT2G45310;(source:Araport11) |
AT3G56260 | hypothetical protein;(source:Araport11) |
AT3G16840 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G12385 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
AT1G11970 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G17570 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT3G50340 | hypothetical protein;(source:Araport11) |
AT3G20340 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
AT1G58110 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT1G60080 | 3-5-exoribonuclease family protein;(source:Araport11) |
AT4G01130 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G01335 | TATA box-binding protein associated factor RNA polymerase I subunit B-like protein;(source:Araport11) |
AT3G47250 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT4G23680 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT4G16695 | transmembrane protein;(source:Araport11) |
AT5G59395 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT1G72790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G32160 | beta-casein (DUF760);(source:Araport11) |
AT5G25920 | hypothetical protein;(source:Araport11) |
AT5G57890 | Glutamine amidotransferase type 1 family protein;(source:Araport11) |
AT5G06440 | polyketide cyclase/dehydrase/lipid transport superfamily protein;(source:Araport11) |
AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
AT5G63410 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G18810 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G27350 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
AT1G61450 | CAP-gly domain linker;(source:Araport11) |
AT5G35375 | transmembrane protein;(source:Araport11) |
AT2G30700 | GPI-anchored protein;(source:Araport11) |
AT5G49015 | Expressed protein;(source:Araport11) |
AT5G56350 | Pyruvate kinase family protein;(source:Araport11) |
AT5G59540 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G08038 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to reverse transcriptase, putative;(source:TAIR10) |
AT4G28025 | hypothetical protein;(source:Araport11) |
AT2G35460 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G26731 | hypothetical protein;(source:Araport11) |
AT2G16790 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G42670 | Agenet domain-containing protein;(source:Araport11) |
AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G49110 | fanconi anemia group I-like protein;(source:Araport11) |
AT5G05400 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
AT3G44620 | protein-tyrosine phosphatase;(source:Araport11) |
AT3G24614 | Encodes a Z4 snoRNA. Gb: AJ240073 |
AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G16660 | Low-density receptor-like protein;(source:Araport11) |
AT3G03620 | MATE efflux family protein;(source:Araport11) |
AT3G57062 | transmembrane protein;(source:Araport11) |
AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT4G33490 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G26830 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT5G04690 | Ankyrin repeat family protein;(source:Araport11) |
AT2G03690 | Ubiquinone biosynthesis protein COQ4 homolog. |
AT1G02890 | AAA-type ATPase family protein;(source:Araport11) |
AT4G17085 | Putative membrane lipoprotein;(source:Araport11) |
AT4G22520 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G23950 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G19860 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT1G51870 | protein kinase family protein;(source:Araport11) |
AT5G65440 | transmembrane protein;(source:Araport11) |
AT3G22750 | Protein kinase superfamily protein;(source:Araport11) |
AT1G13380 | sodium/hydrogen exchanger (DUF1218);(source:Araport11) |
AT3G10760 | Homeodomain-like superfamily protein;(source:Araport11) |
AT3G24840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G26090 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G22560 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-20 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G55790 | hypothetical protein;(source:Araport11) |
AT3G07010 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G78280 | transferases, transferring glycosyl groups;(source:Araport11) |
AT5G18636 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT5G66052 | transmembrane protein;(source:Araport11) |
AT2G46000 | LDL receptor wingless signaling/trafficking chaperone;(source:Araport11) |
AT1G76878 | Natural antisense transcript overlaps with AT1G76880;(source:Araport11) |
AT4G22250 | RING/U-box superfamily protein;(source:Araport11) |
AT1G08870 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
AT2G04135 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G33303.1);(source:TAIR10) |
AT3G24640 | lyase;(source:Araport11) |
AT1G28100 | hypothetical protein;(source:Araport11) |
AT5G20740 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G62760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G03460 | transmembrane protein;(source:Araport11) |
AT3G15720 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G30340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G01430 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
AT5G53220 | hypothetical protein;(source:Araport11) |
AT1G78030 | hypothetical protein;(source:Araport11) |
AT1G23220 | Dynein light chain type 1 family protein;(source:Araport11) |
AT1G65585 | pseudogene of Ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G23930 | troponin T, skeletal protein;(source:Araport11) |
AT5G20225 | Natural antisense transcript overlaps with AT5G20220;(source:Araport11) |
AT2G36670 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G18630 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT1G63840 | RING/U-box superfamily protein;(source:Araport11) |
AT4G30490 | AFG1-like ATPase family protein;(source:Araport11) |
AT4G10410 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT2G44770 | ELMO/CED-12 family protein;(source:Araport11) |
AT2G37960 | myosin-M heavy protein;(source:Araport11) |
AT3G01820 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G55960 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT1G79030 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G78230 | Outer arm dynein light chain 1 protein;(source:Araport11) |
AT3G56350 | Iron/manganese superoxide dismutase family protein;(source:Araport11) |
AT5G56520 | hypothetical protein;(source:Araport11) |
AT1G53360 | F-box/associated interaction domain protein;(source:Araport11) |
AT1G53040 | tRNA (met) cytidine acetyltransferase, putative (DUF616);(source:Araport11) |
AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
AT3G28700 | NADH dehydrogenase ubiquinone complex I, assembly factor-like protein (DUF185);(source:Araport11) |
AT3G15260 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G62981 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT1G77660 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G32650 | hypothetical protein;(source:Araport11) |
AT2G27950 | Ring/U-Box superfamily protein;(source:Araport11) |
AT3G03350 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G39160 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G06380 | hypothetical protein;(source:Araport11) |
AT5G65925 | hypothetical protein;(source:Araport11) |
AT5G22040 | ubiquitin carboxyl-terminal hydrolase;(source:Araport11) |
AT4G14900 | FRIGIDA-like protein;(source:Araport11) |
AT1G18990 | myosin-binding protein, putative (Protein of unknown function, DUF593);(source:Araport11) |
AT3G50800 | PADRE protein. |
AT2G27770 | DUF868 family protein (DUF868);(source:Araport11) |
AT1G19500 | hypothetical protein;(source:Araport11) |
AT3G09760 | RING/U-box superfamily protein;(source:Araport11) |
AT4G17070 | peptidyl-prolyl cis-trans isomerase;(source:Araport11) |
AT4G09745 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT3G17800 | mRNA level of the MEB5.2 gene (At3g17800) remains unchanged after cutting the inflorescence stem |
AT3G05050 | Protein kinase superfamily protein;(source:Araport11) |
AT2G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G55570 | transmembrane protein;(source:Araport11) |
AT3G09330 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT3G19274 | hypothetical protein;(source:Araport11) |
AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G56290 | CwfJ-like family protein;(source:Araport11) |
AT2G26730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT1G15890 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT1G60670 | hypothetical protein (DUF3755);(source:Araport11) |
AT2G34080 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT2G21185 | transmembrane protein;(source:Araport11) |
AT5G58810 | pseudogene of Subtilase family protein;(source:Araport11) |
AT1G56390 | pseudogene of calreticulin 1a;(source:Araport11) |
AT1G23780 | F-box family protein;(source:Araport11) |
AT4G03820 | transmembrane protein, putative (DUF3537);(source:Araport11) |
AT3G11165 | hypothetical protein;(source:Araport11) |
AT3G59923 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT1G20691 | Natural antisense transcript overlaps with AT1G20690;(source:Araport11) |
AT5G13845 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
AT1G62780 | dimethylallyl, adenosine tRNA methylthiotransferase;(source:Araport11) |
AT3G27050 | plant/protein;(source:Araport11) |
AT1G19570 | Encodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.Encodes about 50-60% of extractable leaf GSH-dependent DHAR activity, but single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions (PMID:28381499). Acts redundantly with DHAR2 to oxidize glutathione in response to increased intracelullar hydrogen peroxide (catalase deficiency) . Complementation of a cat2 dhar1 dhar2 dhar3 quadruple mutant with DHAR1 fully restores cat2 phenotype and pathogenesis-related responses |
AT1G03410 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G09570 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT5G42090 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT5G24810 | ABC1 family protein;(source:Araport11) |
AT4G25570 | Encodes cytochrome b561. |
AT5G67410 | transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11) |
AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
AT5G21030 | PAZ domain-containing protein / piwi domain-containing protein;(source:Araport11) |
AT5G19140 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT5G21170 | Encodes AKINbeta1, a subunit of the SnRK1 kinase (Sucrose non-fermenting-1-related protein kinase). Involved in regulation of nitrogen and sugar metabolism. As part of the regulatory subunit, it binds maltose which promotes kinase activity. Acts as a global regulator of genes involved in carbon, lipid and nitrogen metabolism. |
AT1G76010 | Alba DNA/RNA-binding protein;(source:Araport11) |
AT5G59950 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G02530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G30020 | Encodes AP2C1. Belongs to the clade B of the PP2C-superfamily. Acts as a MAPK phosphatase that negatively regulates MPK4 and MPK6. |
AT1G07570 | Protein kinase capable of phosphorylating tyrosine, serine, and threonine residues |
AT4G39210 | Encodes the large subunit of ADP-Glucose Pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL3 is the major large subunit isoform present in inflorescences, fruits and roots. |
AT4G18020 | Encodes pseudo-response regulator 2 (APRR2) that interacts with a calcium sensor (CML9). |
AT5G43780 | sulfate adenylyltransferase, ATP sulfurylase |
AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
AT1G52080 | actin binding protein family;(source:Araport11) |
AT1G06400 | small GTP-binding protein (ara-2).RabGTPase functioning in anterograde trafficking from trans-Golgi network/early endosomal compartments to the plasma membrane as well as in responses to salinity stress. |
AT5G67360 | Encodes a subtilisin-like serine protease essential for mucilage release from seed coats. |
AT4G19640 | Encodes Ara7. |
AT1G28670 | Arabidopsis thaliana lipase |
AT5G03545 | Expressed in roots in response to phosphate starvation, this response is enhanced by the presence of IAA. Additionally, its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. The mRNA is cell-to-cell mobile. |
AT4G38250 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT1G01720 | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. The mRNA is cell-to-cell mobile. |
AT5G08790 | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
AT5G65990 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT1G17720 | type 2A protein serine/threonine phosphatase 55 kDa B |
AT5G03470 | Encodes B' regulatory subunit of PP2A (AtB'alpha), putative size of 57 kDa.Functions redundantly with the beta subunit do maintain sister chromatid cohesion during meiosis. |
AT1G30720 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G30730 | FAD-binding Berberine family protein;(source:Araport11) |
AT4G20820 | FAD-binding Berberine family protein;(source:Araport11) |
AT4G20830 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). It is involved in plant immunity. Overexpressing plants are more resistant to B. cinerea. |
AT4G20840 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
AT4G20860 | involved in the generation of H2O2 from reduced compounds |
AT5G44390 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G44410 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G26420 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G30710 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G65780 | Encodes a chloroplast branched-chain amino acid aminotransferase, can complement the yeast leu/iso-leu/val auxotrophy mutant. Note that the AT5G65780.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. The mRNA is cell-to-cell mobile. |
AT1G51160 | TRAPP protein BET5 homolog. |
AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile. |
AT3G13790 | Encodes a protein with invertase activity. |
AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT3G19450 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. The mRNA is cell-to-cell mobile. |
AT4G25780 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT1G02300 | Encodes a capase involved in stress induced cell death. |
AT1G02305 | Encodes a capase involved in stress induced cell death. |
AT4G01610 | Encodes a capase involved in stress induced cell death. Activity detected in leaf and cell culture. |
AT5G56340 | RING/U-box superfamily protein;(source:Araport11) |
AT5G03760 | encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root. |
AT2G25900 | Encodes a protein with two tandem-arrayed CCCH-type zinc fingers that binds RNA and is involved in RNA turnover. The mRNA is cell-to-cell mobile. |
AT5G10310 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT4G37810 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT1G79940 | J domain protein localized in ER membrane. Mutants have defective pollen germination. |
AT3G08970 | J domain protein localized in ER lumen. Can compensate for the growth defect in jem1 scj1 mutant yeast. Also shows similarity to HSP40 proteins and is induced by heat stress. At high temperatures, mutant alleles are not transmitted through the pollen due to defects in pollen tube growth. |
AT3G62600 | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. Forms a complex SDF2-ERdj3B-BiP that is required for the proper accumulation of the surface-exposed leucine-rich repeat receptor kinases EFR. EFR is involved in PAMP (pathogen associated molecular patterns) triggered immunity. |
AT5G48460 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
AT3G11730 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein. |
AT5G48400 | member of Putative ligand-gated ion channel subunit family |
AT3G08030 | The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein. |
AT1G52150 | Member of the class III HD-ZIP protein family. Contains homeodomain and leucine zipper domain. Critical for vascular development and negatively regulates vascular cell differentiation. |
AT1G69780 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein which is expressed during the seed-to-seedling transition, regulates some of the network nodes, and affects late seedling establishment. Knock-out mutants for athb13 showed increased primary root length as compared with wild type (Col-0) seedlings, suggesting that this transcription factor is a negative regulator of early root growth, possibly repressing cell division and/or cell elongation or the length of time cells elongate. |
AT4G03520 | Encodes a redox activated co-chaperone, chloroplast localized thioredoxin, similar to prokaryotic types. |
AT4G10250 | Columbia endomembrane-localized small heat shock protein |
AT1G73130 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
AT1G09300 | Encodes a mitochondrial protease ICP55. Alters the stability of proteins by removal of a single amino acid from their sequence. |
AT5G05810 | RING/U-box superfamily protein;(source:Araport11) |
AT1G76410 | RING/U-box superfamily protein;(source:Araport11) |
AT2G01910 | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile. |
AT1G18150 | Encodes mitogen-activated protein kinase 8 (MPK8). MPK8 connects protein phosphorylation, Ca2+, and ROS in the wound-signaling pathway. |
AT3G27560 | encodes a protein with kinase domains, including catalytic domains for serine/threonine as well as tyrosine kinases. a member of multi-gene family and is expressed in all tissues examined. |
AT3G05830 | Encodes alpha-helical IF (intermediate filament)-like protein.NEAP1 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
AT5G26770 | NEAP2 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
AT1G09470 | NEAP3 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
AT5G62720 | Integral membrane HPP family protein. Putative nitrate transporter. |
AT4G16160 | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. Two OEP16 genes are closely related to each other and are conserved in all land plants, OEP16-2, also named OEP16-S, and OEP16-1 (renamed OEP16-L) are result of the gene duplication event that occurred prior to divergence of bryophytes and seed plants. Predominantly expressed in seed and is not inducible by cold treatment. atOEP16-S gained an additional exon. The promoter region of atOEP16-S (but not atOEP16-L) contains multiple G-box ABA-responsive elements. The atOEP16-S promoter conferred developmentally regulated seed- and pollen-specific GUS expression in tobacco. |
AT1G01230 | ORM1 is an ER localized orosomucoid-like protein involved in sphingolipid homeostasis. |
AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
AT3G27580 | D6PK family kinase involved in pulse-induced phototropism but also for time-dependent second positive phototropism, and continuous light-induced hypocotyl phototropism.D6PKL3 is polarly localized within the plasma membrane. It is involved in pollen aperture formation. The protein is localized within distinct regions of the pollen plasma membrane and mutants are also defective in pollen aperture formation. |
AT1G62760 | Pectin methylesterase inhibitor that controls PME activity and pectin methylesterification during Botrytis infection. |
AT2G43050 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G11570 | Encodes plastid localized protein involved in riboflavin biosynthesis. It dephosphorylates 5-amino-6-ribitylamino- 2,4(1H,3H) pyrimidinedione 5′-phosphate (ARPP) . |
AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
AT5G59840 | Ras-related small GTP-binding family protein;(source:Araport11) |
AT1G19230 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
AT4G16830 | Encodes a perinuclear and cytoplasmically localized mRNA binding protein. AtRGGA is likely involved in stress responsivness. It is induced by salt and osmotic stress and loss of function mutations are more sensitive to stress. The mRNA is cell-to-cell mobile. |
AT1G32200 | Encodes a chloroplast glycerol-3-phosphate acyltransferase.Involved in the biosynthesis of chloroplast phosphatidylglycerol. |
AT4G01810 | Sec23 homolog , forms a distinct clade with SEC23D.Mutants have defects in pollen exine patterning, tapetal development and pollen intine formation. |
AT4G14160 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
AT3G01720 | peptidyl serine alpha-galactosyltransferase;(source:Araport11) |
AT3G08760 | Encodes an osmotic stress-inducible kinase that functions as a negative regulator of osmotic stress signaling in plants. |
AT3G05840 | Glycogen synthase kinase-3 member which encodes a SHAGGY-like kinase involved in meristem organization. Regulates flowering through mediating CONSTANS stability. |
AT2G16860 | GCIP-interacting family protein;(source:Araport11) |
AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
AT1G68020 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain and a trehalose phosphatase (TPP)-like domain. It can complement a yeast mutant lacking both of these activities suggesting that this is a bifunctional enzyme. |
AT2G03300 | TX12 is a Toll/Interleukin-1 receptor domain containing protein. Misexpression results in ectopic activation of defense response genes. |
AT1G27650 | U2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions. |
AT1G45050 | member of ubiquitin-conjugating E2-proteins |
AT3G62830 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
AT1G78690 | Encodes a lysoglycerophospholipid O-acyltransferase that acylates 1-acyl lyso PE and 1-acyl lyso PG but not PE or PG. |
AT5G44380 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G79900 | encodes a mitochondrial ornithine transporter that exports ornithine from the mitochondria to the cytosol |
AT3G06850 | dihydrolipoamide branched chain acyltransferase |
AT5G20950 | Encodes a beta-glucosidase involved in xyloglucan metabolism. |
AT5G51780 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G03040 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT1G22490 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
AT2G42300 | Together with bHLH60 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
AT3G57800 | Together with bHLH48 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
AT4G27890 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT2G39760 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
AT3G09360 | Cyclin/Brf1-like TBP-binding protein. Double mutants with BRF1 show defects in pollen development. Controls FES1A regulated thermosensitivity. |
AT2G42270 | Similar to yeast Brr2p DEAD/DExH box ATP-dependent RNA helicase. |
AT4G37390 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
AT3G12300 | Similar to Bug22p in Paramecium, a conserved centrosomal/ciliary protein. This protein is widespread in eukaryotes harboring centrioles/cilia at some stage of their life cycles. Among eukaryotes devoid of centrioles/cilia, plants possess BUG22 genes whereas some fungi (at least ascomycetes) do not. |
AT2G42380 | Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP61. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells. |
AT3G58120 | Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP34. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells. |
AT5G28770 | BASIC LEUCINE ZIPPER protein which regulates the circadian oscillator gene PSEUDO RESPONSE REGULATOR7 (PRR7) to change the circadian phase in response to sugars. It upregulates PRR7 in response to low energy. bZIP63 and PRR7 are required for correct oscillator phase under light/dark cycles. bZIP protein BZO2H3 mRNA, partial cds |
AT5G19430 | Encodes a C3HC4-type RING finger E3 ubiquitin ligase of the RING/U-box superfamily whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
AT5G06830 | Conserved reticulophagy receptor that bridges the gap betweenselective autophagy and ribosome stalling at the endoplasmic reticulum. Interacts directly with ATG8. Recruited to phagophores, precursors to autophagosomes, during ER stress in an autophagy-dependent manner. Forms a receptor complex with UFL1, the E3 ligase that mediates ufmylation, and its adaptor protein, DDRGK1. |
AT3G57060 | Similar to mamalian condensin. Mutants have reduced fertility. |
AT5G14060 | lysine-sensitive aspartate kinase |
AT5G57580 | Calmodulin-binding protein;(source:Araport11) |
AT2G18750 | Calmodulin-binding protein;(source:Araport11) |
AT4G25800 | Calmodulin-binding protein;(source:Araport11) |
AT5G03455 | Encodes a homolog of yeast cell cycle regulator CDC25. It has a sole catalytic domain and devoid of the N-terminal regulatory region found in the human CDC25 and is capable of reducing the mitotic cell length of transformed fission yeast. Non-plant CDC25 proteins have been shown to do this. However, the gene is more or less constant, regardless of whether the tissue examined contained proliferative cells. Also described as having arsenate reductase activity involved in arsenate resistance. |
AT1G07270 | Cell division control, Cdc6;(source:Araport11) |
AT2G33510 | CFL1 is a negative regulator of cuticle development. Overexpression of CFL1 causes defects in cuticle formation. Interacts with FBH1, FBH3 and HDG1 to regulate cuticle formation. The physical interaction requires the C terminal 50 amino acids. |
AT5G14170 | CHC1 is predicted to encode a protein that belongs to the chromodomain remodeling complex. Two RNAi knock-down lines have a dwarf phenotype and reduced rates of Agrobacterium-mediated transformation. The low rate of root-mediated transformation rate may result from altered root morphology or reduced root growth rates. Also named as SWP73B, a subunit of the SWI/SNF chromatin remodeling complex. Acts as important modulator of major developmental pathways. |
AT1G62820 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT4G12130 | Encodes a mitochondrial COG0354 protein that requires folate for its function in Fe/S cluster biogenesis. |
AT3G24200 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT4G33320 | DUF641 domain protein, probable psuedogene. |
AT1G56190 | One of a pair of plastid localized phosphoglycerate kinases involved in galactolipid biosynthesis. Functions redundantly with AT3g12780 (PGK1) in the chloroplast in the biosynthesis of thylakoid membrane galactolipids. Double mutants are photosynthetically incompetent, plants are albino and seedling lethal. |
AT5G08650 | Critical for chloroplast protein synthesis under suboptimal conditions. Essential translation factor that promotes the efficiency of chloroplast protein synthesis. |
AT5G18820 | Encodes a subunit of chloroplasts chaperonins that are involved in mediating the folding of newly synthesized, translocated, or stress-denatured proteins. Cpn60 subunits are: Cpn60alpha1 (At2g28000), AtCpn60alpha2 (At5g18820), AtCpn60beta1 (At1g55490), AtCpn60beta2 (At3g13470), AtCpn60beta3 (At5g56500), AtCpn60beta4 (At1g26230). |
AT1G45180 | RING/U-box superfamily protein;(source:Araport11) |
AT5G42940 | RING/U-box superfamily protein;(source:Araport11) |
AT5G24870 | Ubiquitin E3 ligase, works with WDL7 in module which regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
AT2G37150 | RING/U-box superfamily protein;(source:Araport11) |
AT1G73760 | RING/U-box superfamily protein;(source:Araport11) |
AT1G59650 | Encodes CW14. |
AT1G17130 | DUF572 domain protein involved in alternative splicing. |
AT3G48690 | Encodes a protein with carboxylesterase whose activity was tested using both pNA and 2,4-D-methyl. |
AT2G40140 | zinc finger (CCCH-type) family protein;(source:Araport11) |
AT2G29290 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G34170 | hypothetical protein (DUF688);(source:Araport11) |
AT1G62500 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G29200 | Over-expressed by salt stress. |
AT1G76880 | DF1 is a putative transcription factor required for the synthesis of seed mucilage polysaccharides. The df1 seeds produce almost 50% less mucilage than wild-type, but show less severe defects than the myb5 and ttg2 mutants. |
AT3G02720 | Encodes a glyoxalase with high activity towards glyoxal and methylglyoxal. It differs from its animal and bacterial homologs with respect to the configuration of its catalytic residues and the oligomeric property of the enzyme. The mRNA is cell-to-cell mobile. |
AT1G56300 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G64620 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
AT5G62440 | Encodes a protein DOMINO1 that belongs to a plant-specific gene family sharing a common motif present in the tomato DEFECTIVE CHLOROPLASTS AND LEAVES (LeDCL) protein. DOMINO1 is located in the nucleus. Arabidopsis embryos carrying the domino1 mutation grow slowly in comparison with wild type embryos and reach only the globular stage at desiccation. The primary defect of the mutation at the cellular level is the large size of the nucleolus that can be observed soon after fertilization in the nuclei of both the embryo and the endosperm. DOMINO1 might have a role in ribosome biogenesis and in determining the rate of cell division. |
AT5G02470 | core cell cycle genes |
AT2G40340 | Encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
AT4G39520 | Encodes a member of the DRG (developmentally regulated G-protein) family. Has GTPase activity. |
AT2G17190 | Encodes a ubiquitin receptor protein that specifically associates with PEX2 and PEX12. |
AT2G17200 | Encodes a ubiquitin receptor protein that specifically associates with PEX2 and PEX12. |
AT2G41750 | Involved in posttranscriptional modification of tRNA. Can form acp3U20b on a tRNA expressed in yeast cells. The aspartate and tryptophan residues in the DXTW motif of this protein are required for modification activity. Required for the acp3U20a modification of cytosolic tRNA. |
AT1G47530 | MATE efflux family protein;(source:Araport11) |
AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
AT1G18100 | Encodes a member of the FT and TFL1 family of phosphatidylethanolamine-binding proteins. It is expressed in seeds and up-regulated in response to ABA. Loss of function mutants show decreased rate of germination in the presence of ABA. ABA dependent regulation is mediated by both ABI3 and ABI5. ABI5 promotes MFT expression, primarily in the radicle-hypocotyl transition zone and ABI3 suppresses it in the seed. |
AT1G29550 | Eukaryotic initiation factor 4E protein;(source:Araport11) |
AT3G12400 | Mutants of this gene were initially identified because of the trichome morphogenesis phenotype. Those trichomes have multiple nuclei, a defect that turns out not to be restricted to the trichomes but also in all endoreduplicating cell types. This gene encodes a ubiquitin-binding protein with sequence similarities with yeast proteins that are components of the ESCRTI-III complexes. The Arabidopsis protein is found associated with the endosome. |
AT1G13880 | ELM2 domain-containing protein;(source:Araport11) |
AT1G05070 | transmembrane protein, putative (DUF1068);(source:Araport11) |
AT2G24290 | ubiquitin-associated protein (DUF1068);(source:Araport11) |
AT5G39960 | GTP-binding protein;(source:Araport11) |
AT5G11480 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G58370 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G13800 | magnesium transporter NIPA (DUF803);(source:Araport11) |
AT1G71900 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT5G04670 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
AT1G19210 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT5G07580 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT4G13050 | Acyl-ACP thioesterase;(source:Araport11) |
AT1G69572 | Circadian regulated lncRNA, natural antisense gene of CDF5 (AT1G69570). Displays antiphasic expression pattern in relation to CDF5 expression (PMID:28758689). |
AT3G12570 | FYD;(source:Araport11) |
AT1G52343 | Similar to GET2, transmembrane protein that interacts with GET1. |
AT3G06580 | Encodes a protein with galactose kinase activity. The gene was shown to complement the yeast Agal1 mutant defective in the galactokinase gene GAL1. |
AT5G62620 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. Mutants display multiple phenotypes including reduced seed coat mucilage and accelerated leaf senescence. |
AT3G13040 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
AT2G23170 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. |
AT3G49880 | glycosyl hydrolase family protein 43;(source:Araport11) |
AT2G41540 | Encodes a protein with NAD-dependent glycerol-3-phosphate (G3P) dehydrogenase which was shown to complement an Escherichia coli strain: BB20-14, auxotrophic for glycerol/G3P due to a loss-of-function mutation in the gpsA gene. |
AT1G28480 | Encodes GRX480, a member of the glutaredoxin family that regulates protein redox state. GRX480 interacts with TGA factors and suppresses JA-responsive PDF1.2 transcription. GRX480 transcription is SA-inducible and requires NPR1. Maybe involved in SA/JA cross-talk. It has also been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
AT3G62950 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
AT1G76890 | encodes a plant trihelix DNA-binding protein |
AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
AT1G08880 | Encodes HTA5, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10?20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin. |
AT1G32750 | This gene is predicted to encode a histone acetyltransferase. Five lines with RNAi constructs directed against HAF1 grow normally and can produce root calli, but have defects in agrobacterium-mediated transformation. |
AT2G22800 | Encodes homeobox protein HAT9. |
AT2G27840 | Belongs to the plant specific HD2 type proteins; similar to nucleolar Zea mays histone deacetylase; HD2-p39 |
AT1G58290 | Encodes a protein with glutamyl-tRNA reductase (GluTR) activity, catalyzing the NADPH-dependent reduction of Glu-tRNA(Glu) to glutamate 1-semialdehyde (GSA) with the release of free tRNA(Glu). It is involved in the early steps of chlorophyll biosynthesis. |
AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
AT1G69740 | Encodes a putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis. |
AT3G14930 | Uroporphyrinogen decarboxylase;(source:Araport11) |
AT1G68670 | HHO2 is a HRS1 homolog. Nitrate-inducible expression. Also induced in roots by low Pi and is likely involved in maintaining phosphate homeostasis. It is target of PHR1.Both HHO2 and HRS1 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
AT3G18035 | A linker histone like protein |
AT4G36830 | ELO family protein. |
AT3G03890 | Dimeric β-barrel protein that is structurally related to the putative non-canonical heme oxygenase (HO) and is located in chloroplasts. May function additionally in the tetrapyrrole biosynthetic pathway. |
AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
AT2G29500 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT1G07400 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT3G46030 | Histone superfamily protein;(source:Araport11) |
AT5G59910 | Histone superfamily protein;(source:Araport11) |
AT2G37470 | Histone superfamily protein;(source:Araport11) |
AT3G53650 | Histone superfamily protein;(source:Araport11) |
AT1G01370 | Encodes a centromere-identifying protein histone H3 variant. Localized at centromeres in both mitotic and meiotic cells. Aurora3 phosphorylates CENH3 at S65; this post-translational modification is required for the proper development of the floral meristem. |
AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
AT5G58100 | Encodes a membrane protein involved in pollen nexine and sexine development. |
AT1G26170 | Ran effector. |
AT1G15320 | seed dormancy control protein;(source:Araport11) |
AT2G26190 | IQM4 is a plastid localized, Ca2+ independent calmodulin binding protein that is involved in promoting seed dormancy. |
AT5G24360 | IRE1A and IRE1B catalyze bZIP60 mRNA splicing, producing the active bZIP60 transcription factor. |
AT1G70480 | Protein residing in the chloroplast outer membrane, has channel-like properties facilitating the export of the jasmonate precursor 12-oxophytodienoic acid (OPDA) from the chloroplast. |
AT1G11950 | Transcription factor jumonji (jmjC) domain-containing protein;(source:Araport11) |
AT1G62310 | Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3. |
AT3G08960 | Ran effector. |
AT4G10920 | Transcriptional co-activator. Forms homodimers or heterodimers with the kiwi protein. Both proteins are involved in gene activation during pathogen defense and plant development. |
AT3G12130 | KHZ1 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ2. khz1 mutants are late flowering and double mutants with khz2 are even more late flowering. Overexpression leads to increased rates of leaf senescence. |
AT3G50240 | Encodes a kinesin-related protein. |
AT1G55460 | DNA/RNA-binding protein Kin17, conserved region;(source:Araport11) |
AT1G24360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G34480 | Encodes a nuclear localized member of the ribosomal L18ae/LX protein family. Loss of function mutations show reduced transmission through the gametophytes and embryo lethality. |
AT1G04970 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. Putative BPI/LBP family protein. |
AT3G20270 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. |
AT1G24170 | Encodes a protein with putative galacturonosyltransferase activity. |
AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
AT1G09970 | RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. The mRNA is cell-to-cell mobile. |
AT2G41260 | Late-embryogenesis-abundant gene. Involved in the acquisition of desiccation tolerance during late phase of embryogenesis. |
AT1G18160 | required for ABA- and osmotic-stress-MAP3 kinase required for activation of SnRK2 kinases, enabling robust ABA and osmotic stress signal transduction. |
AT1G30050 | tropomyosin;(source:Araport11) |
AT5G13240 | Global repressor of RNA polymerase III (Pol III). Maf1 repressor activity is critical for plant survival during environmental stresses, and is regulated by its phosphorylation/dephosphorylation through the activity of TOR and PP4/PP2A phosphatases. |
AT5G11650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G16120 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G19290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G73480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G77420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G39400 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G39420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G13020 | Encodes a member of the cdc2+ family of protein kinases MHK. Similar to the mak genes of rats. mak encodes a protein kinase that may play a role in spermatogenesis. |
AT1G78830 | In combination with MYB4, MAN3, and Mannose part of signaling cascade which regulates cadmium tolerance. Mannose is able to bind to the GNA-related domain of MNB1; mannose binding to the GNA-related domain of MNB1 is required for MAN3-mediated Cd tolerance. |
AT4G19045 | Member of a conserved family of proteins. Functions redundantly with MOB1A to regulate cell proliferation and JA metabolism. |
AT5G26340 | Encodes a protein with high affinity, hexose-specific/H+ symporter activity. The activity of the transporter appears to be negatively regulated by phosphorylation. Importantly, microarray analysis, as well as the study of the expression of this gene in mutants involved in programmed cell death (PCD) demonstrated a tight correlation between this gene's expression and PCD. |
AT4G09620 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT4G19650 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G21150 | mTERF protein involved in mitochondrial development; required for salt tolerance. |
AT1G61970 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G61980 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT5G55580 | Encodes a mitochondrial transcription termination factor (mTERF) family protein. The gene product is targeted to the chloroplast nucleoid and mutants are affected in plastid gene expression and chloroplast development. Mutants, named as twirt1 (twr-1), display altered root meristem function resulting in short roots. Mutation also affects shoot meristem function. |
AT2G39450 | Encodes a Golgi-localized manganese transporter that is involved in Mn tolerance. When expressed into yeast cells, this gene confer Mn2+ and Cu2+ tolerance. |
AT3G58060 | TP8 is a tonoplast localized member of CDF family of cation transporters. It functions in roots as an Mn transporter.MTP8 transports manganese into root vacuoles of iron-deficient plants and thereby prevents inhibition of iron deficiency-induced ferric chelate reductase by manganese. In seed embryos, MTP8 is responsible for manganese and iron enrichment in the subepidermal cell layer (particularly in vit1 mutant background.) |
AT5G05100 | R3H RNA binding protein that interacts with AGO2 and miRNA. |
AT1G63680 | Encodes AtMurE, a homolog of the bacterial MurE that catalyze the ATP-dependent formation of UDP-N-acetylmuramic acid-tripeptide in bacterial peptidoglycan biosynthesis. Localized to plastids. AtMurE is involved in chloroplast biogenesis. |
AT2G40970 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G08520 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT1G32640 | Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif and interacts with Jasmonate ZIM-domain proteins. MYC2 interacts with EIN3 and EIL1 to repress hook curvature and resistance to Botrytis cinera.Its transcription is induced by dehydration stress, ABA treatment and blue light via CRY1. Negative regulator of blue light-mediated photomorphogenic growth and blue and far-red-light-regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. For example it binds to and regulates the expression of NST1. Its stability is modulated by PUB10 through polyubiquitination. |
AT5G46760 | MYC3 is a JAZ-interacting transcription factor that act together with MYC2 and MYC4 to activate JA-responses. The mRNA is cell-to-cell mobile. |
AT4G17880 | MYC4 is bHLH transcriptional regulator. It functions as a JAZ-interacting transcription factor that acts together with MYC2 and MYC3 to activate JA-responses. It also functions in blue light mediated secondary cell wall biogenesis via regulation of NST1 expression. MYC4 directly binds to NST1 promoter and activates its expression. |
AT4G13630 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT2G22770 | Regulates the development of ER bodies. also involves in response to the endophytic fungus Piriformospora indica. |
AT5G02290 | Encodes a candidate protein kinase NAK that is similar to the oncogenes met and abl. |
AT3G54630 | kinetochore protein;(source:Araport11) |
AT3G54200 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT2G41930 | Protein kinase superfamily protein;(source:Araport11) |
AT5G41190 | Encodes a cytoplasmic protein with RNA endonuclease activity. Mutants display aberrant RNA processing and male and female gametophyte development. |
AT5G55850 | NOI protein |
AT5G18230 | transcription regulator NOT2/NOT3/NOT5 family protein;(source:Araport11) |
AT5G60170 | E3 ligase involved in regulation of chloroplast protein synthesis through activity of PGR3. |
AT2G28540 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G32550 | Cell differentiation, Rcd1-like protein;(source:Araport11) |
AT1G72130 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
AT1G67900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT1G49670 | molecular function has not been defined. Was shown involved in oxidative stress tolerance. |
AT1G51130 | δ-kleisin component of the SMC5/6 complex, possibly involved in synaptonemal complex formation. |
AT1G76940 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G60980 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
AT3G14590 | Ca2+-dependent lipid-binding protein |
AT3G51620 | PAP/OAS1 substrate-binding domain superfamily;(source:Araport11) |
AT3G61690 | Putative TNAase |
AT3G10650 | Encodes a nucleoporin involved in mRNA export from the nucleus. It is also involved in the regulation of nuclear morphology. |
AT1G07615 | GTP-binding protein Obg/CgtA;(source:Araport11) |
AT3G57990 | Encodes a ?-barrel protein, named OEP40, locates in in the outer envelope of chloroplasts, and functions as a solute channel which is selectively permeable for glucose. |
AT1G74930 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile. |
AT1G11960 | Calcium channel that is phosphorylated by BIK1 in the presence of PAMPS and required for stomatal immunity. |
AT4G35870 | early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT5G40660 | Encodes an F-type ATP Synthase Assembly factor that binds to beta subunits of mitochondrial ATPase. |
AT5G16680 | PHD protein which cooperates with AIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT3G52780 | Purple acid phosphatases superfamily protein;(source:Araport11) |
AT3G48760 | DHHC-type zinc finger family protein;(source:Araport11) |
AT1G72160 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G30690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT3G51670 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
AT5G14710 | proteasome assembly chaperone-like protein;(source:Araport11) |
AT3G27430 | Encodes 20S proteasome beta subunit PBB1 (PBB1). |
AT5G35580 | Protein kinase superfamily protein;(source:Araport11) |
AT1G76360 | Protein kinase superfamily protein;(source:Araport11) |
AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
AT1G50950 | protein disulfide-isomerase 5-like protein (DUF1692);(source:Araport11) |
AT1G77600 | One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis. |
AT5G07500 | Encodes an embryo-specific zinc finger transcription factor required for heart-stage embryo formation. |
AT3G27110 | PGM48 is a member of a plant specific clade of metallo-endopeptidase proteins. It is found in plastoglobules. Analysis of over-expression and loss of function phenotypes suggests PGM48 may have a role in positively regulating senescence. |
AT5G61100 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT5G61120 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT5G12150 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
AT5G19390 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
AT4G27320 | Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase. |
AT4G22990 | Encodes a member of the PHOSPHATE TRANSPORTER 5 family (PHT5;3). Overexpression of PHT5:3 leads to Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
AT4G40080 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT1G14910 | ANTH domain-containing protein which functions as adaptor protein for clathrin-mediated endocytosis (CME) of the secretory vesicle-associated longintype R-SNARE VAMP72 group. Interacts with the SNARE domain of VAMP72 and clathrin at the plasma membrane. Required for recycling of R-SNARE proteins. |
AT5G35200 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
AT1G01460 | Type I phosphatidylinositol-4-phosphate 5-kinase, subfamily A. |
AT2G06925 | Encodes a secretory phospholipase A2 enzyme, which specifically hydrolyzes the sn-2 position of phospholipids. The enzyme has a preference towards linoleoyl acyl chain over palmitoyl acyl chain. It also has a slight preference for phosphatidylcholine over phosphatidylethanolamine. |
AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
AT3G60670 | PLATZ transcription factor family protein;(source:Araport11) |
AT1G76590 | PLATZ transcription factor family protein;(source:Araport11) |
AT3G28210 | Encodes a putative zinc finger protein (PMZ). |
AT1G33612 | Encodes a receptor for the Plant Natriuretic Peptide (At2g18660, AtPNP-A). The receptor contains a functional guanylyl cyclase catalytic center embedded in the cytosolic kinase domain. This catalytic center can convert GTP into cGMP (and PPi) which enables ligand-specific downstream signalling. It is therefore consistent with the reported cGMP dependence of AtPNP-A effects (see DOI:10.1007/s11103-016-0465-8). |
AT5G41880 | DNA primase POLA3;(source:Araport11) |
AT1G78650 | Similar to DNA polymerase delta (POLD3), which in other organism was shown to be involved in the elongation of DNA replication. |
AT3G26020 | Encodes protein phosphatase 2A (PP2A) B'eta subunit. Targeted to nucleus and cytosol. |
AT1G55190 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
AT3G13720 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
AT4G31250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G72460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G44570 | Encodes a PPR protein involved in mitochondrial functioning. Mutants suppress cell wall defects caused by C17 chemical inhibitor. Mutants are defective in cytochrome c maturation and activation of mitochondrial retrograde signalling. |
AT5G44572 | transmembrane protein;(source:Araport11) |
AT5G44574 | transmembrane protein;(source:Araport11) |
AT2G40650 | PRP38 family protein;(source:Araport11) |
AT5G46400 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G21960 | Encodes AT4g21960 (AT4g21960/T8O5_170). The mRNA is cell-to-cell mobile. |
AT1G03600 | PSB27 is a chloroplast lumen localized protein that is involved in adaptation to changes in light intensity. |
AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G09800 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G65920 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT2G45910 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT4G25160 | Encodes a U-box domain-containing E3 ubiquitin ligase with central Ser/Thr protein kinase domain whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
AT4G36550 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G61550 | U-box domain-containing protein kinase family protein;(source:Araport11) |
AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT1G56030 | RING/U-box protein;(source:Araport11) |
AT5G26667 | encodes a uridine 5'-monophosphate (UMP)/cytidine 5'-monophosphate (CMP) kinase. The mRNA is cell-to-cell mobile. |
AT5G16630 | DNA repair protein Rad4 family;(source:Araport11) |
AT5G22750 | DNA repair gene. gamma-radiation hypersensitive (RAD5) involved in stable transformation and T-DNA transfer |
AT2G31970 | Encodes the Arabidopsis RAD50 homologue. It is involved in double strand break repair. Component of the meiotic recombination complex that processes meiotic double-strand-breaks to produce single-stranded DNA ends, which act in the homology search and recombination. Accumulates in the nucleus during meiotic prophase, a process regulated by PHS1. |
AT2G28560 | Encodes a protein of the RAD51B family involved in double stranded DNA repair. Homozygous mutant plants show increased sensitivity to mitomycin which induces DS breaks. |
AT5G43530 | Helicase protein with RING/U-box domain-containing protein;(source:Araport11) |
AT3G05480 | Involved in the regulation of DNA damage repair and homologous recombination. |
AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
AT4G11230 | NADPH-oxidase RbohI is expressed highly in seeds and roots. Mutants have inreased sensitivity to osmotic stress suggesting a role in mediating cellular response to stress in roots. |
AT1G11650 | Encodes an RNA binding protein with three RNA recognition motifs. The mRNA is cell-to-cell mobile. |
AT3G19184 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT3G46770 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT3G06160 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT4G26540 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
AT1G71980 | RMR2 is a secretory pathway protein localized to the trans-golgi network. It belongs to a family of vacuolar sorting receptors. If forms heterodimers with RMR1. |
AT1G55140 | Encodes one of two chloroplast Mini-RNase III-like enzymes in Arabidopsis. Double mutants display imprecise maturation of 23S rRNA and other rRNAs. |
AT3G13740 | Encodes one of two chloroplast Mini-RNase III-like enzymes in Arabidopsis. Double mutants display imprecise maturation of 23S rRNA and other rRNAs. |
AT1G24090 | RNase H family protein;(source:Araport11) |
AT1G74450 | Plants overexpressing At1g74450 are stunted in height and have reduced male fertility. |
AT5G18600 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
AT5G14070 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. ROXY2, together with ROXY1 (AT3G02000), controls anther development. roxy1 roxy2 double mutants are sterile and do not produce pollen. |
AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
AT3G02920 | Replication protein A, subunit RPA32;(source:Araport11) |
AT1G15250 | cytosolic ribosomal protein gene, part of eL20 family |
AT3G61620 | exonuclease RRP41 (RRP41) |
AT5G22070 | Putative glycosyltransferase that negatively regulates leaf senescence in a SID2 dependent manner. |
AT2G28620 | Mutants have radially swollen roots but do not exhibit defects in abundance or orientation of cortical microtubules, nor are microfibrils reduced. Cellulose synthesis is also unchanged with respect to wild type. There is a disruption in the normal pattern of cell wall placement. |
AT1G58520 | GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
AT5G62460 | RZFP is a zinc finger protein involved in mediating abiotic stress tolerance. |
AT5G09460 | transcription factor bHLH143;(source:Araport11) |
AT1G29950 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G63980 | Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. It is involved in the response to cold, drought (negative regulator of drought tolerance), and ABA. Mutants in this gene exhibit enhanced induction of stress genes in response to cold, ABA, salt and dehydration and increased levels of 3'-phosphoadenosine 5'-phosphate (PAP). Involved in degradation of small mRNAs. Mutants also affect the accumulation of miRNA target cleavage products. Regulates light-dependent repression of hypocotyl elongation and flowering time via its 3'(2'),5'-bisphosphate nucleotidase activity. Its activity is sensitive to the redox state of its environment, decreasing under oxidative conditions and is regulated by dimerization and intra and inter-molecular disulfide bond formation. |
AT2G47820 | arginine-glutamic acid dipeptide repeat protein;(source:Araport11) |
AT2G39725 | LYR family of Fe/S cluster biogenesis protein;(source:Araport11) |
AT4G12120 | member of KEULE Gene Family |
AT1G18830 | Together with SEC31B a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
AT3G63460 | Together with SEC31A a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
AT1G71820 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
AT2G34980 | Encodes a putative phosphatidylinositol-glycan synthase subunit C gene. It is involved in the first step of the glycosylphosphatidylinositol (GPI) biosynthetic pathway. |
AT3G54690 | Sugar isomerase (SIS) family protein;(source:Araport11) |
AT4G14342 | Splicing factor 3B subunit 5/RDS3 complex subunit 10;(source:Araport11) |
AT5G27350 | Encodes a sugar-porter family protein that is induced during leaf senescence. The increase in its gene expression during leaf senescence is paralleled by an accumulation of monosaccharides. The mRNA is cell-to-cell mobile. |
AT5G58575 | Component of the deubiquitination module of the SAGA complex. |
AT5G54840 | Monomeric G protein. Expressed in the root quiescent center, flowers, and leaf guard cells and hydathodes. |
AT3G21700 | Monomeric G protein. Expressed in root epidermal cells that are destined to become atrichoblasts. Also expressed during pollen development and in the pollen tube tip. |
AT1G69220 | Encodes serine/threonine kinase 1 (SIK1), a Hippo homolog. Regulates cell proliferation and cell expansion. |
AT3G61790 | SINAT E3 ubiquitin ligase involved in mediation of FREE1 and VPS23A degradation to modulate abscisic acid signaling. |
AT4G27880 | Encodes an E3 ubiquitin ligase that functions in 26S proteosome pathway. Targeting of proteins for degradation such RD21A results in indirect effects such as loss of drought induced stomatal immunity. |
AT1G21410 | AtSKP2;1 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. |
AT1G77000 | AtSKP2;2 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. AtSKP2b may also be involved in the degradation of KRP1/ICK1, a CDK inhibitor. |
AT4G12420 | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
AT3G07590 | SmD1a is one of two Yeast SmD1 orthologs, lower levels than SmD1b.It is localized to the nucleus and may play a minor role in RNA splicing and indirectly facilitating PTGS. |
AT2G28870 | cyclin-dependent kinase inhibitor SMR1-like protein;(source:Araport11) |
AT2G37610 | hypothetical protein;(source:Araport11) |
AT5G02420 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
AT5G40460 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
AT1G10690 | cyclin-dependent kinase inhibitor;(source:Araport11) |
AT1G14200 | E3 ligase involved in the regulation of the homeostasis of sensor NLR immune receptors. |
AT2G37970 | Encodes a cytosolic heme binding protein(cHBP)that can reversibly bind tetrapyrroles including heme, protoporphyrin IX and Mg-protoporphyrin IX dimethyl ester with distinct binding affinities. |
AT5G08565 | Transcription initiation Spt4-like protein;(source:Araport11) |
AT2G47090 | zinc ion binding/nucleic acid binding protein;(source:Araport11) |
AT3G62240 | RING/U-box superfamily protein;(source:Araport11) |
AT5G44568 | Secreted peptide which functions in plant growth and pathogen defense. |
AT4G08810 | Calcium binding protein involved in cryptochrome and phytochrome coaction |
AT5G65300 | Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering. |
AT3G04380 | Encodes SUVR4, a nucleolar histone methyltransferase with preference for monomethylated H3K9. One of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. |
AT1G09310 | ABA responsive trichome formation regulator. |
AT4G25010 | Encodes a member of the SWEET sucrose efflux transporter family proteins. Together with SWEET13, it is likely involved in modulating the GA response and is required for proper development of anthers, seeds and seedlings. |
AT3G16690 | Nodulin MtN3 family protein;(source:Araport11) |
AT4G15920 | Encodes a vacuolar fructose transporter expressed in parenchyma and xylem that controls leaf fructose content. When its expression is reduced, fructose accumulates in leaves. |
AT3G14770 | Nodulin MtN3 family protein;(source:Araport11) |
AT2G35605 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
AT5G40840 | Cohesion family protein SYN2 (SYN2). Plays a role in somatic DNA double strand break damage repair. |
AT5G04220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G65540 | transcription initiation factor TFIID subunit;(source:Araport11) |
AT3G19100 | Encodes a protein kinase that positively regulates gibberellic acid (GA) signaling by inactivating the E3 ubiquitin ligase GARU. GARU mediates ubiquitin-dependent degradation of GID1s, which are GA receptors. |
AT3G16160 | TCX8 is a transcriptional regulatory protein. It binds the LOX2 promoter and represses its expression. |
AT4G23050 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
AT5G54770 | Encodes a thiamine biosynthetic gene that has a dual function in thiamine biosynthesis and mitochondrial DNA damage tolerance. It appears to be involved in producing the thiazole portion of thiamine (vitamin B1). A crystal structure of the protein reveals that it forms a 2-ring homo-octamer. The mRNA is cell-to-cell mobile. |
AT5G09860 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. One of the pathways affected by THO1 is the miRNA399-PHO2 pathway that regulates root APase activity. |
AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
AT1G70700 | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile. |
AT1G72860 | NBS TIR LRR protein. It is induced in response to bacterial pathogens and overexpression results in cell death in leaves. |
AT1G12930 | Ran effector. |
AT1G02510 | Encodes AtTPK4, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK4 is targeted to the plasma membrane. In contrast other members of the AtTPK proteins are located in tonoplast. AtTPK4 forms a voltage-independent K+ channel that is blocked by extracellular calcium ions. May form homomeric ion channels in vivo. |
AT1G80500 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
AT1G78010 | tRNA modification GTPase;(source:Araport11) |
AT1G14205 | Member of the uL18 RNA-binding protein family. uL18 proteins share a short structurally conserved domain that binds the 5S rRNA and allow its incorporation into ribosomes. Essential for the splicing of the first intron of rps12 in plastid. |
AT5G61455 | U2-7;(source:Araport11) |
AT2G41160 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with a role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
AT5G66690 | UGT72E2 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl aldehydes as well as sinapyl- and coniferyl alcohol. The enzyme is thought to be involved in lignin metabolism. A knockdown mutant line (72E2KD) was obtained using RNAi silencing. A twofold reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype. In comparison, both knockout and knockdown lines of UGT72E1 and UGT72E3, respectively, failed to display the same reduction in phenylpropanoid 4-O-glucosides. The mRNA is cell-to-cell mobile. |
AT4G15490 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
AT1G22400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G06000 | encodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols |
AT3G22450 | Member of the uL18 RNA-binding protein family. uL18 proteins share a short structurally conserved domain that binds the 5S rRNA and allow its incorporation into ribosomes. Required for the splicing of two mitochondrial introns. |
AT1G61180 | Coiled-coil nucleotide-binding leucine-rich-repeat protein involved in disease resistance. |
AT2G39260 | Nonsense mediated decay (NMD)factor. |
AT1G33980 | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). Regulates AT1G72910, AT1G72940, and ADR1-LIKE 2 in a temperature dependent manner. |
AT3G61800 | ENTH/VHS protein;(source:Araport11) |
AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
AT2G16510 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
AT4G02620 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
AT1G16780 | Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves. |
AT5G22950 | SNF7 family protein;(source:Araport11) |
AT3G10640 | SNF7 family protein;(source:Araport11) |
AT3G19770 | Guanine nucleotide exchange factor VPS9a. Can activate all Rab5 members to GTP-bound forms in vitro. Required for embryogenesis. Regulates the localization of ARA7 and ARA6. Involved in postembryonic root development. |
AT2G22880 | VQ motif-containing protein;(source:Araport11) |
AT3G02870 | Encodes a L-galactose-1-phosphate phosphatase, involved in ascorbate biosynthesis. |
AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT1G49160 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its |
AT4G01250 | AtWRKY22 is a member of WRKY Transcription Factor; Group II-e. It is involved in regulation of dark induced leaf senescence. |
AT4G23550 | Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile. |
AT4G01720 | member of WRKY Transcription Factor; Group II-b |
AT2G04240 | Encodes a small protein with an N-terminal trans-membrane domain and a RING-H2 zinc finger motif located at the C-terminus. Gene expression is induced by salt and osmotic stress. Transcrips levels are induced by DELLA proteins and repressed by gibberellic acid. Involved in ABA metabolism. |
AT1G58440 | Encodes a putative protein that has been speculated, based on sequence similarities, to have squalene monooxygenase activity. |
AT3G58160 | Class XI myosin gene expressed in flowers from 4-6 week old plants and leaves from 3 week old plants |
AT5G20490 | Encodes a member of the type XI myosin protein family involved in root hair growth, trichome development, and organelle trafficking. Required for fast root hair growth. This gene appears to be expressed at low levels throughout the plant. |
AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter;(source:Araport11) |
AT1G51510 | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm. |
AT5G58060 | Constitutively expressed SNARE protein of the YKT6 family. |
AT5G21920 | One of four Arabidopsis homologs of bacterial ymlg proteins. |
AT3G46090 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT1G59590 | ZCF37 mRNA, complete cds The mRNA is cell-to-cell mobile. |
AT1G59560 | Encodes a chloroplast-localized putative RING-type ubiquitin E3 ligase. |
AT3G57700 | Protein kinase superfamily protein;(source:Araport11) |
AT3G57640 | Protein kinase superfamily protein;(source:Araport11) |
AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
AT1G22275 | One of two nearly identical proteins (ZYP1a) identified by similarity to transverse filament (TF) proteins. These proteins are involved in chromosome synapsis during meiosis I and localize to the synaptonemal complex (SC). Single mutants have reduced fertility and double mutants (induced by RNAi) have severely reduced fertility. |
AT4G03205 | Coproporphyrinogen III oxidase;(source:Araport11) |
AT5G14220 | Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development. |
AT2G20960 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT3G48050 | Encodes a large protein with N-terminal bromo-adjacent homology (BAH) and transcription elongation factor S-II (TFS2N) domains and two C-terminal GW (glycine and tryptophan) repeats. It is nuclear and colocalizes with the processing-body component DCP1 in the cytoplasm. SOU is a component of the miRNA pathway and is involved in translational repression. |
AT3G47020 | E3 ubiquitin ligase involved in SGS3 degradation leading to inhibited biosynthesis of tasiRNA. The heat-induced activation of SGIP1 is inherited in the progeny. |
AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
AT4G11280 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family The mRNA is cell-to-cell mobile. |
AT5G11380 | Encodes a protein postulated to have 1-deoxy-D-xylulose 5-phosphate synthase activity. |
AT2G31360 | Encodes a protein homologous to delta 9 acyl-lipid desaturases of cyanobacteria and acyl-CoA desaturases of yeast and mammals. expression up-regulated by cold temperature. It is involved in the synthesis of the 24:1n-9 and 26:1n-9 components of seed lipids, sphingolipids and the membrane phospholipids phosphatidylserine (PS), and phosphatidylethanolamine (PE). |
AT3G08590 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
AT3G19010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT5G47760 | serine/threonine protein kinase |
AT3G51260 | 20S proteosomal alpha subunits. Interacts with SnRK, SKP1/ASK1 during proteasomal binding of an SCF ubiquitin ligase. |
AT1G53850 | Encodes alpha5 subunit of 20s proteosome involved in protein degradation and RNA degradation. |
AT3G14290 | Encodes 20S proteasome subunit PAE2 (PAE2) that has RNase activity. |
AT2G27020 | Encodes 20S proteasome alpha 7 subunit PAG1. |
AT2G20580 | encoding the RPN subunits of the 26S proteasome The mRNA is cell-to-cell mobile. |
AT4G28470 | encoding the RPN subunits of the 26S proteasome |
AT4G33510 | Enzyme catalyzing the first committed step in aromatic amino acid biosynthesis The mRNA is cell-to-cell mobile. |
AT4G39980 | Encodes a 2-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase, which catalyzes the first committed step in aromatic amino acid biosynthesis. Gene expression is induced by wounding and pathogenic bacteria Pseudomonas syringae. The mRNA is cell-to-cell mobile. |
AT2G26800 | Mutant has increased seed ile, leu and val as well as his and arg. |
AT4G34510 | Encodes KCS17, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT5G43760 | Encodes KCS20, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). The mRNA is cell-to-cell mobile. |
AT1G19440 | Encodes KCS4, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G68530 | Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT2G16280 | Encodes KCS9, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT4G34030 | MCC-B is involved in leucine degradation in mitochondria. The active protein is a dimer of MCC-A and MCC-B. MCC-A is biotinylated whereas MCC-B is not. The mRNA is cell-to-cell mobile. |
AT5G57850 | ADCL encodes a protein that acts as a 4-amino-4-deoxychorismate lyase. It catalyzes the production 4-aminobenzoate (pABA) production which is required for folate biosynthesis. The enzyme localizes to chloroplasts based on an import assay and GFP localization experiments. Involved in D-Amino Acid Stimulated Ethylene Production. |
AT1G51680 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. In addition to 4-coumarate, it also converts ferulate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, ferulic acid, caffeic acid and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as substrate. |
AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
AT5G60600 | Encodes a chloroplast-localized hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate (HMBPP) synthase (HDS), catalyzes the formation of HMBPP from 2-C-methyl-D-erythrytol 2,4-cyclodiphosphate (MEcPP). The HDS enzyme controls the penultimate steps of the biosynthesis of IPP and dimethylallyl diphosphate (DMAPP) via the MEP pathway and may serve as a metabolic control point for SA-mediated disease resistance. In the light, the electrons required for the reaction catalyzed by HDS are directly provided by the electron flow from photosynthesis via ferredoxin. In the dark however, the enzyme requires an electron shuttle: ferredoxin-NADP+ reductase. The mRNA is cell-to-cell mobile. |
AT1G75660 | Encodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN3 acts as a suppressor of posttranscriptional gene silencing. Mutants accumulate excised miRNA products suggesting that XRN3 is involved in degradation of these products. |
AT5G08530 | 51 kDa subunit of complex I;(source:Araport11) |
AT5G41670 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
AT1G13700 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
AT3G49360 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
AT1G01100 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
AT5G47700 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
AT5G48390 | Defective in meiotic chromosome segregation. It is involved in crossover formation and involved in both male and female meiosis. |
AT3G02860 | Encodes a C2H2 zinc finger protein that is localized to the nucleus and is translocated to the cytoplasm in response to ABA or oxidative stress. It functions as a positive regulator countering ABA to break seed dormancy and maintain ROS homeostasis in response to ABA and oxidative stress. |
AT5G67030 | Encodes a single copy zeaxanthin epoxidase gene that functions in first step of the biosynthesis of the abiotic stress hormone abscisic acid (ABA). Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
AT1G52340 | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
AT1G16540 | Encodes molybdenum cofactor sulfurase. Involved in Moco biosynthesis. Involved in the conversion of ABA-aldehyde to ABA, the last step of abscisic acid (ABA) biosynthesis. sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.N terminal domain is similar to bacterial NifS suggesting a common mechanism for sulphur mobilization and transfer. Also involved in protein import into chloroplasts. |
AT3G24650 | Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230). |
AT4G23450 | AtAIRP1 gene encodes a C3H2C3-type RING E3 Ub ligase. It has been shown to be a positive regulator in the Arabidopsis ABA-dependent drought response. |
AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
AT5G04895 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT1G66600 | A member of WRKY Transcription Factor; Group III. Involved in the regulation of plant responses to ABA and drought stress. |
AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile. |
AT4G11890 | Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction. |
AT5G51760 | Encodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination. |
AT5G50360 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G46510 | Encodes a nuclear localized BLH domain containing transcriptional activator involved in response to ABA. Overexpression confers enhanced ABA responsiveness while loss of function mutants are ABA sensitive.bHLH17 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH14 to negatively regulate jasmonate responses. |
AT3G54770 | Encodes a putative RNA binding protein that is localized in the nucleus and affects ABA-regulated seed germination of Arabidopsis. |
AT5G66070 | E3 ubiquitin ligase that functions in negative regulation of ABA signaling. |
AT1G05805 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G01660 | Encodes an ABC1-like protein, member of the ATH subfamily; putative ABC transporter; isolated by functional complementation of a yeast abc1 mutant The mRNA is cell-to-cell mobile. |
AT1G79600 | Encodes a chloroplast ABC1-like kinase that regulates vitamin E metabolism. |
AT2G40090 | member of ATH subfamily |
AT1G60600 | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport. |
AT3G23560 | Member of the multidrug and toxic compound extrusion (MATE) family, protects roots from inhibitory compounds. |
AT3G10572 | APEM9 is required for both PTS1- and PTS2-dependent protein transport. APEM9 interacts with PEX6 in BiFC assay and mating-based Split ubiquitin system. BiFC data shows that APEM9 is required for peroxisomal localization of PEX1-PEX6 complex. These results indicate that APEM9 functions like mammalian PEX26 and yeast PEX15. |
AT1G13740 | Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. |
AT2G46225 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. One of four ABI-like proteins. |
AT5G42030 | ABL interactor-like protein 4;(source:Araport11) |
AT2G45190 | Encodes a member of the YABBY family of transcriptional regulators that is involved in abaxial cell type specification in leaves and fruits. YAB1 acts in a non-cell autonomous fashion within the meristem to affect phyllotactic patterning. The non-autonomous effect on the central region of the meristem is mediated through the activity if Lateral Suppressor (LAS). |
AT4G29010 | Functions in beta-oxidation of fatty acids, similar to CuMFP with L-3-hydroxyacyl-CoA hydrolyase , L-3-hydroxyacyl-dehydrogenase, D-3-hydroxyacyl-CoA epimerase, and 3, 2-enoyl-CoA isomerase activities. |
AT2G36080 | Encodes a plant-specific B3 DNA-binding domain transcription factor. Has transcription repressor activity. |
AT4G34000 | Encodes an ABA-responsive element-binding protein with similarity to transcription factors that is expressed in response to stress and abscisic acid. |
AT2G27150 | Encodes the aldehyde oxidase delta isoform catalyzing the final step in abscisic acid biosynthesis. |
AT1G62380 | Encodes a protein similar to 1-aminocyclopropane-1-carboxylic oxidase (ACC oxidase). Expression of the AtACO2 transcripts is affected by ethylene. |
AT1G62960 | Encodes an aminotransferase with broad specificity for aspartate and aromatic amino aids such as tyrosine and phenylalanine. It does not act on branched chain amino acids and does not have ACC synthase activity. |
AT3G44880 | Encodes a pheide a oxygenase (PAO). Accelerated cell death (acd1) mutants show rapid, spreading necrotic responses to both virulent and avirulent Pseudomonas syringae pv. maculicola or pv. tomato pathogens and to ethylene. |
AT4G37000 | Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. |
AT1G64810 | Encodes a chloroplast localized RNA binding protein that is involved in group II intron splicing. Splicing defects can account for the loss of photosynthetic complexes in apo1 mutants. |
AT4G25650 | Similar to ACD1. Leaves of antisense ACD1-like plants turn yellow in darkness like wild-type whereas antisense ACD1 plants remain dark after five days of dark treatment. |
AT2G31810 | ACT domain-containing small subunit of acetolactate synthase protein;(source:Araport11) |
AT2G23600 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES2 appears to be involved in MeSA hydrolysis in planta. This protein does not act on MeGA4, or MEGA9 in vitro and has been show to be capable of hydrolyzing methyl ester nicotinate back to nicotinate. |
AT2G38040 | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis |
AT4G26970 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. The mRNA is cell-to-cell mobile. |
AT1G76990 | ACT domain repeat 3;(source:Araport11) |
AT2G03730 | Member of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. |
AT3G01990 | Member of a small family of ACT domain containing proteins in Arabidopsis. ACT domains are involved in amino acid binding. |
AT4G22780 | Member of a family of ACT domain containing proteins . ACT domains are involved in amino acid binding . |
AT1G12420 | ACT domain repeat 8;(source:Araport11) |
AT1G16880 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. The mRNA is cell-to-cell mobile. |
AT5G04740 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
AT3G18780 | Encodes an actin that is constitutively expressed in vegetative structures but not pollen. ACT2 is involved in tip growth of root hairs. |
AT5G09810 | Member of Actin gene family.Mutants are defective in germination and root growth. The mRNA is cell-to-cell mobile. |
AT1G49240 | Member of a subclass of actins composed of ACT2 and ACT8. Its mRNA is strongly expressed in strongly expressed in leaves, roots, stems, flowers, pollen, and siliques. However, protein expression, assayed by a ACT8:GUS fusion reporter, is very low in pollen. |
AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
AT4G34970 | A member of actin polymerizing factors (ADFs)family, ADF9 primarily functions as an actin bundling protein. |
AT3G12110 | Encodes an actin that is expressed predominantly during reproductive development. |
AT1G18450 | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. Phenotype of the arp4-1 mutant allele revealed partial sterility due to defects in anther development. Targeting the distinct, 3' UTR of AtARP4 transcripts with RNA interference caused a drastic reduction in the level of AtARP4 protein expression, and resulted in strong pleiotropic phenotypes such as altered organization of plant organs, early flowering, delayed flower senescence and high levels of sterility. Western blot analysis and immunolabelling demonstrated a clear correlation between reductions in the level of AtARP4 expression and severity of the phenotypes. |
AT3G12380 | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP gene family. |
AT5G56180 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. Member of nuclear ARP family of genes. |
AT2G33385 | actin-related protein C2B;(source:Araport11) |
AT1G73910 | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. |
AT1G33560 | Encodes a NBS-LRR disease resistance protein that possesses N-terminal kinase subdomains. Activation tagged mutant of ADR1 showed elevated levels of SA and reactive oxygen species in addition to number of defense gene transcripts. Exhibits resistance to number of microbial pathogens. |
AT1G11390 | Atypical kinase which functions in plant salt stress tolerance by regulating reactive oxygen species (ROS). |
AT3G16170 | Encodes a malonyl-CoA synthetase that is localized to the cytosol and mitochondrion. AAE13 produces two transcripts one of which includes an N terminal mitochondrial targeting motif. Loss of function of the mtAAE13 product results in growth arrest and lethality. |
AT5G16370 | acyl activating enzyme 5;(source:Araport11) |
AT1G66120 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT5G23050 | acyl-activating enzyme 17;(source:Araport11) |
AT3G48990 | Encodes an oxalyl-CoA synthetase and is required for oxalate degradation, for normal seed development, and for defense against an oxalate-producing fungal pathogen. |
AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
AT5G16240 | Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
AT5G16230 | Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm. |
AT4G27780 | Encodes acyl-CoA-binding protein with ankyrin repeats The mRNA is cell-to-cell mobile. |
AT3G05420 | Acyl-CoA binding protein with high affinity for oleoyl-CoA. Expressed in all plant organs. Involved in fatty acid transport. Plays a role in determining seed oil content. |
AT4G16760 | Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate. |
AT5G65110 | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
AT3G51840 | Encodes a short-chain acyl-CoA oxidase, which catalyzes the first step of peroxisomal fatty acid beta-oxidation during early, post-germinative growth in oilseed species. Null mutants virtually lack short-chain acyl-CoA and are resistant to 2,4-dichlorophenoxybutyric acid, which is converted to the herbicide and auxin analogue 2,4-dichlorophenoxyacetic acid by beta-oxidation. Despite the almost complete loss of short-chain activity, lipid catabolism and seedling growth and establishment was unaltered in the acx4 mutant. However, double mutants in acx3acx4 (acx3 encodes medium chain acyl CoA oxidase) were not viable and arrested during embryogenesis. |
AT2G35690 | Encodes an acyl-CoA oxidase. Involved in jasmonate biosynthesis. Expressed uniformly in seedlings and throughout development. |
AT3G51970 | acyl-CoA sterol acyl transferase 1;(source:Araport11) |
AT4G24230 | acyl-CoA-binding protein ACBP3. Localized extracellularly in transiently expressed tobacco BY-2 cells and onion epidermal cells. Binds arachidonyl-CoA with high affinity. Microarray data shows up-regulation of many biotic- and abiotic-stress-related genes in an ACBP3 OE-1 in comparison to wild type. |
AT1G31812 | Acyl-CoA-binding protein. Bind acyl-CoA esters and protect acyl-CoAs from degradation by microsomal acyl-hydrolases. Plays a role in determining seed oil content. |
AT1G31730 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
AT5G11490 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
AT4G01100 | Adenine nucleotide transporter. Located in mitochondrion. Expressed in a broad range of tissues, but predominantly in root tips. Loss of function mutants exhibit reduced root growth and respiration. |
AT5G66360 | Encodes a mitochondrial rRNA dimethylase. |
AT5G03300 | Encodes adenosine kinase 2 (ADK2), a typical, constitutively expressed housekeeping enzyme. Shows a high sequence identity with ADK1. Involved in salvage synthesis of adenylates and methyl recycling. Enzyme activity is substantially inhibited in roots, siliques and dry seeds by an unknown compound. May contribute to cytokinin interconversion. The mRNA is cell-to-cell mobile. |
AT3G03900 | Provides activated sulfate for the sulfation of secondary metabolites, including the glucosinolates. Redundant with APK4. |
AT5G67520 | Provides activated sulfate for the sulfation of secondary metabolites, including the glucosinolates. Redundant with APK3. |
AT5G63400 | encodes a protein similar to adenylate kinase. |
AT5G19220 | Encodes the large subunit of ADP-glucose pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL1 is the major large subunit isoform present in leaves. Mutational analysis of APS1 suggests that APL1 and APL2 can compensate for loss of APS1 catalytic activity,suggesting both have catalytic as well as regulatory functions. |
AT1G23490 | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
AT3G62290 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. The mRNA is cell-to-cell mobile. |
AT3G49870 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
AT5G67560 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Possible pseudogene because it lacks an N-terminal part that is conserved among the other ARL8 proteins. The mRNA is cell-to-cell mobile. |
AT5G13490 | Encodes mitochondrial ADP/ATP carrier |
AT4G28390 | Encodes a mitochondrial ADP/ATP carrier protein. Shown in heterologous systems to be located in the plasma membrane. Has comparable affinity for ADP and ATP (in E.coli). |
AT4G33300 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. |
AT5G04720 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. The mRNA is cell-to-cell mobile. |
AT1G22130 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL104 is expressed in pollen.It forms heterodimers with other MICK family members (AGL65 and AGL30). Involved in late stages of pollen development and pollen tube growth. |
AT4G11880 | AGL12, AGL14, and AGL17 are all preferentially expressed in root tissues and therefore represent the only characterized MADS box genes expressed in roots. The mRNA is cell-to-cell mobile. |
AT3G57230 | MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes. AGL16 can directly interact with SVP and indirectly interact with FLC. Furthermore, the accumulation of AGL16 transcripts is modulated by miR824 (AT4G24415). The flowering time effect for the miR824/AGL16 module is more obvious in the Col-FRI background than in the Col-0 background. AGL16 controls flowering via a allelic dosage effect in long-day non-vernalized conditions. |
AT2G45660 | Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA. |
AT4G37940 | encodes a MADS box protein, highly expressed in the root. |
AT2G14210 | MADS box gene, transcription factor |
AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
AT5G41200 | AGAMOUS-like 75;(source:Araport11) |
AT5G49490 | AGAMOUS-like 83;(source:Araport11) |
AT5G26950 | AGAMOUS-like 93;(source:Araport11) |
AT1G69540 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. |
AT3G12690 | Encodes a putative serine/threonine kinase It is expressed specifically in pollen and appears to function redundantly with AGC1.7 to regulate polarized growth of pollen tubes. |
AT2G36350 | Member of AGC VIIIa Kinase gene family. |
AT3G44610 | Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation. |
AT5G03640 | AGCVIII kinase involved in the pulse-induced first positive phototropism. |
AT5G65510 | Encodes one of three PLETHORA transcription factors required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. |
AT3G12740 | Physically interacts with ALA3, and is required for the phospholipid translocase activity of ALA3. The mRNA is cell-to-cell mobile. |
AT1G79450 | ALA-interacting subunit 5;(source:Araport11) |
AT1G17290 | Encodes for alanine aminotransferase (ALAAT1), involved in alanine catabolism during plants recovery from hypoxia The mRNA is cell-to-cell mobile. |
AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
AT4G39660 | alanine:glyoxylate aminotransferase 2 homolog (AGT2). The mRNA is cell-to-cell mobile. |
AT2G38400 | alanine:glyoxylate aminotransferase 2 homolog (AGT3) mRNA, |
AT2G36230 | Encodes a BBMII isomerase involved in histidine biosynthesis. |
AT4G01800 | Encodes the ATPase subunit of the chloroplast Sec translocation machinery which plays an essential role in chloroplast biogenesis and the regulation of photosynthesis, the absence of which triggers a retrograde signal, eventually leading to a reprogramming of chloroplast and mitochondrial gene expression. |
AT5G01370 | Nuclear protein with a lysine-rich domain and a C-terminal serine-rich domain. Interacts with Alcatraz (ALC). ACI1 is mainly expressed in the vascular system. Involved in cell separation during fruit dehiscence. |
AT5G67110 | encodes a myc/bHLH transcription factor-like protein. Gene product is involved in fruit dehiscence. Mutant siliques fail to dehisce. |
AT2G14170 | Arabidopsis thaliana methylmalonate-semialdehyde dehydrogenase |
AT5G62530 | Encodes mitochondrial Delta-pyrroline-5- carboxylate dehydrogenase. Involved in the catabolism of proline to glutamate. Involved in protection from proline toxicity. Induced at pathogen infection sites. P5CDH and SRO5 (an overlapping gene in the sense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
AT4G36250 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
AT4G34240 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. ALDH3I1 was able to use both NAD+ and NADP+ as cofactors. |
AT1G79440 | Encodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004). |
AT1G54100 | Aldehyde dehydrogenase |
AT3G43600 | Encodes an aldehyde oxidase. AAO2 does not appear to act on abscisic aldehyde in vitro but it is possible that it may function in abscisic acid biosynthesis when the activity of At2g27150 (AAO3), the primary abscisic aldehyde oxidase, is lost. |
AT2G37760 | Encodes an NADPH-dependent aldo-keto reductase that can act on a wide variety of substrates in vitro including aliphatic and aromatic aldehydes and steroids. Transcript levels for this gene are up-regulated in response to cold, salt, and drought stress. |
AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
AT3G11200 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
AT5G26210 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
AT4G34860 | Plant neutral invertase family protein;(source:Araport11) |
AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
AT5G16970 | encodes a 2-alkenal reductase (EC 1.3.1.74), plays a key role in the detoxification of reactive carbonyls |
AT4G20070 | The gene encoding Arabidopsis thaliana Allantoate Amidohydrolase (AtAAH)which catalyzes the allantoate deiminase reaction (EC 3.5.3.9)is expressed in all parts of the plant being consistent with a function in purine turnover in Arabidopsis. The mRNA is cell-to-cell mobile. |
AT4G04955 | Encodes an allantoinase which is involved in allantoin degradation and assimilation. Gene expression was induced when allantoin was added to the medium. The insertion mutant, ataln m2-1, did not grow well on the MS medium where allantoin, instead of ammonium nitrate, was supplied. |
AT5G42650 | Encodes a member of the cytochrome p450 CYP74 gene family that functions as an allene oxide synthase. This enzyme catalyzes dehydration of the hydroperoxide to an unstable allene oxide in the JA biosynthetic pathway. It shows a dual catalytic activity, the major one being a 13-AOS but also expressing a 9-AOS activity. CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can induce the expression of AOS. |
AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
AT5G22770 | AP-2 complex subunit alpha-1. Part of endomembrane trafficking system. |
AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
AT5G08380 | alpha-galactosidase 1;(source:Araport11) |
AT3G56310 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
AT5G11720 | Glycosyl hydrolases family 31 protein;(source:Araport11) |
AT3G10740 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 51 of glycoside hydrolases. It may be involved in cell wall modification. |
AT1G18460 | Alpha/beta hydrolase |
AT2G24100 | ATP-dependent DNA helicase;(source:Araport11) |
AT2G44980 | SNF2 domain-containing protein / helicase domain-containing protein;(source:Araport11) |
AT1G20650 | Protein kinase superfamily protein;(source:Araport11) |
AT3G03210 | Pmr5/Cas1p GDSL/SGNH-like acyl-esterase family protein;(source:Araport11) |
AT2G29990 | alternative NAD(P)H dehydrogenase 2;(source:Araport11) |
AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile. |
AT5G64210 | encodes an isoform of alternative oxidase, which is expressed in rosettes, stems, and roots. Transcript accumulates in dry seeds and decreased upon germination and is not affected by actinomycin A. Protein is localized to mitochondria. |
AT1G18420 | Involved in malate efflux response to P-deficiency in root hairs. |
AT3G21430 | DNA binding protein;(source:Araport11) |
AT4G14940 | atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. |
AT1G58360 | Encodes AAP1 (amino acid permease 1), a neutral amino acid transporter expressed in seeds. Functions in amino acid uptake into embryos. The transporter also functions in acquisition of glutamate and neutral amino acids by the root. |
AT1G44100 | amino acid permease 5 |
AT4G21120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. The mRNA is cell-to-cell mobile. |
AT3G25585 | aminoalcoholphosphotransferase (AAPT2) |
AT4G33090 | encodes an aminopeptidase, a ortholog of mouse microsomal AP (EC 3.4.11.2). |
AT4G36760 | Arabidopsis aminopeptidase P1 The mRNA is cell-to-cell mobile. |
AT5G04930 | Encodes a putative aminophospholipid translocase (p-type ATPase) involved in chilling response. It is targeted to the plasma membrane following association in the endoplasmic reticulum with an ALIS protein beta-subunit. The mRNA is cell-to-cell mobile. |
AT5G44240 | Expression is upregulated in the shoot of cax1/cax3 mutant. The mRNA is cell-to-cell mobile. |
AT1G72700 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT4G13510 | Encodes a plasma membrane localized ammonium transporter. Contains a cytosolic trans-activation domain essential for ammonium uptake. The mRNA is cell-to-cell mobile. |
AT4G21530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G39090 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
AT3G05870 | Subunit of the anaphase promoting complex, a ubiquitin ligase complex that regulates progression through the cell cycle. |
AT1G01510 | Encodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. It has been shown to localize to cytosolic stress granules and is involved in their formation. |
AT5G28640 | Encodes a protein with similarity to mammalian transcriptional coactivator that is involved in cell proliferation during leaf and flower development. Loss of function mutations have narrow, pointed leaves and narrow floral organs. AN3 interacts with members of the growth regulating factor (GRF) family of transcription factors. |
AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
AT3G63270 | A mutation in ANTAGONIST OF LHP1 1 (ALP1) suppresses the phenotype of lhp1 mutant plants. ALP1 interacts genetically with several PcG and trxG components and antagonizes PcG silencing. The interaction has a negative effect on polycomb-mediated gene repression since double mutant combinations of clf alp1 or lhp1 alp1 show supression of the clf and lhp1 single mutant phenotypes. ALP1 domestication probably occured at the root of angiosperm diversification coincident with mutation of conserved residues important for endonuclease activity. |
AT4G28395 | related to lipid transfer proteins |
AT4G13540 | ADR is a peroxisome localized, myristoylated protein. It is expressed in flowers and plays a role in suppressing ROS accumulation in anthers. Overexpression results in reduced ROS, lower levels of NST1 and NST2 and, consequently alterations in lignification of the anther endothecium resulting in male sterility. |
AT5G61160 | anthocyanin 5-aromatic acyltransferase 1;(source:Araport11) |
AT4G00730 | Encodes a homeodomain protein of the HD-GLABRA2 group. Involved in the accumulation of anthocyanin and in root development. Loss of function mutants have increased cell wall polysaccharide content. |
AT1G25220 | Catalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2). |
AT2G21120 | Encodes a putative magnesium transporter that was identified through a forward genetic screen, directly isolating antiviral RNAi-defective (avi) mutant using a Cucumber Mosaic Virus (CMV) mutant. Compared to Wildtype Col-0, avi2 mutant showed severe disease symptom after viral infection and viral accumulation was significantly increased while viral siRNAs and virus-activated endogenous siRNAs (vasiRNAs) were reduced in avi2 mutant. Detailed genetic study indicated that AVI2 modulated RNAi-mediated antiviral immunity by regulating the biogenesis of secondary viral siRNAs and vasiRNAs in Arabidopsis. |
AT4G38730 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT4G36920 | Encodes a floral homeotic gene, a member of the AP2/EREBP (ethylene responsive element binding protein) class of transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem indeterminancy, and development of the ovule and seed coat. AP2 also has a role in controlling seed mass. Dominant negative allele I28, revealed a function in meristem maintenance-mutant meristems are smaller than normal siblings. AP2 appears to act on the WUS-CLV pathway in an AG independent manner. |
AT1G69120 | Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies floral meristem and sepal identity. Required for the transcriptional activation of AGAMOUS. Interacts with LEAFY.Binds to promoter and regulates the expression of flowering time genes SVP, SOC1 and AGL24. |
AT3G48425 | DNAse I-like superfamily protein;(source:Araport11) |
AT5G10760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G78860 | curculin-like (mannose-binding) lectin family protein, low similarity to Ser/Thr protein kinase (Zea mays) GI:2598067; contains Pfam profile PF01453: Lectin (probable mannose binding) but not the protein kinase domain of the Z. mays protein |
AT3G03860 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile. |
AT4G08930 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile. |
AT2G14750 | Encodes adenosine-5'-phosphosulfate kinase. Provides activated sulfate for sulfation of secondary metabolites, including the glucosinolates. Essential for pollen viability. The mRNA is cell-to-cell mobile. |
AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
AT4G36050 | Encodes a base excision repair protein with 3'-phosphatase activity and strong 3'-5' exonuclease activity. Together with ZDP, it plays overlapping roles in the maintenance of epigenome and genome stability in plants. |
AT3G04080 | Encodes an Golgi-localized integral membrane enzyme with nucleoside diphosphate activity that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.With respect to substrate specificity, APY1 shows the following preferences UTP>IDP>GDP. |
AT2G02970 | Encodes a putative apyrase involved in pollen exine pattern formation and anther dehiscence. |
AT5G20635 | Encodes an atypical heterotrimeric G-protein gamma-subunit involved in guard cell K+-channel regulation and morphological development. |
AT1G78790 | Encodes a protein with high similarity to mammalian MHF2 that acts in the same pathway as FANCM to restrain class II meiotic crossing over. |
AT3G01310 | Encodes a functional VIP1/PPIP5K-type ATP-grasp kinase that is involved in both InsP6 to InsP7 conversion and InsP7 to InsP8 conversion, producing the InsP8 cofactor of the ASK1-COI1-JAZ-jasmonate co-receptor complex. It is the major isoform in plants, is required for jasmonate-dependent defenses, and plays an important role in plant defenses against necrotrophic fungi and insect herbivores. |
AT3G54020 | Inositol phosphorylceramide synthase |
AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
AT1G77360 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G33920 | Protein phosphatase 2C family protein;(source:Araport11) |
AT4G38520 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G02760 | Encodes a phosphatase that functions in sustaining proper leaf longevity and preventing early senescence by suppressing or perturbing SARK-mediated senescence signal transduction. |
AT5G06750 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G65530 | Encodes a protein kinase involved in mediating resistance to fungi and also trichome branch number. Kinase activity is increased by ROP6 which also affects its sub-cellular localization (becomes localized to the cell periphery_ |
AT2G28130 | NSE5 subunit of the SMC5/6 complex. |
AT1G09730 | Encodes a SUMO protease that positively regulates the transition to flowering in long and short days. Along with SPF2, its activity is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
AT1G49220 | RING/U-box superfamily protein;(source:Araport11) |
AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
AT4G30400 | RING/U-box superfamily protein;(source:Araport11) |
AT4G15975 | RING/U-box superfamily protein;(source:Araport11) |
AT4G17245 | RING/U-box superfamily protein;(source:Araport11) |
AT4G35840 | RING/U-box superfamily protein;(source:Araport11) |
AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
AT2G37580 | RING/U-box superfamily protein;(source:Araport11) |
AT2G34990 | RING/U-box superfamily protein;(source:Araport11) |
AT4G09100 | RING/U-box superfamily protein;(source:Araport11) |
AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
AT2G42360 | RING/U-box superfamily protein;(source:Araport11) |
AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
AT5G40250 | RING/U-box superfamily protein;(source:Araport11) |
AT5G57750 | RING/U-box superfamily protein;(source:Araport11) |
AT2G18670 | RING/U-box superfamily protein;(source:Araport11) |
AT1G33480 | RING/U-box superfamily protein;(source:Araport11) |
AT3G18930 | RING/U-box superfamily protein;(source:Araport11) |
AT2G46160 | RING/U-box superfamily protein;(source:Araport11) |
AT3G61550 | RING/U-box superfamily protein;(source:Araport11) |
AT2G35910 | RING/U-box superfamily protein;(source:Araport11) |
AT1G49200 | RING/U-box superfamily protein;(source:Araport11) |
AT1G49210 | RING/U-box superfamily protein;(source:Araport11) |
AT3G18773 | RING/U-box superfamily protein;(source:Araport11) |
AT5G47610 | RING/U-box superfamily protein;(source:Araport11) |
AT4G33565 | RING/U-box superfamily protein;(source:Araport11) |
AT3G60966 | RING/U-box superfamily protein;(source:Araport11) |
AT3G20395 | RING/U-box superfamily protein;(source:Araport11) |
AT5G53110 | RING/U-box superfamily protein;(source:Araport11) |
AT1G21630 | TPLATE Adaptor complex subunit. |
AT1G17860 | Member of Kunitz trypsin inhibitor (KTI) family involved in plant defense response against spider mites. |
AT5G61670 | Encodes a close homolog of the Cauliflower OR (Orange) protein that is located in the chloroplast of light grown organs but in the nucleus of etiolated cotyledons. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich zinc finger domain that is highly specific to DnaJ-like molecular chaperons. The AtOR protein interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis. |
AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
AT3G05200 | Encodes a putative RING-H2 zinc finger protein ATL6 (ATL6). The mRNA is cell-to-cell mobile. |
AT2G35000 | ATL9 is an E3 ligase-like protein that is induced by chitin oligomers and contributes to fungal resistance.It differs from other members of the ATL family in that it has a PEST domain. It is a short lived protein that is subject to proteosome mediated degradation. It is expressed in many aerial tissues in a pattern that varies with developmental stage. |
AT5G44930 | Encodes a putative arabinosyltransferase that is associated with arabinan biosynthesis and is not redundant with ARAD1. The two glycosyltransferases may function in complexes held together by disulfide bridges. |
AT5G64310 | Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile. |
AT3G01700 | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP11 function results in decreased fertility due to defects in pollen tube growth. |
AT3G13520 | Encodes a GPI-anchored arabinogalactan (AG) peptide with a short 'classical' backbone of 10 amino acids, seven of which are conserved among the 4 other Arabidopsis AG peptides. These peptides may be involved in cell signaling. |
AT5G11740 | Encodes arabinogalactan protein (AGP15). The mRNA is cell-to-cell mobile. |
AT2G46330 | Encodes arabinogalactan protein (AGP16). |
AT2G23130 | AGP17 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP18 and AGP19, other lysine-rich AGPs. 84% of its proline residues are hydroxylated to hydroproline and its heavy glycosylation accounts for appr. 69% of the molecular weight. The main glycosyl residues are arabinose (30.1%) and galactose (55.1%). Glycosyl linkages are consistent with type II arabinogalactans. AGP17 is predicted to have a glycosylphosphatidylinositol (GPI)anchor and is localized to the plasma membrane and Hechtian strands. It is expressed in young/old leaves, shoots, suspension cultures and flowers. |
AT2G22470 | Encodes arabinogalactan-protein (AGP2). |
AT3G61640 | arabinogalactan protein 20;(source:Araport11) |
AT3G57690 | Encodes a putative arabinogalactan-protein (AGP23). |
AT5G18690 | arabinogalactan protein 25;(source:Araport11) |
AT3G06360 | Encodes an arabinogalactan-protein (AGP27). |
AT5G65390 | arabinogalactan protein 7;(source:Araport11) |
AT2G14890 | putative proline-rich protein (At2g14890) mRNA, complete The mRNA is cell-to-cell mobile. |
AT4G16130 | Arabinokinase. |
AT3G45230 | Encodes the arabinogalactan protein core of plant cell wall proteoglycan that contains arabinogalactan and cell wall matrix glycan pectin and/or xylan domains. |
AT5G54310 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. Regulates membrane trafficking and organ separation. |
AT4G17890 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT2G16500 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements. |
AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
AT3G61860 | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT2G46610 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT4G25500 | Encodes an arginine/serine-rich splicing factor. The transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS40 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis (DOI:10.1093/nar/gkv751). |
AT1G48410 | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
AT1G31290 | ARGONAUTE 3;(source:Araport11) |
AT2G32940 | Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing. |
AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
AT2G44080 | Encodes ARL, a gene similar to ARGOS involved in cell expansion-dependent organ growth. Upregulated by brassinosteroid. Acts downstream of BRI1. The mRNA is cell-to-cell mobile. |
AT1G05880 | Encodes ARI12 (ARIADNE 12). ARI12 belongs to a family of `RING between RING fingers' (RBR) domain proteins with E3 ligase activity. Expression of ARI12 is induced by UV-B exposure. |
AT5G63760 | RING/U-box superfamily protein;(source:Araport11) |
AT1G05890 | RING/U-box superfamily protein;(source:Araport11) |
AT2G31770 | RING/U-box superfamily protein;(source:Araport11) |
AT5G19330 | Encodes an armadillo repeat protein involved in the abscisic acid response. The protein interacts with a transcription factor, ABF2, which controls ABA-dependent gene expression via the G-box-type ABA-responsive elements. |
AT5G13060 | Encodes a novel Armadillo BTB protein that intreacts with the pre-replication complex and several transcription factors. Overexpression results in decreased cell proliferation and loss of function results in increased cell proliferation suggesting a role in negative regulation of cellular proliferation. |
AT1G01950 | Encodes a member of the armadillo/beta-catenin repeat kinesin motor family. Mutants have twisted roots due to abnormal cell file rotation; the phenotype is dependent on microtubules. |
AT1G12430 | Encodes the kinesin-like protein PAK has an Armadillo motif tail and is involved in guard cell development in Arabidopsis (from Genbank record AF159052).However, no defect in stomatal complexes has been observed in loss of function mutations. It accumulates at the preprophase band (PPB) in a cell-cycle and microtubule-dependent manner and is most highly expressed in cells where the placement of the division plane (early embryogenesis, stomatal lineages) is critical. |
AT4G36030 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
AT3G26600 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
AT1G11790 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
AT5G22630 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
AT1G08250 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Although this enzyme has sequence similarity to prephenate dehydratases, it is 98 times more active with arogenate than prephenate in enzymatic assays. |
AT3G11900 | encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. |
AT1G07890 | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. The mRNA is cell-to-cell mobile. |
AT4G32320 | Encodes a cytosolic ascorbate peroxidase APX6. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
AT1G05970 | Anti-silencing factor. Forms a complex with ASI1-EDM2 that is required for expression of some nonintronic HC-TRE genes |
AT3G02890 | PHD protein which cooperates with PAIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT4G11560 | BAH domain protein which cooperates with PHD protein AIPP2 to read H3K27me3 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Responsible for preventing flowering by suppressing the expression of flowering genes. Binding of BDT1 to the H3K27me3 peptide, which is enhanced by PHD proteins, is critical for preventing early flowering. |
AT5G65010 | Encodes asparagine synthetase (ASN2). |
AT2G47760 | Encodes an α-1,3-mannosyltransferase. Plants with mutations in the ALG3 protein have abnormal gylcoslation profiles. They also exhibit abnormal responses to MAMPs possibly because the glycan properties of FL22 are affected. |
AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
AT5G11520 | Encodes the chloroplastic isozyme of aspartate aminotransferase. Involved in aspartate biosynthesis and nitrogen metabolism. mRNA is expressed in senescing leaves. |
AT1G31230 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
AT4G19710 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
AT1G11910 | Encodes an aspartic proteinase that forms a heterodimer and is stable over a broad pH range (ph 3-8). |
AT2G42440 | Lateral organ boundaries (LOB) domain family protein;(source:Araport11) |
AT1G67370 | Meiotic asynaptic mutant 1 (ASY1). ASY1 protein is initially distributed as numerous foci throughout the chromatin. During early G2, the foci are juxtaposed to the nascent chromosome axes to form a continuous axis associated signal. |
AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
AT3G61310 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT3G04590 | AHL proteins contain two conserved structural units, the AT-hook motif and DUF296 domain. |
AT4G22770 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT4G17800 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
AT4G22810 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT3G55560 | AT-hook protein of GA feedback 2;(source:Araport11) |
AT3G04570 | AT-hook motif nuclear-localized protein 19;(source:Araport11) |
AT4G14465 | AT-hook protein. Overexpression results in early flowering in short and long days. |
AT2G45430 | Encodes a nuclear localized AT hook domain containing protein that can bind AT rich DNA in vitro. Overexpression of the gene results in delayed flowering. Is likely to act redundantly with AHL18, AHL27 and AHL29 in the regulation of flowering. It is also involved in both photo- and skotomorphogenesis. |
AT1G20900 | Encodes an AT hook domain containing protein that acts redundantly with SOB3 to modulate hypocotyl growth inhibition in response to light. |
AT2G46040 | Encodes a transcriptional activator that is involved in pollen development. ARID1 is expressed in nuclear bodies of microspore, vegetative and generative cells, and binds to and activates DUO during microgametogenesis. |
AT3G48190 | Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
AT3G06590 | Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress. |
AT3G17100 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT1G09250 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G05800 | AtBS1(activation-tagged BRI1 suppressor 1)-interacting factor 1;(source:Araport11) |
AT2G45980 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1. |
AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
AT1G71960 | Encodes a plasma membrane localized ABC transporter involved in abscisic acid transport and responses. |
AT2G41700 | ATP-binding cassette A1;(source:Araport11) |
AT3G28860 | Encodes a member of the ATP-binding cassette (ABC) transporter family that is involved in auxin transport and is involved in postembryonic organ separation. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl elongation and gravitropic response. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AtPGP1. |
AT3G62150 | Encodes a facultative transporter controlling auxin concentrations in plant cells. |
AT4G28630 | Half-molecule ABC transporter ATM1. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
AT1G70610 | member of TAP subfamily |
AT4G25450 | member of NAP subfamily |
AT2G47000 | Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. |
AT2G39480 | P-glycoprotein 6;(source:Araport11) |
AT3G62700 | member of MRP subfamily |
AT2G34660 | encodes a multidrug resistance-associated protein that is MgATP-energized glutathione S-conjugate pump. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. The mRNA is cell-to-cell mobile. |
AT2G47800 | Encodes a plasma membrane localized ATPase transporter involved in multidrug transport. The expression of this gene is upregulated by herbicide safeners such as benoxacor, fluxofenim and fenclorim. The mRNA is cell-to-cell mobile. |
AT1G04120 | encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C. |
AT3G21250 | member of MRP subfamily |
AT1G54350 | ABC transporter family protein;(source:Araport11) |
AT3G13640 | member of RLI subfamily |
AT4G19210 | member of RLI subfamily The mRNA is cell-to-cell mobile. |
AT4G30300 | member of NAP subfamily |
AT5G60790 | Member of GCN subfamily; essential for translation inhibition under cold stress through interacting with GCN2 to phosphorylate eukaryotic translation initiation factor 2. GCN1 regulated gens are involved in flower development, seed dormancy and seed development, response to osmotic stress, amino acid biosynthesis, photosynthesis, cell wall organization, protein transport and localization, lipid biosynthesis, transcription, macroautophagy, proteolysis and cell death. |
AT5G64840 | ABCF5 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein GCN20. |
AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
AT3G55110 | ABC-2 type transporter family protein;(source:Araport11) |
AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
AT5G60740 | ABC transporter family protein. Localizes to the growing tip of pollen tubes where it appears to be critical for localizing polyamines and reactive oxygen species. |
AT3G16340 | Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis. |
AT4G15230 | pleiotropic drug resistance 2;(source:Araport11) |
AT1G15210 | pleiotropic drug resistance 7;(source:Araport11) |
AT4G15215 | pleiotropic drug resistance 13;(source:Araport11) |
AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
AT4G15236 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
AT2G13610 | ABC-2 type transporter family protein;(source:Araport11) |
AT3G20320 | Encodes a permease-like component of an ABC transporter involved in lipid transfer from ER to chloroplast. A phosphatidic acid-binding protein with a predicted mycobacterial cell entry domain. It is tethered to the inner chloroplast envelope membrane facing the outer envelope membrane. Presumed bacterial orthologs of TGD1 and TGD2 in Gram-negative bacteria are typically organized in transcriptional units, suggesting their involvement in a common biological process. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
AT1G67940 | member of NAP subfamily The mRNA is cell-to-cell mobile. |
AT1G10670 | One of the three genes encoding subunit A of the trimeric protein ATP Citrate Lyase. Antisense ACLA-1 plants cause a reduction in cytosolic acetyl-CoA metabolism and have upregulation of stress-related genes and down-regulation of primary metabolism and growth genes, suggesting the mutation restricts normal growth and developmental processes and puts the plant into a state of stress. |
AT1G60810 | One of the three genes encoding subunit A of the trimeric enzyme ATP Citrate lyase |
AT1G09430 | Encodes subunit A of the heteromeric enzyme ATP citrate lyase (ACL). In animals, ACL is encoded by a single gene; ACL in Arabidopsis is composed of two polypeptides, ACLA (encoded by 3 genes) and ACLB (encoded by 2 genes). The holoenzyme has an A(4)B(4)stoichiometry. Expression of both ACLA and ACLB but not of either of the subunits alone results in ACL activity. |
AT3G06650 | One of the two genes encoding subunit B of the trimeric enzyme ATP Citrate lyase |
AT4G14680 | Encodes one of three A. thaliana ATP-sulfurylases. APS is the first enzyme of sulfate assimilation that catalyzes the formation of adenosine-5'-phosphosulfate from ATP and sulfate. |
AT5G61810 | Encodes the predominant of three APC isoforms in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
AT5G07320 | Encodes an APC isoform in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
AT1G56310 | DEDDy-type 3′ -> 5′ exoribonuclease involved in miRNA degradation. |
AT4G18980 | Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression. |
AT2G40800 | TIM domain protein. Associates with components of mitochondrial complex I and III. May be involved in biogenesis of respiratory chain components. |
AT3G56430 | TIM domain protein. Associates with components of mitochondrial complex I and III. May be involved in biogenesis of respiratory chain components. |
AT4G26160 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
AT4G29670 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
AT2G33270 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. |
AT1G08570 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. The mRNA is cell-to-cell mobile. |
AT5G61440 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. The mRNA is cell-to-cell mobile. |
AT2G32980 | HAUS augmin-like complex subunit;(source:Araport11) |
AT5G38880 | HAUS augmin-like complex subunit;(source:Araport11) |
AT3G63380 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT2G41560 | Encodes a calmodulin-regulated Ca(2+)-ATPase that improves salt tolerance in yeast. Localized to the vacuole. Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA11. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate). |
AT3G57330 | Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA4. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate) |
AT3G13970 | Autophagy protein. |
AT3G19190 | Encodes autophagy-related 2 (ATG2). The mRNA is cell-to-cell mobile. |
AT2G44140 | Autophagy protein |
AT5G17290 | Autophagy protein ATG5. Forms a conjugate with ATG12 with an essential role in plant nutrient recycling. Mutants missing ATG5 display early senescence and are hypersensitive to nitrogen or carbon starvation, accompanied by a more rapid loss of organellar and cytoplasmic proteins. |
AT5G45900 | Component of autophagy conjugation pathway. Required for proper senescence. Contributes to plant basal immunity towards fungal infection. |
AT4G21980 | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. Highest expression in flowers. mRNA abundance increased during dark-induced carbon starvation. Predominantly cytoplasmic with or without N starvation. Upon concanamycin A the protein accumulates in the central vacuole as punctuate structures that resemble autophagic bodies. This localization is more abundant upon N starvation. The mRNA is cell-to-cell mobile. |
AT4G04620 | Autophagy protein. |
AT1G62040 | Autophagy protein. |
AT2G45170 | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes. Involved in submergence (hypoxia) tolerance; ethanol induces autophagy. |
AT4G16520 | Autophagy protein. |
AT3G15580 | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. |
AT3G06420 | Autophagy protein. |
AT2G31260 | Involved in autophagy, the process of vacuolar bulk degradation of cytoplasmic components. Mutant shows accelerated bolting and senescence. |
AT3G49590 | Autophagy protein. |
AT5G05150 | autophagy-related protein 18E;(source:Araport11) |
AT3G61960 | autophagy gene |
AT1G75310 | auxin-like 1 protein;(source:Araport11) |
AT1G21660 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT4G36520 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G49980 | auxin F-box protein 5;(source:Araport11) |
AT5G43700 | Auxin inducible protein similar to transcription factors. |
AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
AT1G54990 | auxin response mutant (AXR4) The mRNA is cell-to-cell mobile. |
AT2G28350 | Involved in root cap cell differentiation. |
AT1G77850 | Encodes a transcriptional regulator that directly binds to the promoter of MYB108 and plays a crucial role in anther dehiscence, pollen wall pattern formation, tapetum development, and auxin signal transduction in anthers. It is post-transcriptionally regulated by miR160 and regulates early auxin response genes. |
AT1G19220 | Encodes an auxin response factor that contains the conserved VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like domains III and IV present in most ARFs at its C-terminus. The protein interacts with IAA1 (yeast two hybrid) and other auxin response elements such as ER7 and ER9 (yeast one hybrid). ARF19 protein can complement many aspects of the arf7 mutant phenotype and , together with ARF7, is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
AT5G62000 | Encodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation. The mRNA is cell-to-cell mobile. |
AT5G60450 | Encodes a member of the ARF family of transcription factors which mediate auxin responses. ARF4 appears to have redundant function with ETT(ARF3) in specifying abaxial cell identity. |
AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
AT5G37020 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF6 to control stamen elongation and flower maturation. Expression of ARF8 is controlled by miR167. |
AT4G23980 | Encodes auxin response factor 9 (ARF9). The mRNA is cell-to-cell mobile. |
AT3G26810 | Auxin F box protein, the dominant auxin receptor in roots. |
AT1G12820 | Auxin receptor involved in primary and lateral root growth inhibition in response to nitrate. Target of miR393. Induced by nitrate in primary roots. |
AT4G24390 | RNI-like superfamily protein;(source:Araport11) |
AT1G78100 | F-box family protein;(source:Araport11) |
AT3G07390 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. The mRNA is cell-to-cell mobile. |
AT2G33310 | Auxin induced gene, IAA13 (IAA13). |
AT3G59900 | Encodes ARGOS (Auxin-Regulated Gene Involved in Organ Size). Inducible by auxin. Involved in lateral organ size control. Transgenic plants expressing sense or antisense ARGOS cDNA display enlarged or reduced aerial organs, respectively. The alteration in organ size is attributable mainly to changes in cell number and the duration of organ growth. |
AT4G12980 | Activated by OXS2 under the treatment of salt. |
AT4G12470 | Encodes AZI1 (AZELAIC ACID INDUCED 1). Involved in the priming of salicylic acid induction and systemic immunity triggered by pathogen or azelaic acid. Targeting if AZI1 to chloroplasts is increased during SAR induction and that localization requires the PRR domain.It is involved in the uptake and movement of the azelaic acid signal. AZI1 uses a previously undescribed variant of the signal anchor proteins mechanism to target plastids. AZI1 uses a bipartite N-terminal signature: a non-cleavable TMD that anchors the protein to membranes, followed by a proline rich region with features that are shared with bona fide chloroplastic transit peptides. flg22 MAMP treatment strongly induces AZI1/EARLI1 protein levels and increases their relative enrichment in the plastid fraction. |
AT2G33500 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT1G28050 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT1G68520 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT1G25440 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT1G49130 | Regulated by heat shock. |
AT1G75540 | Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. The mRNA is cell-to-cell mobile. |
AT4G10240 | B-box zinc finger family protein;(source:Araport11) |
AT1G68190 | B-box zinc finger family protein;(source:Araport11) |
AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
AT5G54470 | B-box type zinc finger family protein;(source:Araport11) |
AT3G21150 | Encodes a protein with a B-box domain predicted to act as a transcription factor. Expression of the BBX32 gene is affected by monochromatic red light. Genetic analysis shows BBX32 is under circadian control; it is a morning gene under clock regulation. |
AT5G48250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT3G18080 | B-S glucosidase 44;(source:Araport11) |
AT4G34700 | Encodes the B22 subunit of eukaryotic mitochondrial Complex I. Mutation in the gene display pleiotropic phenotypes including shorter roots, smaller plants and delayed flowering. The mRNA is cell-to-cell mobile. |
AT1G27190 | Activated by TCP8/14/15/22, involved in modulation of GA-dependent stamen filament elongation. |
AT2G35260 | CAAX protease self-immunity protein;(source:Araport11) |
AT4G17840 | CAAX protease self-immunity protein;(source:Araport11) |
AT3G45260 | BIB is a member of the BIRD family of zinc finger proteins that includes JKD. BIB functions redundantly with JKD to retain SHR in the nucleus and thereby restrict SHR movement in root tissues. |
AT3G47710 | BNQ3 belongs to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. Directly and negatively regulated by AP3 and PI in petals. Required for appropriate regulation of flowering time.May also have a role in regulating light responses. |
AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
AT3G49670 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM1,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM2 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
AT3G12500 | encodes a basic chitinase involved in ethylene/jasmonic acid mediated signalling pathway during systemic acquired resistance based on expression analyses. |
AT4G29100 | Member of basic helix loop helix protein family. Expressed primarily in vascular system. Overexpression causes ABA sensitivity. Together with PFA1 and PFA2 governs the competence of pericycle cells to initiate lateral root primordium formation. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT1G06170 | Encodes a bHLH transcription factor that together with bHLH010 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. Recognizes the TCATGTGC box to activate the expression of target genes, including ATA20, EXL4, and MEE48. |
AT1G51070 | bHLH115 is a basic helix loop helix protein of the IVc subgroup that plays a role in iron homeostasis. It interacts with related family members and targets PYE and other genes involved in response to Fe. |
AT3G25710 | Encodes a basic helix-loop-helix transcription factor that is expressed in the hypophysis-adjacent embryo cells, and is required and partially sufficient for MP-dependent root initiation. Involved in response to phosphate starvation. Negative regulator of root hair development, anthocyanin formation and Pi content. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
AT3G23210 | bHLH34 is a basic helix loop helix transcription factor. It can bind GAGA and E-box cis elements.It is induced by abiotic stressors including ABA, salt and glucose. PGR, a plasma membrane glucose responsive regulator is a target of bHLH34. Involved in Fe regulation. |
AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT3G51960 | bZIP transcription factor induced by salt stress and promoted salt tolerance. Localized to the cytoplasm and nucleus under control conditions and targeted preferentially to the nucleus under salt stress |
AT3G54620 | bZIP transcription factor-like protein mRNA |
AT5G49450 | Encodes a transcription activator is a positive regulator of plant tolerance to salt, osmotic and drought stresses. |
AT2G18160 | Encodes a b-ZIP transcription factor. |
AT5G15830 | basic leucine-zipper 3;(source:Araport11) |
AT1G75390 | basic leucine-zipper 44;(source:Araport11) |
AT1G06850 | bZIP protein involved in heat stress response. Under heat stress localization moves exclusively to nucleus. |
AT2G22850 | basic leucine-zipper 6;(source:Araport11) |
AT1G06070 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT1G14685 | Encodes a member of the BASIC PENTACYSTEINE (BPC) proteins. BPC proteins are plant-specific transcription factors present throughout land plants. BPC transcription factor family is integral for a wide range of processes that support normal growth and development.Along with BPC1, BPC2 binds to the promoter of and represses GALS1 thereby reducing beta 1,4- galactan accumulation. |
AT1G68120 | BASIC PENTACYSTEINE protein;(source:Araport11) |
AT4G38910 | Encodes a basic pentacysteine protein that is localized to the nucleus and specifically binds in vitro to GA dinucleotide repeats. |
AT2G01930 | BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.Along with BPC2, BPC1 binds to the promoter of and represses GALS1 thereby reducing beta 1,4- galactan accumulation. |
AT1G27850 | Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development. |
AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT3G51540 | mucin-5AC-like protein;(source:Araport11) |
AT3G62420 | Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene. |
AT3G56660 | basic region/leucine zipper motif protein 49;(source:Araport11) |
AT1G32150 | Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members. |
AT5G47120 | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. The mRNA is cell-to-cell mobile. |
AT3G60080 | RING/U-box superfamily protein;(source:Araport11) |
AT3G10815 | RING/U-box superfamily protein;(source:Araport11) |
AT1G55530 | RING/U-box superfamily protein;(source:Araport11) |
AT3G56130 | biotin/lipoyl attachment domain-containing protein;(source:Araport11) |
AT5G52060 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
AT5G62100 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
AT5G07220 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
AT3G51780 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. BD domain of ATBAG4 had highest similarity to human DB domain of BAG protein. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
AT2G46240 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Expression of BAG6 in leaves was strongly induced by heat stress. Knockout mutants exhibited enhanced susceptibility to fungal pathogen Botrytis cinerea. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. The mRNA is cell-to-cell mobile. |
AT5G62390 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. Localized to the ER. Necessary for the proper maintenance of the unfolded protein response during heat and cold tolerance. |
AT1G77890 | One of a pair of paralogs (the other is AT4G08540)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex but is not essential for PI3P biosynthesis. |
AT2G35940 | Encodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm. |
AT4G36870 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw1/saw2 may act redundantly to repress BP in leaves. Regulates together with BLH4 demethylesterification of homogalacturonan in seed mucilage. |
AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
AT2G23760 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw2 and saw1 may act redundantly to repress BP in leaves. Regulates together with BLH2 demethylesterification of homogalacturonan in seed mucilage. |
AT2G16400 | BEL1-like homeodomain 7;(source:Araport11) |
AT5G41410 | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
AT1G69010 | Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
AT4G36780 | BES1/BZR1 homolog 2;(source:Araport11) |
AT4G18890 | BES1/BZR1 homolog 3;(source:Araport11) |
AT1G78700 | BES1/BZR1 homolog 4;(source:Araport11) |
AT3G61320 | Encodes a bestrophin-like protein (Best1). Located in the stroma thylakoid membrane. Functions as a chloride ion channel. Proposed to modulate proton motive force partitioning by mediating chloride ion influx in the thylakoid lumen. Major isoform (based on transcript analysis), redundant function with AtBest2. |
AT3G58170 | Encodes a Bet1/Sft1-like SNARE protein which fully suppresses the temperature-sensitive growth defect in sft1-1 yeast cells; however, it cannot support the deletion of the yeast BET1 gene (bet1Δ). |
AT1G58180 | beta carbonic anhydrase 6;(source:Araport11) |
AT4G27830 | Encodes a beta-glucosidase that may be responsible for acyl-glucose-dependent anthocyanin glucosyltransferase activity in Arabidopsis. In vitro efforts to demonstrate AAGT activity for BGLU10 have been unsuccessful but experiments with mutants in this gene suggest at least an indirect involvement in anthocyanin formation. |
AT1G02850 | beta glucosidase 11;(source:Araport11) |
AT3G60130 | beta glucosidase 16;(source:Araport11) |
AT2G44480 | beta glucosidase 17;(source:Araport11) |
AT1G52400 | encodes a member of glycosyl hydrolase family 1, located in inducible ER bodies which were formed after wounding, required in inducible ER body formation The mRNA is cell-to-cell mobile. |
AT3G60120 | beta glucosidase 27;(source:Araport11) |
AT2G44460 | Beta-glucosidase, major myrosinase which initiates sulfur reallocation by hydrolyzing particular GL species, conferring sulfur deficiency tolerance, especially during early development. |
AT2G44470 | beta glucosidase 29;(source:Araport11) |
AT1G60090 | beta glucosidase 4;(source:Araport11) |
AT3G18070 | beta glucosidase 43;(source:Araport11) |
AT1G61820 | beta glucosidase 46;(source:Araport11) |
AT4G27820 | beta glucosidase 9;(source:Araport11) |
AT5G42100 | encodes a plasmodesmal (Pd)-associated membrane protein involved in plasmodesmal callose degradation, i.e. beta-1,3-glucanase (EC 3.2.1.39), and functions in the gating of Pd |
AT3G52060 | Encodes a plasmodesmal glycosyltransferase-like protein. Mutation results in defects in seed germination and delayed plant growth. |
AT3G23920 | Encodes a chloroplast beta-amylase. Is necessary for leaf starch breakdown in the absence of BAM3.Activity of BAM1 increases 4 days after osmotic stress. BAM1 has a higher temperature optimum than BAM3 (PMID:25293962). |
AT5G18670 | putative beta-amylase BMY3 (BMY3) |
AT5G52570 | Converts β-carotene to zeaxanthin via cryptoxanthin. |
AT5G64570 | Encodes a beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
AT1G55120 | Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. |
AT1G77410 | beta-galactosidase 16;(source:Araport11) |
AT1G72990 | beta-galactosidase 17;(source:Araport11) |
AT3G52840 | beta-galactosidase 2;(source:Araport11) |
AT5G56870 | beta-galactosidase 4;(source:Araport11) |
AT5G20710 | beta-galactosidase 7;(source:Araport11) |
AT2G28470 | putative beta-galactosidase (BGAL8 gene) |
AT1G61810 | beta-glucosidase 45;(source:Araport11) |
AT4G21760 | beta-glucosidase 47;(source:Araport11) |
AT5G39990 | Encodes GlcAT14A, a beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan. The protein was localized to the Golgi apparatus when transiently expressed in Nicotiana benthamiana. Plays a role in cell elongation during seedling growth. |
AT1G65590 | Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane. |
AT1G67730 | Encodes one of the two Arabidopsis homologues to YBR159w encoding a S. cerevisiae beta-ketoacyl reductase (KCR), which catalyzes the first reduction during VLCFA (very long chain fatty acids, >18 carbon) elongation: KCR1 (At1g67730), KCR2 (At1g24470). Complementation of the yeast ybr159Delta mutant demonstrated that the two KCR proteins are divergent and that only AtKCR1 can restore heterologous elongase activity similar to the native yeast KCR gene. The mRNA is cell-to-cell mobile. |
AT5G64370 | PYD3 encodes a beta-ureidopropionase which, when expressed in E. coli, has been shown to convert beta-ureidopropionate into beta-alanine. It localizes to the cytosol and plays an important role in uracil degradation. |
AT5G49360 | Encodes a bifunctional {beta}-D-xylosidase/{alpha}-L-arabinofuranosidase required for pectic arabinan modification. Located in the extracellular matrix. Gene is expressed specifically in tissues undergoing secondary wall thickening. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
AT4G31490 | Required for plant growth, salt tolerance, and maintenance of the structure of the Golgi apparatus. |
AT1G75380 | Encodes a nuclease involved in ABA-mediated callose deposition. It has been shown to interact with JAZ proteins, binds to a jasmonic acid-responsive element (JARE) and repress AtJMT expression. |
AT1G19660 | Wound-responsive family protein;(source:Araport11) |
AT1G69160 | suppressor;(source:Araport11) |
AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
AT4G22840 | Sodium Bile acid symporter family;(source:Araport11) |
AT1G78560 | Chloroplast inner membrane, pantothenate transporter. |
AT5G16840 | Binds to ACD11 and fungal elicitor RxLR207. Regulates ROS mediated defense response. |
AT1G09080 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
AT5G57590 | Encodes a bifunctional enzyme with both dethiobiotin synthetase and diaminopelargonic acid aminotransferase activities that is involved in biotin synthesis. |
AT1G64150 | Encodes an integral thylakoid membrane protein that is required for normal operation of oxygen-evolving complex (as evidenced by oxygen evolution rates) and for manganese incorporation. PAM71 belongs to a small gene family in Arabidopsis comprising five members. PAM71 is well conserved in the green lineage and shares homology with putative Ca2+/H+ exchangers from yeast (Saccharomyces cerevisiae) (GDT1) and human (Homo sapiens) (TMEM165). |
AT3G57130 | Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus. |
AT4G18950 | BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening. |
AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
AT5G20230 | Encodes a Al-stress-induced gene. Along with TCF, it promotes lignin biosynthesis in response to cold stress. The mRNA is cell-to-cell mobile. |
AT1G14580 | C2H2-like zinc finger protein;(source:Araport11) |
AT5G53400 | Encodes BOBBER1 (BOB1), a non-canonical small heat shock protein required for both development and thermotolerance. BOB1 is cytoplasmic at basal temperatures but forms heat shock granules containing canonical small heat shock proteins at high temperatures. The mRNA is cell-to-cell mobile. |
AT1G64670 | Encodes a epidermally expressed extracellular protein that likely functions as an alpha-beta hydrolase and is required for normal cuticle formation. Homozygous mutant plants are dwarfed and have abnormal leaves, collapsed cells, reduced numbers of trichomes. The specific role of BDG is unclear: it may function in cutin biosynthesis or as a cross-linking enzyme in the cell wall itself. |
AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
AT3G61190 | Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis. |
AT5G61900 | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
AT5G07300 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. |
AT1G08860 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Overexpression of this gene suppresses bon1-1 phenotypes. Double mutant analyses with bon1-1 suggest that BON1 and BON3 have overlapping functions in maintaining cellular homeostasis and inhibiting cell death. |
AT4G39630 | translation initiation factor;(source:Araport11) |
AT2G39660 | Encodes a plasma membrane-localized ser/thr protein kinase that is a crucial component of host response signaling required to activate the resistance responses to Botrytis and A. brassicicola infection. It is likely a negative regulator of salicylic acid accumulation and basal defense against virulent bacterial pathogens. Together with ER plays opposing roles in leaf morphogenesis and inflorescence architecture. Required to maintain appropriate auxin response during leaf margin morphogenesis. Interacts with ER-family proteins and directly phosphorylates ER. |
AT1G79420 | C-type mannose receptor (DUF620);(source:Araport11) |
AT3G19540 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
AT5G66740 | spindle assembly abnormal protein (DUF620);(source:Araport11) |
AT3G01210 | ACD11 binding partner, may be involved in negative regulation of ROS-mediated defense response. |
AT4G17720 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
AT5G32450 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
AT1G18400 | Encodes the brassinosteroid signaling component BEE1 (BR-ENHANCED EXPRESSION 1). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT4G36540 | Encodes the brassinosteroid signaling component BEE2 (BR-ENHANCED EXPRESSION 2). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT1G73830 | Encodes the brassinosteroid signaling component BEE3 (BR-ENHANCED EXPRESSION 3). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT4G31910 | Encodes an acyltransferase that can modify brassinosteroids (BRs) by acylation and may modulate endogenous BR levels. |
AT2G46020 | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D. |
AT3G03460 | One of two paralogous GLTSCR domain containing proteins and a core component of SWI/SNF complexes. Interacts with BRM and may be responsible for ensuring proper complex assembly and association with chromatin. Function is dependent upon the GLTSCR domain. |
AT3G18550 | Encodes a TCP transcription factor, closely related to teosinte branched1, arrests axillary bud development and prevents axillary bud outgrowth. Role in flowering control. |
AT1G10060 | encodes a mitochondrial branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
AT1G10070 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. Involved in cell wall development. |
AT3G49680 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
AT1G75080 | Encodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. There is evidence for phosphorylation-dependent nucleocytoplasmic shuttling of BZR1. GSK3-like kinases (including BIN2), 14-3-3 proteins, and the phosphatase BSU1 seem to participate in this process. Phosphorylation also appears to affect BZR1's transcriptional activities. |
AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. The mRNA is cell-to-cell mobile. |
AT4G18710 | Encodes BIN2, a member of the ATSK (shaggy-like kinase) family. BIN2 functions in the cross-talk between auxin and brassinosteroid signaling pathways. BIN2 regulates root epidermal cell fate specification by phosphorylating EGL3 and TTG1. BIN2-mediated phosphorylation appears to promote BZR1 export from the nucleus. KIB1 interacts with BIN2 blocking its interaction with substrates and promotes BIN2 degradation. |
AT5G24630 | This gene is predicted to encode a protein that forms part of the topoisomerase VI complex. BIN4 is a nuclear-localized protein that can bind DNA. bin4 mutants are brassinolide-insensitive dwarves with severely reduced cell size in leaves, roots, and hypocotyls. Proper development of root hairs and trichomes is also disrupted in bin4 mutants and they have elevated levels of double strand breaks in their cotyledon cells. |
AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
AT4G00710 | Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
AT1G31880 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. BRX encodes a key regulator of cell proliferation and elongation in the root, which has been implicated in the brassinosteroid (BR) pathway as well as regulation of auxin-responsive gene expression. Also involved in cytokinin-mediated inhibition of lateral root initiation. A loss-of-function allele, named brx-2 in Rodrigues et al. (2009) Plant Physiol. but changed to brx-3 to resolve nomenclature conflict (Li et al. Planta 2009:229(3):593-603), shows enhanced response to ABA-mediated inhibition of root growth. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with PAX, thereby timing PPSE differentiation. Dampens PIN-mediated auxin efflux. |
AT2G35600 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
AT5G20540 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
AT5G42750 | Encodes a plasma-membrane associated phosphoprotein that interacts directly with the kinase domain of BRI1 through the evolutionarily conserved C-terminal BIM motif binding to the C-lobe of the BRI1 kinase domain. It interferes with the interaction between BRI1 with its signalling partner, the plasma membrane localised LRR-receptor kinase BAK1 by inhibiting the transphosphorylation to keep BRI1 at a basal level of activity. It is phosphorylated by BRI1 at Ser270 & Ser274 and at tyrosine site Tyr211 and dissociates from plasma membrane to end up in the cytosol after phosphorylation. Its loss-of-function mutant shows higher sensitivity to BR treatment. |
AT2G45400 | involved in the regulation of brassinosteroid metabolic pathway |
AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
AT3G13380 | Similar to BRI, brassinosteroid receptor protein. |
AT1G61215 | Bromodomain protein with a DNA binding motif |
AT1G20670 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
AT1G76380 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
AT1G03457 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G18290 | Encodes BRUTUS (BTS), a putative E3 ligase protein with metal ion binding and DNA binding domains, which negatively regulates the response to iron deficiency. The mRNA is cell-to-cell mobile. |
AT1G74770 | zinc ion binding protein;(source:Araport11) |
AT1G18910 | E3 ubiquitin ligase that functions redundantly in the root with BTSL1 to negatively regulate iron uptake. |
AT5G67480 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
AT4G37610 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
AT5G19000 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
AT5G21010 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
AT1G50280 | BTB/POZ protein that forms a complex with CUL3a. Involved in repression of ABA responses. |
AT3G19590 | Encodes a protein that may have a role in the spindle assembly checkpoint. |
AT1G49910 | Encodes a homolog of the yeast and human BUB3 (BUDDING UNINHIBITED BY BENZYMIDAZOL 3) protein. Yeast and human BUB3s function in spindle assembly checkpoint control. |
AT5G04480 | Encodes a protein with sequence similarity to glycosyltransferases that is localized to the golgi apparatus and is involved in pollen tube development. |
AT1G01550 | Encodes a protein with no functionally characterized domains that to prevent the synthesis of a novel substance that moves from the root to the shoot, where it modifies shoot growth by interfering with auxin signaling. Synthesis and delivery of this substance requires neither phloem nor endodermis. |
AT2G46080 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
AT4G01360 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
AT1G18740 | DUF793 domain containing protein. Expression is induced by cold. Loss of function mutations are more sensitive to freezing and have reduced levels of CBFs. May act by preventing degradation of CBFs. |
AT1G19490 | Putative bZIP transcription factor. Expression is induced by drought and mutants are sensitive to drought. |
AT4G39070 | Encodes BZS1, a brassinosteroids-regulated BZR1 target (BRBT) gene. BZS1 is a putative zinc finger transcription factor. Expression of BZS1 was increased under BR-deficient condition and repressed by BR. Transgenic Arabidopsis plants overexpressing BZS1 showed a hypersensitivity to the BR biosynthetic inhibitor brassinazole (BRZ). In contrast, transgenic plants expressing reduced level of BZS1 had longer hypocotyls than wild type when grown on BRZ. |
AT5G51990 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF4). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to drought stress and abscisic acid treatment, but not to low temperature. |
AT4G25490 | Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
AT4G25470 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. |
AT1G72180 | Encodes a leucine-rich repeat receptor kinase that functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
AT1G70790 | C2-domain ABA-related (CAR) protein, involved in the recruitment of ABA receptors to the plasma membrane to facilitate ABA signaling. Its stability and dynamic localization is regulated by LOT1. |
AT3G56170 | Encodes a calcium-dependent nuclease with similarity to staphylococcal nuclease. |
AT4G01840 | Encodes AtTPK5, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK5 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
AT5G49480 | AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. The mRNA is cell-to-cell mobile. |
AT4G27280 | EF-hand Ca2 + -binding protein, which is a Ca2+-dependent transducer of auxin-regulated gene expression and interacts with ICR1. |
AT1G64980 | Encodes a putative nucleotide-diphospho-sugar transferase required for pollen germination and tube growth. |
AT5G44070 | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. The mRNA is cell-to-cell mobile. |
AT4G34050 | Methyltransferase in the lignin biosynthetic pathway. |
AT4G26570 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins) |
AT5G21326 | Ca2+regulated serine-threonine protein kinase family protein;(source:Araport11) |
AT4G17615 | Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation. |
AT5G47100 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo. |
AT1G16020 | vacuolar fusion protein (DUF1712);(source:Araport11) |
AT5G17860 | Cation/Ca2+ exchanger family member. Double mutants with CCX4 show delayed greening and defects in ROS response. |
AT4G22120 | Calcium-permeable stretch activated cation channel. |
AT4G38810 | SnRK2-Interacting Calcium Sensor. Encodes two different isoforms that can both inhibit SnRK2. The longer form (AT4G38810.2) is calcium dependant, the other is not. |
AT2G41860 | member of Calcium Dependent Protein Kinase |
AT5G19450 | calcium-dependent protein kinase (CDPK19) mRNA, complete |
AT2G35890 | member of Calcium Dependent Protein Kinase |
AT5G66210 | Calcium Dependent Protein Kinase. Functions in the BIK1 innate immune response pathway. |
AT1G76040 | member of Calcium Dependent Protein Kinase |
AT3G57530 | Calcium-dependent Protein Kinase. ABA signaling component that regulates the ABA-responsive gene expression via ABF4. AtCPK32 has autophosphorylation activity and can phosphorylate ABF4 in vitro |
AT1G05570 | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
AT2G41010 | Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress. |
AT2G41110 | Encodes a touch-inducible calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. The mRNA is cell-to-cell mobile. |
AT3G56800 | encodes a calmodulin |
AT1G66410 | encodes a calmodulin |
AT3G51920 | encodes a divergent member of calmodulin, which is an EF-hand family of Ca2+-binding proteins. This gene is expressed in leaves, flowers and siliques. The gene functionally complements yeast calmodulin 1 (CAM1) but only when selected against the plasmid harboring wild-type yeast sequences. Also the protein does not form formed a complex with a basic amphiphilic helical peptide in the presence of Ca2+ in vitro. Authors suggest that this gene may represent a Ca2+-binding sensor protein that interacts with a more limited set of target proteins than do more conventional CaM isoforms. Mutations in this gene alter plant responses to abiotic stress and abscisic acid. |
AT2G41090 | Encodes a cytoplasmic, calcium binding calmodulin variant. CML10 interacts with phosphomannomutase (PMM)in vivo and increases its activity thereby affecting ascorbic acid biosynthesis. Its expression is induced by oxidative and other stress. The mRNA is cell-to-cell mobile. |
AT1G66400 | Encodes a calmodulin-like protein. Regulates nitric oxide levels and transition to flowering. |
AT4G20780 | Calcium sensor involved in trichome branching. |
AT4G35987 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G62570 | Calmodulin binding protein-like protein;(source:Araport11) |
AT5G64220 | CAMTA2 proteins bind to the AtALMT1 promoter at in vitro. The gene itself is Al inducible, and AtALMT1 expression is partially repressed in camta2 mutant. The mRNA is cell-to-cell mobile. |
AT4G35310 | calmodulin-domain protein kinase CDPK isoform 5 (CPK5) |
AT3G20410 | calmodulin-domain protein kinase CDPK isoform 9 (CPK9) |
AT3G10660 | predicted to encode calcium-dependent protein kinase and is localized to the ER. Protein is myristoylated in a cell-free extract. Changing the proposed myristoylated site, G residue in the amino terminal, to A prevented the meristoylation . The G to A mutation decreased AtCPK2 membrane association by approximately 50%. |
AT1G76650 | calmodulin-like 38;(source:Araport11) |
AT5G61790 | calnexin 1;(source:Araport11) |
AT1G09210 | Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress. |
AT1G08450 | Encodes one of three Arabidopsis calreticulins. In CRT-deficient mouse fibroblasts, this protein restores ER Ca2+ levels. Non-receptor component required for EFR-mediated immunity. Mutants show de-repressed anthocyanin accumulation in the presence of elf18, and EFR accumulation and signalling. |
AT1G57680 | plasminogen activator inhibitor;(source:Araport11) |
AT5G18520 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. The mRNA is cell-to-cell mobile. |
AT4G01060 | Encodes a Myb-related protein similar to CPC. Involved in epidermal cell differentiation. Mutants have reduced numbers of root hairs and increased trichome branching. Involved in endoreduplication. Loss of function mutants are hypertrophic and early flowering. |
AT3G01500 | Encodes a putative beta-carbonic anhydrase betaCA1. Together with betaCA4 (At1g70410) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. Activated by OXS2 under the treatment of salt. |
AT3G48700 | carboxyesterase 13;(source:Araport11) |
AT5G14310 | carboxyesterase 16;(source:Araport11) |
AT1G49660 | Encodes a protein with carboxylesterase whose activity was tested using pNA. |
AT4G32810 | Encodes a protein with similarity to carotenoid cleaving deoxygenases, the enzymes that cleave beta-carotene. Involved in the production of a graft transmissable signal to suppress axillary branching. Protein is localized to chloroplast stroma and expressed primarily in root tip. Mutants in the gene exhibit increased shoot branching, and light-dependent defects in hook opening and hypocotyl/root elongation. Only upregulated by auxin in the root and hypocotyl, and this is not required for the inhibition of shoot branching. |
AT4G28860 | Member of CKL gene family (CKL-A group) |
AT4G28540 | Member of CKL gene family (CKL-C group). |
AT4G17640 | Encodes casein kinase II beta (regulatory) subunit. |
AT3G60250 | Regulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis |
AT1G04440 | Member of CKL gene family (CKL-C group). |
AT4G03540 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G15610 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G06390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G14380 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G35760 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT5G62820 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G36330 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G55390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G39530 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT5G02060 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G37235 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G50810 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G11550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G35600 | Encodes a receptor-like cytoplasmic kinase that acts as a spatial inhibitor of cell separation. Analysis of the cDNA previously described in Meiners et al., 1991 revealed mistakes in the predicted open reading frame. The mRNA is cell-to-cell mobile. |
AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
AT4G35090 | Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. Note that in Queval et al. (2007) Plant Journal, 52(4):640, SALK_057998 is named as cat2-1, SALK_076998 is named as cat2-2; in Bueso et al. (2007) Plant Journal, 52(6):1052, SALK_076998 is named as cat2-1. TAIR has adopted the nomenclature consistent with that in Bueso et al. (2007) after consultation with the authors: SALK_076998 (cat2-1), SALK_057998 (cat2-2). |
AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile. |
AT1G54115 | Involved in cation (Na and K) homeostasis. |
AT1G08960 | Encodes a member of the Potassium-dependent sodium-calcium exchanger like-family that localizes to the plasma membrane and nuclear periphery, and has a role in mediating high-affinity K+ uptake and Na+ transport in yeast. |
AT3G51860 | cation exchanger 3;(source:Araport11) |
AT3G14070 | Involved in cation (K, Na and Mn) homeostasis and transport |
AT5G17850 | CCX2 is a putative cation/Ca2+ exchange protein. It is located in the endoplasmic reticulum. It plays a role in salt induced calcium signaling. Loss of function results in decreased cytosolic and increased ER Ca2+ concentrations. |
AT5G41610 | member of Putative Na+/H+ antiporter family |
AT3G17630 | member of Putative Na+/H+ antiporter family |
AT3G53720 | member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells. |
AT1G08135 | cation/H+ exchanger 6B;(source:Araport11) |
AT1G58030 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Localized to the tonoplast. |
AT1G17120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
AT3G17510 | Encodes a CBL-interacting protein kinase. Specifically interacts with ECT1 and ECT2. |
AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
AT2G34180 | Encodes CBL-interacting protein kinase 13 (CIPK13). |
AT5G01810 | Encodes a CBL-interacting serine/threonine protein kinase, also has similarities to SOS2 kinase. |
AT2G25090 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.18), which has also been reported as a member of the CBL-interacting protein kinases (CIPK16) and is involved in salinity tolerance. |
AT5G57630 | CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress. |
AT2G38490 | member of AtCIPKs |
AT1G30270 | Arabidopsis thaliana CBL-interacting protein kinase 23. CIPK23 serves as a positive regulator of the potassium transporter AKT1 by directly phosphorylating AKT1. CIPK23 is activated by the binding of two calcineurin B-like proteins, CBL1 and CBL9. The mRNA is cell-to-cell mobile. |
AT2G26980 | encodes a serine-threonine protein kinase whose expression increases in response to abscisic acid, cold, drought, high salt, and wounding conditions. The gene is expressed in developing seeds and seedlings. Lines carrying a T-DNA insertions have reduced germination efficiency and expression of cold, high-salt, and abscisic acid marker genes are altered, but not drought-response markers. |
AT5G10930 | Encodes CBL-interacting protein kinase 5 (CIPK5). |
AT4G24400 | Encodes a CBL (calcineurin B-like calcium sensor proteins) -interacting serine/threonine protein kinase. Regulates the low-affinity phase of the primary nitrate response. The mRNA is cell-to-cell mobile. |
AT1G01140 | Encodes a CBL-interacting protein kinase with similarity to SOS2 |
AT5G10860 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
AT4G27460 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
AT3G26740 | transcripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
AT3G44260 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
AT1G61470 | Deadenylase. |
AT1G80780 | Deadenylase. |
AT2G32070 | Deadenylase. |
AT1G62430 | Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis. |
AT2G41140 | Encodes CDPK-related kinase 1 (CRK1). |
AT2G46700 | CDPK-related kinase 3;(source:Araport11) |
AT3G48750 | A-type cyclin-dependent kinase. Together with its specific inhibitor, the Kip-related protein, KRP2 they regulate the mitosis-to-endocycle transition during leaf development. Dominant negative mutations abolish cell division. Loss of function phenotype has reduced fertility with failure to transmit via pollen. Pollen development is arrested at the second mitotic division. Expression is regulated by environmental and chemical signals. Part of the promoter is responsible for expression in trichomes. Functions as a positive regulator of cell proliferation during development of the male gametophyte, embryo and endosperm. Phosphorylation of threonine 161 is required for activation of its associated kinase. |
AT2G29680 | Encodes cell division control protein 6 (CDC6). |
AT2G03670 | CDC48 - like protein AAA-type ATPaseCell. division control protein 48 homolog B |
AT5G64620 | Plant cell wall (CWI) and vacuolar invertases (VI) play important roles in carbohydrate metabolism, stress responses and sugar signaling. |
AT3G22120 | Cell wall-plasma membrane linker protein homolog (CWLP) |
AT1G02800 | Encodes a protein with similarity to endo-1,4-b-glucanases and is a member of Glycoside Hydrolase Family 9. CEL2 is induced by nemotodes and is expressed in syncitia induced by Heterodera schachtii.May be involved in the development and function of syncitia. |
AT1G22880 | cellulase 5;(source:Araport11) |
AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
AT5G09870 | Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose.Mutants are defective in seed coat mucilage.Involved in the regulation of mucilage composition and/or mucilage synthesis. |
AT5G64740 | Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The mRNA is cell-to-cell mobile. |
AT4G39350 | Encodes a cellulose synthase isomer, related to CESA6. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The mRNA is cell-to-cell mobile. |
AT3G56000 | encodes a gene similar to cellulose synthase |
AT1G55850 | encodes a protein similar to cellulose synthase The mRNA is cell-to-cell mobile. |
AT4G24000 | encodes a protein similar to cellulose synthase |
AT4G23990 | encodes a protein similar to cellulose synthase |
AT2G22125 | Encodes a protein involved in cell elongation in root and anther filaments. Mutants have greater cell volumes in root tissues and have additive phenotypes with other cell expansion mutants such as those carrying mutations in COB, QUI and POM1 loci. POM2/CSI1 promotes Cellulose Synthase and microtubule co-alignment. The mRNA is cell-to-cell mobile. |
AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture. |
AT1G24070 | encodes a gene similar to cellulose synthase |
AT1G23480 | encodes a gene similar to cellulose synthase |
AT2G32530 | encodes a gene similar to cellulose synthase |
AT2G32540 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
AT3G03050 | encodes a cellulose synthase like protein. mutations initiate root hairs that rupture at their tip soon after initiation. is required for the synthesis of a noncellulosic wall polysaccharide. |
AT5G16910 | encodes a gene similar to cellulose synthase. Located in Golgi membranes. The mRNA is cell-to-cell mobile. |
AT3G28180 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
AT4G31590 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
AT3G07330 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
AT3G50360 | CAM like protein with four EF-hand domains. Binds calcium. Loss of function mutants affect ABA regulation of guard cell channels and accumulation of stress responsive transcripts(PMID:28603528). |
AT1G15660 | Encodes a homologue of the human centromeric protein C (CENP-C). CENP-C co-localizes with the 180 bp centromeric regions of chromosomes throughout the cell cycle, but does not completely cover the 180 bp regions. |
AT1G34750 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G22820 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT5G20720 | Encodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES. |
AT5G20890 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
AT3G14870 | hypothetical protein (DUF641);(source:Araport11) |
AT3G60680 | DUF641 family protein (DUF641);(source:Araport11) |
AT2G43570 | chitinase;(source:Araport11) |
AT3G16920 | Encodes a chitinase-like protein expressed predominantly in stems. Mutants accumulate ligning in etiolated hypocotyls. |
AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
AT1G44446 | Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll b and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22. |
AT1G19670 | Chlorophyllase is the first enzyme involved in chlorophyll degradation. It catalyzes the hydrolysis of the ester bond to yield chlorophyllide and phytol. AtCLH1 lacks a typical signal sequence for the chloroplast. Its expression is induced rapidly by methyljasmonate, a known promoter of senescence and chlorophyll degradation. |
AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
AT4G17090 | Encodes a beta-amylase targeted to the chloroplast. Transgenic BMY8 RNAi lines fail to accumulate maltose during cold shock suggesting that maltose accumulation coincides with BMY8 expression. Apart from maltose, the sugar content of the RNAi lines were similar to wildtype (glucose and sucrose unaffected).BAM3 activity declines 2 and 4 days after start of cold stress despite an increase in transcript levels. BAM3 activity has a lower temperature optimum than BAM1 (PMID:25293962). |
AT4G13010 | Oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
AT1G36390 | Chloroplast GrpE protein. |
AT2G20270 | Thioredoxin superfamily protein;(source:Araport11) |
AT4G24280 | Involved in protein import into chloroplasts during early developmental stages. The mRNA is cell-to-cell mobile. |
AT5G49910 | Stromal heat shock protein involved in protein import into chloroplast. The mRNA is cell-to-cell mobile. |
AT1G08640 | Encodes a choloroplast membrane protein CJD1 (Chloroplast J-like Domain 1). Predicted to contain a transit peptide, three transmembrane domains and an N-terminal J-like domain. Influences fatty acid composition of chloroplast lipids. |
AT2G16800 | Encodes a nuclear-encoded chloroplast protein that plays an important role in vegetative growth, female gametogenesis, and embryogenesis likely by mediating chloroplast integrity and development. |
AT1G09340 | Encodes CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein. CRB is important for the proper functioning of the chloroplast. Mutations in CRB also affects the circadian system, altering the expression of both oscillator and output genes. The mRNA is cell-to-cell mobile. |
AT2G20020 | Promotes the splicing of chloroplast group II introns. Splices clpP-1 and ropC1 introns. |
AT5G50250 | Encodes a RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Supports editing of specific CP31A-dependent sites. |
AT3G25690 | actin binding protein required for normal chloroplast positioning The mRNA is cell-to-cell mobile. |
AT2G25625 | Histone deacetylase-like protein;(source:Araport11). Induced by senescence and abiotic stresses. |
AT1G10500 | Involved in chloroplast Fe-S cluster assembly. Located in the chloroplast stroma. Expressed preferentially in green tissues. |
AT5G66650 | Chloroplast localized mitochondrial calcium uniporter. |
AT5G63060 | Sec14p like protein involved in chloroplast vesicle transport. Required for photoauxotrophic growth. |
AT1G76080 | Encodes a thioredoxin like protein. Localizes to the chloroplast and is redistributed to the chloroplast envelope under heat stress. It is involved in non host resistance and thermotolerance. |
AT1G08490 | Chloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation. |
AT2G45350 | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-E subfamily) with 11 pentatricopeptide (PPR) repeats. The protein is involved in RNA editing of the initiation codon of ndhD in the chloroplast. |
AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile. |
AT1G74320 | encodes a choline kinase, whose expression is induced by high salt and mannitol. |
AT3G29200 | L-ascorbate peroxidase |
AT5G10870 | Encodes chorismate mutase AtCM2. |
AT5G66750 | Protein is similar to SWI2/SNF2 chromatin remodeling proteins. DDM1 is appears to act as a chromatin-remodeling ATPase involved in cytosine methylation in CG and non-CG contexts. Involved in gene silencing and maintenance of DNA methylation and histone methylation. Hypomethylation of many genomic regions occurs in ddm1 mutants, and can cause several phenotypic abnormalities, but some loci, such as BONSAI (At1g73177) can be hypermethylated in ddm1 mutants after several generations, leading to different phenotypes. DDM1 might be involved in establishing a heterochromain boundary. A line expressing an RNAi targeted against DDM1 shows some resistance to agrobacterium-mediated root transformation. |
AT5G18620 | Encodes a member of the A. thaliana imitation switch (AtISWI) subfamily of chromatin remodeling factors. Double mutation in CHR17 and CHR11 results in the loss of the evenly spaced nucleosome pattern in gene bodies, but does not affect nucleosome density. |
AT3G23690 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G30490 | Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development. |
AT1G80820 | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
AT1G15950 | Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. The mRNA is cell-to-cell mobile. |
AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
AT1G72680 | cinnamyl-alcohol dehydrogenase;(source:Araport11) |
AT2G46830 | Encodes a transcriptional repressor that performs overlapping functions with LHY in a regulatory feedback loop that is closely associated with the circadian oscillator of Arabidopsis. Binds to the evening element in the promoter of TOC1 and represses TOC1 transcription. CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis. CCA1 binds the GI promoter. |
AT2G17570 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
AT2G23400 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
AT5G58770 | AtCPT7 synthesizes medium-chain polyprenols of approximately 55 carbons in length. The enzyme utlizes geranylgeranyl pyrophosphate (GGPP) and isopentenyl pyrophosphate (IPP) as substrates. The enzymatic product accumulates into plastdial membranes (DOI:10.1105/tpc.16.00796). |
AT2G42790 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
AT4G19810 | ChiC encodes a Class V chitinase that is a part of glycoside hydrolase family 18 based on CAZy groupings. It appears to primarily act as an exochitinase in vitro where it predominantly cleaves a chitobiose (GlcNAc)2 residue from the non-reducing end of a chitin oligosaccharide. However, it shows some minor endochitinase activity in vitro, as well. A putative 24 amino-acid signal peptide may direct this protein to the secretory system and it has been detected in cell wall apoplastic fluid. RT-PCR experiments demonstrate that ChiC transcript levels are increased in response to abscisisc acid, jasmonic acid, and NaCl stress. Microarray results also suggest that transcript levels rise in response to osmotic stress, two fungal pathogens, a bacterial pathogen, and the elicitor flagellin. The mRNA is cell-to-cell mobile. |
AT3G11130 | CHC1 heavy chain subunit of clathrin. Involved in vesicle mediated trafficking. Mutants show reduced rates of endocytosis and defects clathrin mediated exocytosis. Mutants also have increased dehydration tolerance which may be related to the overall slower stomatal aperture dynamics. Overall growth is affected. |
AT2G40060 | Encodes a clathrin that is localized to the cortical division zone and the cell plate and colocalizes with TPLATE during cell plate anchoring. The mRNA is cell-to-cell mobile. |
AT3G51890 | Clathrin light chain protein;(source:Araport11) |
AT1G75820 | Putative receptor kinase with an extracellular leucine-rich domain. Controls shoot and floral meristem size, and contributes to establish and maintain floral meristem identity. Negatively regulated by KAPP (kinase-associated protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain. |
AT4G38060 | hypothetical protein;(source:Araport11) |
AT1G73965 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
AT1G63245 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo. |
AT1G70895 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT5G64800 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT4G13195 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770). The protein is expressed in the vascular system and is involved in axillary bud formation. |
AT1G26600 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
AT2G01730 | a homolog of cleavage and polyadenylation specificity factor that plays an essential role in the development of female gametophyte and embryo |
AT4G15560 | Encodes a protein with 1-deoxyxylulose 5-phosphate synthase activity involved in the MEP pathway. It is essential for chloroplast development in Arabidopsis |
AT5G45390 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
AT1G49970 | Encodes a ClpP-related sequence. Though similar to ClpP proteins, this does not contains the highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
AT5G53350 | CLP protease regulatory subunit CLPX mRNA, nuclear gene |
AT5G50920 | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC (Translocon at the Inner envelope membrane of Chloroplasts) translocation machinery. Association of Hsp93 with the inner envelope membrane through its N domain is important for the functions of Hsp93 in vivo. |
AT1G76730 | Encodes a paralog of ATP-dependent folate salvage enzyme 5-formyltetrahydrofolate cycloligase (5-FCL) that is targeted to chloroplasts and to be required for embryo viability and lacks 5-FCL activity. |
AT1G53000 | Encodes a mitochondrial-localized CMP-KDO (3-deoxy-D-manno-octulosonate) synthetase. This is the enzyme activating KDO as a nucleotide sugar prior to its incorporation into rhamnogalacturonan-II. Heterozygous mutants are defective in pollen development and in pollen tube elongation. |
AT3G16860 | COBRA-like protein 8 precursor;(source:Araport11) |
AT2G31955 | COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 2. Encodes a protein involved in molybdenum cofactor biosynthesis. Homologous to E.coli moaA. Expression is abundant in all tissues examined, particularly in roots. Appears to have targeting signals for chloroplast or mitochondria. |
AT1G01290 | COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 3. Encodes a protein involved in molybdenum cofactor biosynthesis. Homologous to E.coli MoaC. Expression is low in all tissues examined, except in roots. Appears to have targeting signals for chloroplast or mitochondria |
AT1G29160 | Encodes a DOF transcription factor involved in seed coat development. Regulates PRX2 and PRX25, involved in seed longevity. |
AT1G29395 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. involved in response to salt tolerance |
AT1G29390 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. |
AT2G15970 | encodes an alpha form of a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. The mRNA is cell-to-cell mobile. |
AT5G42900 | Acts with COR28 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
AT4G36020 | Encodes a cold shock domain protein. Involved in cold acclimation by blocking the secondary structure of mRNA which in turn facilitates translation at cold temperature. |
AT2G21660 | Encodes a small glycine-rich RNA binding protein that is part of a negative-feedback loop through which AtGRP7 regulates the circadian oscillations of its own transcript. Gene expression is induced by cold. GRP7 appears to promote stomatal opening and reduce tolerance under salt and dehydration stress conditions, but, promotes stomatal closing and thereby increases stress tolerance under conditions of cold tolerance. Loss of function mutations have increased susceptibility to pathogens suggesting a role in mediating innate immune response. Mutants are also late flowering in a non-photoperiodic manner and are responsive to vernalization suggesting an interaction with the autonomous flowering pathway. There is a reduction of mRNA export from the nucleus in grp7 mutants. GRP7:GFP fusion proteins can be found in the cytosol and nucleus. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
AT4G33980 | Acts with COR27 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
AT1G45688 | CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
AT2G41990 | late embryogenesis abundant protein;(source:Araport11) |
AT4G38240 | Encodes N-acetyl glucosaminyl transferase I, the first enzyme in the pathway of complex glycan biosynthesis. |
AT4G01290 | Protein with evolutionarily conserved eIF4E-binding motif in its N-terminal domain that can form mRNA cap?binding complexes and has the potential for regulating gene expression as a translation factor associated plant-specific cell cycle regulator. |
AT1G77710 | ubiquitin-fold modifier;(source:Araport11) |
AT2G25240 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death. |
AT5G67370 | DUF1230 family protein (DUF1230);(source:Araport11) |
AT1G67930 | Golgi transport complex protein-like protein;(source:Araport11) |
AT5G03190 | peptide upstream protein;(source:Araport11) |
AT2G31280 | Encodes a LHW-like protein with 80% amino acid identity to LHW. |
AT5G53420 | Member of ASML2 family of CCT domain proteins.There is a preferential accumulation of RNA isoforms CCT101.1 and CCT101.2 in response to N-treatment, each isoform has different targets. |
AT5G15850 | Homologous to the flowering-time gene CONSTANS. |
AT2G24790 | Positive regulator of photomorphogenesis that acts downstream of COP1 but can promote lateral root development independently of COP1 and also function as a daylength-sensitive regulator of shoot branching. The mRNA is cell-to-cell mobile. |
AT5G24930 | Flowering repressor in long days (LD) and short days (SD) and acts on the expression of FT and FT-like genes as well as on SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1). |
AT5G57660 | CONSTANS-like 5;(source:Araport11) |
AT3G07650 | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. The mRNA is cell-to-cell mobile. |
AT3G26940 | Receptor-like cytoplasmic kinase, RLCKVII subfamily. Overexpression causes abnormal differential and elongation growth after organ differentiation. |
AT2G32950 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light. The mRNA is cell-to-cell mobile. |
AT5G14250 | Encodes subunit 3 of the COP9 signalosome. |
AT5G05690 | Encodes a member of the CP90A family, a cytochrome P450 monooxygenase which converts 6-deoxocathasterone to 6-deoxoteasterone in the late C6 oxidation pathway and cathasterone to teasterone in the early C6 oxidation pathway of brassinolide biosynthesis. Expressed in cotyledons and leaves. Mutants display de-etiolation and derepression of light-induced genes in the dark, dwarfism, male sterility and activation of stress-regulated genes in the light. The expression of the gene using a CPD promoter:LUC fusion construct was shown to be under circadian and light control. Additionally, the circadian regulation was shown to be independent of BR levels as it remains unchanged in bri1 mutant lines. CPD appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through a BRI1-mediated signaling pathway that affects FLC expression levels, as uncovered by double mutant analyses. |
AT5G03730 | Homologous to the RAF family of serine/threonine protein kinases. Negative regulator in the ethylene signal transduction pathway. Interacts with the putative ethylene receptors ETR1 and ERS. Constitutively expressed. |
AT3G01490 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
AT3G50260 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. Involved in defense and freezing stress responses. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile. |
AT5G63440 | Encodes a single copy protein in Arabidopsis containing a DUF167 domain that is conserved in eukaryotes. Genetically CSU suppresses mutations in COP1. In vitro, it interacts with CACTIN and in vivo with CCA1. CSU4 promotes photomorphogenesis via negative regulation of CCA1 and PIF4 expression. |
AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile. |
AT1G71230 | Encodes a subunit of the COP9 complex, similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Involved in protein deneddylation. Double mutants with CSN5A are constitutively photomorphogenic (de-etiolated) and have abnormal auxin responses. |
AT4G12290 | Copper amine oxidase. Induced by ABA and involved in stomatal closure. |
AT1G31710 | Copper amine oxidase family protein;(source:Araport11) |
AT3G43670 | Copper amine oxidase family protein;(source:Araport11) |
AT2G42490 | Peroxisome-localized copper amine oxidase involved in lateral root formation. |
AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
AT1G12520 | Copper-zinc superoxide dismutase copper chaperone (delivers copper to the Cu-Zn superoxide dismutase). Localized to the chloroplast. Expressed in roots and shoots. Up-regulated in response to copper and senescence. The AtACC activates all three CuZnSOD activities located in three different subcellular compartments. Contains three domains, central, ATX-1 like and C-terminal. ATX-1 like domain essential for the copper chaperone function of AtCCS in planta. |
AT3G56940 | Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site. The mRNA is cell-to-cell mobile. |
AT1G28680 | Catalyses trans-cis isomerization and lactonization in the biosynthesis of coumarins in roots. |
AT2G47400 | CP12-1 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. The mRNA is cell-to-cell mobile. |
AT1G76560 | CP12 domain-containing protein 3;(source:Araport11) |
AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
AT5G47850 | CRINKLY4 related 4;(source:Araport11) |
AT3G01370 | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing. |
AT4G14510 | Encodes a CRM domain protein CFM3b. Homolog of CFM3a (AT3G23070). CFM3a is shown to function in the splicing of group IIB introns in chloroplasts. |
AT5G19380 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. |
AT5G12170 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. The mRNA is cell-to-cell mobile. |
AT4G36280 | Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. |
AT5G48560 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G08920 | Encodes CRY1, a flavin-type blue-light photoreceptor with ATP binding and autophosphorylation activity. Functions in perception of blue / green ratio of light. The photoreceptor may be involved in electron transport. Mutant phenotype displays a blue light-dependent inhibition of hypocotyl elongation. Photoreceptor activity requires light-induced homodimerisation of the N-terminal CNT1 domains of CRY1. Involved in blue-light induced stomatal opening. The C-terminal domain of the protein undergoes a light dependent conformational change. Also involved in response to circadian rhythm. Mutants exhibit long hypocotyl under blue light and are out of phase in their response to circadian rhythm. CRY1 is present in the nucleus and cytoplasm. Different subcellular pools of CRY1 have different functions during photomorphogenesis of Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
AT1G04400 | Blue light receptor mediating blue-light regulated cotyledon expansion and flowering time. Positive regulator of the flowering-time gene CONSTANS. This gene possesses a light-induced CNT2 N-terminal homodimerisation domain.Involved in blue-light induced stomatal opening. Involved in triggering chromatin decondensation. An 80-residue motif (NC80) is sufficient to confer CRY2's physiological function. It is proposed that the PHR domain and the C-terminal tail of the unphosphorylated CRY2 form a "closed" conformation to suppress the NC80 motif in the absence of light. In response to blue light, the C-terminal tail of CRY2 is phosphorylated and electrostatically repelled from the surface of the PHR domain to form an "open" conformation, resulting in derepression of the NC80 motif and signal transduction to trigger photomorphogenic responses. Cry2 phosphorylation and degradation both occur in the nucleus.The life-time of cry2 signaling state in situ (in planta) is about 16 min. |
AT1G32790 | RNA-binding protein, putative, similar to RNA-binding protein GB:CAB40027 GI:4539439 from (Arabidopsis thaliana).Member of a family of PAB2 binding domain proteins. |
AT5G24440 | RNA-binding protein, putative. Contains PAM2, PABC binding domain. |
AT3G14010 | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
AT4G39830 | role in the degradation of ascorbate to (mono)dehydroascorbate |
AT3G18210 | Belongs to the 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily proteins and contains an oxoglutarate/iron-dependent oxygenase domain (InterPro:IPR005123) of the prolyl 4-hydroxylase, alpha subunit subtype (P4Hc; InterPro:IPR006620), participates in epigenetic repression of flowering genes, works redundantly with ICU11 to repress several members of the MADS-box transcription factors family, during vegetative development via histone modification. |
AT2G23380 | Similar to the product of the Polycomb-group gene Enhancer of zeste. Catalytic component of the PRC2 complex.Required for stable repression of AG and AP3. Putative role in cell fate determination. Involved in the control of leaf morphogenesis. mutants exhibit curled, involute leaves. AGAMOUS and APETALA3 are ectopically expressed in the mutant. |
AT4G38100 | CURVATURE THYLAKOID 1D-like protein; involved in thylakoid membrane organization. |
AT2G39360 | Protein kinase superfamily protein;(source:Araport11) |
AT4G30140 | Member of the GDSL lipase/esterase family of proteins that functions as cutinase. Expressed in pollen and at the zone of lateral root emergence. |
AT2G32010 | Encodes an inositol polyphosphate 5?-phosphatase (5PTase). Mediating phosphoinositide signaling. Involved in establishment of foliar vein patterns. |
AT3G23490 | Encodes a cyanase that catalyzes the bicarbonate-dependent breakdown of cyanate to ammonia and bicarbonate. CYN forms a hexadecamer and is believed to be a cytosolic protein. Long-term exposure to NaCl increases CYN transcript levels. It is also expressed at higher levels in flowers relative to stems, roots, and seedlings. |
AT4G34180 | Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development. |
AT1G01340 | member of Cyclic nucleotide gated channel family |
AT4G30560 | member of Cyclic nucleotide gated channel family. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
AT5G54250 | member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent. |
AT2G46440 | Member of Cyclic nucleotide gated channel family. Positive regulator of resistance against avirulent fungal pathogen. The mRNA is cell-to-cell mobile. |
AT2G46450 | Member of Cyclic nucleotide gated channel family.Positive regulator of resistance against avirulent fungal pathogen.Suppresses the phenotype conferred by cpr22 in a dosage-dependent manner. |
AT3G48010 | member of Cyclic nucleotide gated channel family |
AT1G17330 | cGMP-activated phosphodiesterase responsible for UVA induced decrease in cGMP. |
AT1G44110 | Cyclin A1;(source:Araport11) |
AT1G80370 | Encodes a A2-type cyclin. Contributes to the fine-tuning of local proliferation during plant development. |
AT3G11520 | Encodes a B-type mitotic cyclin. |
AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
AT5G67260 | Encode CYCD3;2, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs and mediating cytokinin effects in apical growth and development. With PPD and NINJA, it plays a crucial role in leaf morphogenesis. |
AT5G65420 | Encodes a D-type cyclin CYCD4;1 that physically interacts with CDC2A and is expressed during vascular tissue development, embryogenesis, and formation of lateral root primordia. Its expression is upregulated early during germination.Involved in stomatal cell lineage proliferation in the hypocotyl. |
AT2G01905 | cyclin J18 (cycJ18) |
AT3G63120 | cyclin p1;(source:Araport11) |
AT3G21870 | cyclin p2;(source:Araport11) |
AT3G60550 | cyclin p3;(source:Araport11) |
AT1G27630 | cyclin T 1;(source:Araport11) |
AT5G63610 | significant sequence similarity to plant and animal cyclin-dependent protein kinases, and was classified as an E-type CDK with a SPTAIRE cyclin binding motif in the kinase domain. |
AT5G63370 | CDKG1 interacts with the splicing factor RSZ33 to regulate proper splicing of Cals5 Pre-mRNA. |
AT5G62430 | Dof-type zinc finger domain-containing protein, similar to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Represses expression of Constans (CO), a circadian regulator of flowering time. Interacts with LKP2 and FKF1. Expression oscillates under constant light conditions. Mainly expressed in the vasculature of cotyledons, leaves and hypocotyls, but also in stomata. Localized to the nucleus and acts as a repressor of CONSTANS through binding to the Dof binding sites in the CO promoter. Protein gets degraded by FKF1 in the afternoon. CDF1 binds to the TOPLESS co-repressor protein through an N-terminal motif which is conserved across CDF-like proteins throughout land-plants. This interaction is important for the repression of CO and FT genes during the morning. Loss of CDF1 dependent repression through omission of TPL coordinating residues or through the loss of TPL function in phloem companion cells results in early flowering due to an up regulation of FT. |
AT5G39660 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
AT3G47500 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
AT1G69570 | CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572).CDF5 transcript accumulation delays flowering. CDF5 links circadian oscillation and photoperiodism. |
AT1G26790 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT2G07050 | Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol. |
AT3G01480 | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. The mRNA is cell-to-cell mobile. |
AT1G53720 | Encodes a cyclophilin, member of a family modular proteins consisting of a peptidyl-prolyl cis? trans isomerase (PPIase) domain, followed by an RNA recognition motif (RRM), and a C-terminal domain enriched in charged amino acids. Interacts with with SCL33/SR33 and with a majority of Arabidopsis SR proteins and the largest subunit of RNA polymerase II. Localizes to the nucleus, but it does not significantly colocalize with SR proteins in nuclear speckles. |
AT1G66160 | CYS, MET, PRO, and GLY protein 1;(source:Araport11) |
AT5G64660 | CYS, MET, PRO, and GLY protein 2;(source:Araport11) |
AT2G40880 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). The mRNA is cell-to-cell mobile. |
AT3G48350 | Involved in starvation-related responses that curtail primary root growth under severe nutrient limitation. |
AT5G47550 | Putative phytocystatin expressed in seedlings and induced by heat stress and abscisic acid. Overexpression increases germination rate and heat stress tolerance. CYS5 is a target of ABF1 and ABF3 transcriptional regulators which bind to its promoter. |
AT4G36880 | cysteine proteinase1;(source:Araport11) |
AT3G03630 | Encodes a protein that possesses S-sulfocysteine synthase activity and lacks O-acetylserien(thiol)lyase activity. |
AT3G61440 | Encodes a cysteine synthase isomer CysC1. The isomer is however less effective in cysteine biosynthesis. It is involved in beta-cyanoalanine biosynthesis, an intermediate of cyanide detoxification pathway. The mRNA is cell-to-cell mobile. |
AT4G23190 | Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria, Ralstonia solanacearum. Naming convention from Chen et al 2003 (PMID 14756307) |
AT4G23260 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23270 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
AT4G38830 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G21410 | Encodes a cysteine-rich receptor-like protein kinase. |
AT1G70530 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G04490 | Encodes a cysteine-rich receptor-like protein kinase. |
AT1G70520 | Encodes a cysteine-rich receptor-like protein kinase located to the plasma membrane. Involved in regulating microbe-associated molecular pattern-triggered ROS production and stress induced callose deposition at the plasmodesmata in roots. Required for MAMP-triggered responses and resistance to Pseudomonas syringae pv. tomato 118 DC3000 . |
AT1G05340 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT4G33660 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT2G32190 | cysteine-rich/transmembrane domain A-like protein;(source:Araport11) |
AT2G32200 | cysteine-rich/transmembrane domain A-like protein;(source:Araport11) |
AT2G19570 | Encodes a cytidine deaminase that deaminates cytidine and deoxycytidine and is competitively inhibited by cytosine-containing compounds. |
AT2G32720 | Participates with ELO2 in VLCFA synthesis. |
AT1G60660 | member of Cytochromes b5 |
AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
AT1G69750 | cytochrome c oxidase 19-2;(source:Araport11) |
AT1G22840 | Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers. Double mutants with CYTC-2 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
AT4G10040 | Encodes cytochrome c. Promoter directs preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and in anthers. Double mutants with CYTC-1 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
AT2G24180 | Encodes a cytochrome P450 monooxygenase that converts indole-3-acetonitrile to indole-3-aldehyde / indole-3-carboxylic acid and cyanide. The mRNA is cell-to-cell mobile. |
AT1G17060 | Encodes a protein with similarity to other cytochrome P450's and is a homolog of BAS1. Over expression causes a dwarf phenotype resembling brassinolide resistant mutants. Double mutant analysis of sob7/bas1 loss of function mutants suggests these genes have redundant functions in light responsiveness. SOB7 may function in metabolizing brassinolides. Expressed in leaf, root, stem and silique but expression highest in flower and cauline leaves. Dominant overexpressing plants have dwarf phenotype, short siliques/seeds, rounded dark green leaves and short hypocotyls in light and dark. Loss of function alleles result in plants with long hypocotyls. |
AT5G04330 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT1G65670 | a member of the cytochrome P450 gene family. molecular function unknown. |
AT4G15393 | a member of the cytochrome P450 gene family. molecular function unknown. |
AT4G15396 | cytochrome P450, family 702, subfamily A, polypeptide 6;(source:Araport11) |
AT1G69500 | Encodes a cytochrome P450, designated CYP704B1. Expressed in the developing anthers. Essential for pollen exine development. Mutations in CYP704B1 result in impaired pollen walls that lack a normal exine layer and exhibit a characteristic striped surface, termed zebra phenotype. Heterologous expression of CYP704B1 in yeast cells demonstrated that it catalyzes omega-hydroxylation of long-chain fatty acids, implicating these molecules in sporopollenin synthesis. |
AT4G12300 | member of CYP706A |
AT4G12310 | member of CYP706A |
AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
AT2G29090 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. This gene predominantly accumulates in dry seeds and is up-regulated immediately following imbibition. CYP707A2 appears to play a major role in the rapid decrease in ABA levels during early seed imbibition. |
AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
AT4G27710 | member of CYP709B The mRNA is cell-to-cell mobile. |
AT1G13110 | member of CYP71B The mRNA is cell-to-cell mobile. |
AT5G25120 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT5G25130 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT5G25140 | putative cytochrome P450 |
AT3G26170 | putative cytochrome P450 |
AT1G13080 | cytochrome P450 monooxygenase |
AT3G26180 | putative cytochrome P450 |
AT3G26190 | putative cytochrome P450 |
AT3G26200 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT3G26210 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT3G26230 | putative cytochrome P450 |
AT3G26290 | putative cytochrome P450 |
AT1G13090 | putative cytochrome P450 |
AT1G13100 | putative cytochrome P450 |
AT3G26220 | cytochrome P450 monooxygenase |
AT3G26300 | putative cytochrome P450 |
AT3G26310 | putative cytochrome P450 |
AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
AT2G34490 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze the conversion of both 24-epi-campesterol and β-sitosterol to brassicasterol and stigmasterol, respectively, in the presence of NADPH. |
AT2G26170 | Encodes a protein with similarity to thromboxane-A synthase, member of the CYP711A cytochrome P450 family. MAX1 is a specific repressor of vegetative axillary buds generated by the axillary meristem. Expressed in vascular traces in the rosette stem and axillary buds throughout plant development. Mutants have increased axillary branches. Along with MAX3,4 thought to mediate control of shoot branching via synthesis of a signal molecule which is transported over long distance mediated by MAX2. cDNA supports the existence of the longer transcript predicted for this locus, no cDNA isolated for shorter transcript. MAX1 downregulates 11 genes involved in flavonoid pathway (CHS, CHI, F3H, F3'H, FLS, DFR, ANS, UFGT, RT, AAC and GST). |
AT5G24910 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
AT3G14640 | putative cytochrome P450 |
AT3G14650 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT3G14660 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT3G14680 | putative cytochrome P450 |
AT3G14690 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT3G14610 | putative cytochrome P450 |
AT3G10570 | member of CYP77A |
AT2G46660 | Encodes a member of CYP78A cytochrome P450 monooxygenase protein family that is required in the sporophytic tissue of the mother plant to promote seed growth. |
AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
AT1G79370 | member of CYP79C |
AT4G37340 | member of CYP81D |
AT4G37330 | member of CYP81D |
AT4G37320 | member of CYP81D |
AT5G67310 | member of CYP81G |
AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
AT4G00360 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems. |
AT1G01600 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly at highest level in mature stems and flowers. |
AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
AT1G13140 | member of CYP86C |
AT3G03470 | P450 monooxygenase CYP89A9. Involved in NDCC accumulation during Arabidopsis leaf senescence. |
AT1G64900 | Encodes cytochrome P450 (CYP89A2). The mRNA is cell-to-cell mobile. |
AT1G64950 | member of CYP89A The mRNA is cell-to-cell mobile. |
AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
AT3G48520 | CYP94B3 is a jasmonoyl-isoleucine-12-hydroxylase that catalyzes the formation of 12-OH-JA-Ile from JA-Ile. By reducing the levels of this the biologically active phytohormone, CYP94B3 attenuates the jasmonic acid signaling cascade. CYP94B3 transcript levels rise in response to wounding. |
AT4G39510 | member of CYP96A |
AT1G31800 | Encodes a protein with β-ring carotenoid hydroxylase activity. The mRNA is cell-to-cell mobile. |
AT2G40890 | encodes coumarate 3-hydroxylase (C3H), a P450-dependent monooxygenase. Involved in lignin biosynthesis and flavonoid biosynthesis. Also affects the biosynthesis of coumarins such as scopoletin and scopolin as a branching-out-pathway from the phenylpropanoid acid level. |
AT2G39770 | Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. This enzyme provides GDP-mannose, which is used for cell wall carbohydrate biosynthesis and protein glycosylation as well as for ascorbate (vitamin C) biosynthesis. Mutations in this gene confer hypersensitivity to NH4+. |
AT1G75450 | This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
AT3G63440 | This gene used to be called AtCKX7. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
AT4G11140 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT1G25470 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT4G27950 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT2G46310 | CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
AT3G61630 | CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
AT3G44326 | Cytokinin induced F-Box protein. Forms a unique F-Box family with AT2G27310 and AT2G36090. It is primarily expressed in the root. |
AT4G26150 | Encodes a member of the GATA factor family of zinc finger transcription factors. Modulate chlorophyll biosynthesis and glutamate synthase (GLU1/Fd-GOGAT) expression. |
AT1G35580 | CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9. |
AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
AT1G65930 | Encodes a NADP+-isocitrate dehydrogenase that is believed to function in the cytosol. It appears to contribute to NADPH production under oxidative stress, and thereby to participate in redox signalling linked to defense responses. The mRNA is cell-to-cell mobile. |
AT1G04270 | Encodes cytosolic ribosomal protein S15. |
AT1G04410 | predicted to encode a cytosolic malate dehydrogenase. |
AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
AT4G36400 | Encodes a (D)-2-hydroxyglutarate dehydrogenase. |
AT3G51370 | Protein phosphatase 2C family protein;(source:Araport11) |
AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
AT5G55910 | Member of AGC VIIIa Kinase family. D6PK is a protein kinase involved that plays a role in polar auxin transport. Most likely acts redundantly with the related proteins: D6PKL1,D6PKL2,and D6PKL3. PIN1 is a target of D6PK phosphorylation. D6PK is associated with sterol enriched membrane rafts and may be involved in regulation of the switch from basal to planar polarity during root hair initiation. Involved in pulse-induced phototropism but also for time-dependent second positive phototropism. Works with PIN3 in the same genetic pathway of hypocotyl phototropism under all light conditions. Involved in the generation of auxin asymmetrical distribution induced by phototropic stimulation. |
AT1G78420 | Activates the latent peptidases DA1, DAR1 and DAR2 by mono-ubiquitination at multiple sites. Subsequently, these activated peptidases destabilize various positive regulators of growth. |
AT4G36860 | DAR1 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. |
AT5G66640 | DA1-related protein 3;(source:Araport11) |
AT5G66620 | DA1-related protein 6;(source:Araport11) |
AT5G66610 | DA1-related protein 7;(source:Araport11) |
AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
AT3G10910 | RING/U-box superfamily protein;(source:Araport11) |
AT5G01880 | RING/U-box superfamily protein;(source:Araport11) |
AT5G58760 | Encodes a DDB1a interacting protein DDB2 required for UV-B tolerance and genomic integrity. |
AT4G05420 | Structurally similar to damaged DNA binding proteins. DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis. DDB1a is shown to be RUB-modified. |
AT3G60140 | Encodes a protein similar to beta-glucosidase and is a member of glycoside hydrolase family 1. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
AT3G13450 | branched chain alpha-keto acid dehydrogenase E1 beta |
AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
AT3G20550 | Encodes a nuclear localized FHA (forhkead) domain containing protein.Mutant plants have shortened roots, delayed flowering time, altered floral organ number, defective floral organs and reduced fertility.Ddl mutants also show reduced levels of pri-miRNAs as well as mature miRNAs suggesting involvement in biogenesis of miRNAs. DDL does not affect transcription of miRNAs directly but may act through other proteins such as DCL. |
AT3G42170 | transposase-like gene with conserved domains from the family of hAT transposases that includes hobo from Drosophila melanogaster, Activator (Ac) from maize, and Tam3 from snapdragon but lacks several amino acids known to be essential for Ac transposition5. The DAYSLEEPER gene lacks 8 bp duplications and TIRs (a common feature of transcriptionally silent hAT transposases), however, DAYSLEEPER expression was detected, and several expressed sequence tags are available. The expression seems to be under the control of factors determining the circadian rhythm. DAYSLEEPER was isolated as a factor binding to a motif (Kubox1) present in the upstream region of the Arabidopsis DNA repair gene Ku70. Mutant plants lacking DAYSLEEPER or strongly overexpressing this gene do not develop in a normal manner. |
AT5G03210 | Encodes a small polypeptide contributing to resistance to potyvirus. |
AT5G22760 | PHD finger family protein;(source:Araport11) |
AT4G31770 | Encodes a RNA lariat debranching enzyme required for embryogenesis. |
AT5G13570 | Encodes DCP2 with mRNA decapping activity. DCP2 forms a mRNA decapping complex with DCP1 (At1g08370) and VCS (VARICOSE) (At3g13300). Recombinant DCP2 is enzymatically active in vitro, generating from capped mRNAs m7GDP, and 5?-phosphorylated mRNAs. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. The protein was shown by immunoprecipitation not to interact with DCP1. |
AT5G61590 | Encodes an AP2/ERF-type transcription factor that is preferentially expressed in the epidermis and induced by darkness and negatively regulates cuticular wax biosynthesis. |
AT1G72490 | DRO1 is a member of the IGT gene family and has a unknown function . It is expressed in roots and involved in leaf root architecture, specifically the orientation of lateral root angles. Involved in determining lateral root branch angle. |
AT2G44810 | Mutant has defects in anther dehiscence, pollen maturation, and flower opening. The DAD1 protein is a chloroplastic phospholipase A1 that catalyzes the initial step of jasmonic acid biosynthesis. |
AT4G33400 | Together with DEM2 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
AT5G66680 | Encodes a protein ortholog of human SOT48 or yeast WBP1, an essential protein subunit of the oligosaccharyltransferase (OST) complex, which is responsible for the transfer in the ER of the N-linked glycan precursor onto Asn residues of candidate proteins. |
AT1G19100 | Encodes a member of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing. |
AT5G26940 | Encodes a Mg2+-dependent DNA exonuclease that degrades organelle DNA during Arabidopsis pollen development. |
AT1G55350 | Similar to maize DEK1, a gene encoding a membrane protein of the calpain gene superfamily required for aleurone cell development in the endosperm of maize grains. A key component of the embryonic L1 cell-layer specification pathway. It localizes to membranes and undergoes intramolecular autolytic cleavage events that release the calpain domain into the cytoplasm. |
AT1G32210 | Encodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation. |
AT5G15410 | 'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens. CNGC2 could be the key step mediating bulk Ca2+ influx into leaf cells after unloading from the vascular and have no direct roles in the leaf development and HR. |
AT1G13870 | Encodes a homolog of the yeast TOT4/KTI12 protein. Yeast TOT4/KTI12 associates with Elongator, a multisubunit complex that binds the RNA polymerase II transcription elongation complex. Ds insertion mutant has enlarged shoot apical region, 4 to 6 long slender leaves followed by spike-like structures, short roots. Mutants also have no ncm5U (5-carbamoylmethyluridine). |
AT3G16550 | Encodes a putative DegP protease. |
AT5G54745 | Trypsin family protein;(source:Araport11) |
AT2G47940 | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. |
AT4G18370 | Encodes DEG5. Forms a hexamer with DEG8 in the thylakoid lumen. Involved in the cleavage of photodamaged D2 protein of photosystem II (PSII). |
AT5G45380 | urea-proton symporter DEGRADATION OF UREA 3 (DUR3);(source:Araport11) |
AT4G25480 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
AT2G38340 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
AT1G54410 | Encodes a KS-type dehydrin can reduce the formation of reactive oxygen species (ROS) from Cu. |
AT3G50980 | dehydrin xero 1;(source:Araport11) |
AT5G45830 | Encodes DOG1 (DELAY OF GERMINATION 1). A quantitative trait locus involved in the control of seed dormancy. Belongs to a novel plant-specific gene family whose members include: DOG1-like 1-4 (DOGL1-4, At4g18660, At4g18680, At4g18690, At4g18650 respectively) and DOG1. DOG1 expression is seed-specific. |
AT3G12930 | Encodes a novel conserved chloroplast protein that interacts with components of the PEP complex. Mutants show delayed greening and reduced photosynthetic capcity. |
AT3G55610 | encodes delta 1-pyrroline-5-carboxylate synthetase B. Gene expression is induced by dehydration, high salt and ABA. Knock-out mutations in P5CS2 are embryo-lethal. P5CS2 appears to be present in different cells and/or different subcellular locations from P5CS1 in a tissue-dependent manner. Mutants are defective in pollen development. |
AT3G16240 | Delta tonoplast intrinsic protein, functions as a water channel and ammonium (NH3) transporter. Highly expressed in flower, shoot, and stem. Expression shows diurnal regulation and is induced by ammonium (NH3). Protein localized to vacuolar membrane. The mRNA is cell-to-cell mobile. |
AT3G20210 | Encodes a vacuolar processing enzyme with caspase-1-like activity that is specifically expressed in inner integument of developing seeds. Mutants display abnormal seed coat development. It is speculated to be involved in cell death of limited cell layers, the purpose of which is to form a seed coat. |
AT1G65520 | encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
AT5G04560 | Encodes a DNA glycosylase DEMETER (DME). Responsible for endosperm maternal-allele-specific hypomethylation at the MEDEA (MEA) gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele. |
AT5G05920 | Encodes a deoxyhypusine synthase. |
AT1G72040 | Encodes a multisubstrate deoxyribonucleoside kinase that salvages DNA precursors. |
AT4G29330 | DERLIN-1;(source:Araport11) |
AT1G07645 | Ortholog of HC205/ Xhdsi-1voc from Xerophyta humilis. Member of VOC metalloenzyme superfamily. Not involved in response to abiotic stress, unlike its Xerophyta ortholog. |
AT5G41560 | Encodes a substrate receptor for CRL4-CDD complexes that provides substrate specificity for CRL4 by interacting with ubiquitination targets. By its interaction and regulation of levels of PYL8 through proteasomal degradation, it negatively regulates ABA-mediated developmental responses, including inhibition of seed germination, seedling establishment, and root growth |
AT5G38030 | MATE transporter involved in auxin homeostasis in roots. |
AT3G23637 | Member of a family of small polypeptides found only in angiosperm lineages.Contains a conserved 29 amino acid domain (RTF or DVL domain). |
AT5G05980 | Encodes one of the three folylpolyglutamate synthetase isoforms (FPGSs): FPGS1 (At5g05980, plastidic), FPGS2 (At3g10160, mitochondrial) and FPGS3 (At3g55630, cytosolic). |
AT3G55630 | Encodes one of the three folylpolyglutamate synthetase isoforms (FPGSs): FPGS1 (At5g05980, plastidic), FPGS2 (At3g10160, mitochondrial) and FPGS3 (At3g55630, cytosolic). |
AT1G48320 | Encodes one of the two functional DHNA-CoA (1,4-dihydroxy-2-naphthoyl-CoA) thioesterases found in Arabidopsis. |
AT1G48300 | Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity). |
AT5G63770 | a member of the diacylglycerol kinase gene family. Encodes a functional diacylglycerol kinase. Involved in root elongation and plant development. Gene expression is induced by wounding or cold. |
AT2G18730 | diacylglycerol kinase 3;(source:Araport11) |
AT2G20900 | diacylglycerol kinase 5;(source:Araport11) |
AT4G30340 | encodes a diacylglycerol kinase. Applying a specific diacylglycerol kinase inhibitor to the growth media resulted in reduced root elongation and plant growth. Gene is expressed throughout the plant but is strongest in flowers and young seedlings. |
AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
AT4G24570 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). The mRNA is cell-to-cell mobile. |
AT5G12860 | AtpOMT1 encodes dicarboxylate transporter functions both as as an oxaloacetate/malate transporter and as a 2-oxoglutarate/malate transporter. |
AT3G11670 | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE). |
AT2G45440 | Encodes a protein that likely has dihydropicolinate synthase activity based on its mutant phenotype of decreased lysine levels and increased aspartate levels. The mutant also has increased levels of threonine. The enzyme is predicted to localize to the chloroplast. |
AT5G42800 | dihydroflavonol reductase. Catalyzes the conversion of dihydroquercetin to leucocyanidin in the biosynthesis of anthocyanins. Not expressed in roots (qRT-PCR). The mRNA is cell-to-cell mobile. |
AT1G27980 | Encodes an ER-localized sphingoid long-chain base-1-phosphate lyase involved in the dehydration stress response. |
AT4G23690 | Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
AT2G45180 | nsLTP family-related gene. Expression is strongly suppressed by bacterial pathogens. Mutants are more susceptible to pathogens and abiotic stressors suggesting a function in basal stress response. |
AT5G64860 | Encodes a maltotriose-metabolizing enzyme with chloroplastic α-1,4-glucanotransferase activity. Mutant has altered starch degradation. |
AT2G40840 | Encodes a cytosolic protein with transglucosidase and amylomaltase activity. It is an essential component of the pathway from starch to sucrose and cellular metabolism in leaves at night. The protein binds to heteroglycans and utilizes glucose, mannose and xylose as acceptors. Fucose and galactose can also act as acceptors but less efficiently than the previous three. It was also was also recently reported to act on maltodextrins. On the other hand, arabinose and fructose were not efficiently used. Its role probably includes metabolizing maltose exported from the chloroplast. Studies using maltose extracted from the double mutant be2-1 be3-2 showed that this enzyme is preferentially active of β-maltose. The mRNA is cell-to-cell mobile. |
AT5G58900 | R-R-type MYB protein |
AT5G04760 | R-R-type MYB protein which plays negative roles in salt stress and is required for ABA signaling in Arabidopsis. |
AT3G14990 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. The mRNA is cell-to-cell mobile. |
AT4G34020 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. |
AT1G80030 | Molecular chaperone Hsp40/DnaJ family protein;(source:Araport11) |
AT2G17880 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G13310 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G23240 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT2G42750 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT3G05345 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G08130 | Encodes the Arabidopsis DNA ligase 1 that provides the major DNA ligase activity in cells and plays a key role in both DNA replication and excision repair pathways. In addition, it is an important component of the active DNA demethylation machinery and is indispensable for cell viability. AtLIG1 expresses one major and two minor mRNA transcripts differing only in the length of the 5' untranslated leader sequences preceding a common ORF. Translation from the first in-frame start codon produces an AtLIG1 isoform that is targeted exclusively to the mitochondria. Translation initiation from the second in-frame start codon produces an AtLIG1 isoform targeted only to the nucleus. |
AT1G66730 | Encodes a novel plant specific DNA ligase that is involved in seed germination and DNA repair. |
AT2G25620 | Encodes DBP1, a member of the DBP factors (DNA-binding protein phosphatases) featuring sequence-specific DNA-binding and protein phosphatase activity. DBP1 is involved in plant-potyvirus interactions. Loss-of-function of DBP1 renders resistance to potyviruses. Negatively regulates drought and salt tolerance through altering leaf surface permeability. |
AT1G20340 | recombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis. Mutation of this gene does not have obvious effect on photosynthesis. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. |
AT2G46590 | Encodes a protein containing Dof zinc finger motifs that is a positive regulator of light-mediated seed germination. Its expression is limited to vascular system of the mother plant. A recessive mutation is inherited as maternal-effect and expression is not detected in the embryo. Mutants are defective in seed germination and are more dependent on light and cold treatment and less sensitive to gibberellin during seed germination. It plays its main role downstream of PIL5 and DAG1 in the phytochrome B (phyB)-mediated pathway. |
AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
AT3G21270 | Encodes Dof zinc finger protein adof2. |
AT3G45040 | Encodes a putative dolichol kinase that is localized to the endoplasmic reticulum and involved in pollen tube reception in the female gametophyte. |
AT3G19800 | Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence. |
AT5G23800 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
AT2G47220 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
AT2G47230 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. |
AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
AT5G23770 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
AT2G36800 | Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype. |
AT2G33830 | Negative regulator of local and systemic acquired resistance; target of FLD for activation of SAR. |
AT1G28330 | dormancy-associated protein (DRM1) |
AT4G25670 | stress response NST1-like protein;(source:Araport11) |
AT4G22470 | Encodes a hybrid proline-rich protein that contains two tandem PRD-8CMs (proline-rich domain-eight cysteine motif) that is involved in systemic acquired resistance. |
AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
AT1G79760 | Identified as target of the AGL15 binding motif CArG. |
AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
AT1G59660 | Encodes a protein with similarity to mammalian nucleoporin Nup98.Its expression is upregulated in mutants that are NUP deficient. Nucleoportin which redundantly inhibits flowering together with Nup98a through multiple pathways including clock, photoperiod, and age pathways. Gates flowering in a CONSTANS (CO)-independent mode and bypasses the CO checkpoint in photoperiodic signaling and integrated signals from multiple pathways to directly target FLOWERING LOCUS T (FT) for flowering control. |
AT5G05410 | Encodes a transcription factor that specifically binds to DRE/CRT cis elements (responsive to drought and low-temperature stress). Belongs to the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2A). There are eight members in this subfamily including DREB2B. The protein contains one AP2 domain. Overexpression of transcriptional activation domain of DREB2A resulted in significant drought stress tolerance but only slight freezing tolerance in transgenic Arabidopsis plants. Microarray and RNA gel blot analyses revealed that DREB2A regulates expression of many water stress?inducible genes. The mRNA is cell-to-cell mobile. |
AT5G67190 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT2G23340 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT2G30580 | Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. DRIP2 seems to be involved in regulating stress-related transcriptional changes and drought tolerance. |
AT5G17460 | glutamyl-tRNA (Gln) amidotransferase subunit C;(source:Araport11) |
AT3G05700 | Encodes a DNA binding protein with transcription activation activity. It is expressed in response to osmotic, drought and ABA stress. |
AT3G26932 | dsRNA-binding protein 3;(source:Araport11) |
AT5G45010 | Member of the intrinsically disordered protein family, interacts with different protein partners forming complexes involved in diverse biological mechanisms such as DNA repair, regulation of protein homeostasis, mRNA export. Role in the post-translational protein modification named DSSylation. Involved in molecular mechanisms underlying plant abiotic stress responses. |
AT3G23610 | Encodes a dual specificity protein phosphatase whose activity is modulated by CaM binding. |
AT4G17505 | carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11) |
AT5G03390 | hypothetical protein (DUF295);(source:Araport11) |
AT5G67040 | F-box protein, putative (DUF295);(source:Araport11) |
AT5G25460 | Encodes a DUF642 cell wall protein. |
AT4G24310 | transmembrane protein, putative (DUF679);(source:Araport11) |
AT5G46090 | transmembrane protein, putative (DUF679);(source:Araport11) |
AT5G02390 | Target promoter of the male germline-specific transcription factor DUO1. |
AT4G35700 | Target promoter of the male germline-specific transcription factor DUO1. |
AT3G19820 | Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to campesterol. Brassinosteroids affect cellular elongation. Mutants have dwarf phenotype. DWF1 is a Ca2+-dependent calmodulin-binding protein. |
AT3G03990 | Encodes an alpha/beta hydrolase essential for strigolactone signaling. Degradation of the protein is promoted by strigolactone. The mRNA is cell-to-cell mobile. |
AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
AT1G50430 | Mutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype. EXO70 interactor and presumed negative secretion regulator. |
AT1G12610 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in delayed flowering and dwarfism, reduction of gibberellic acid biosynthesis, and increased tolerance to high levels of salt. This gene is expressed in all tissues examined, but most abundantly expressed in upper stems. Overexpression of this gene is also correlated with increased expression of GA biosynthetic genes and RD29A (a cold and drought responsive gene). Under salt stress it induces the expression of GAOX7, which encodes ad C20-GA inhibitor. |
AT1G63030 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in the reduction of gibberellic acid biosynthesis. This gene is expressed in all tissues examined, but most abundantly expressed in rosette leaves and stems. Overexpression of DDF1, a putative paralog of this gene, also reduces gibberellic acid biosynthesis and makes the plants more tolerant to high-salinity levels. |
AT4G03400 | Encodes a GH3-related gene involved in red light-specific hypocotyl elongation. Analysis of sense and antisense transgenic plants suggests that DFL2 is located downstream of red light signal transduction and determines the degree of hypocotyl elongation. |
AT1G61210 | DWA3 encodes a DWD(DDB1 binding WD40) protein. Invitro analyses suggest its involvement in the negative regulation of ABA responses.One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
AT4G17620 | NAD-RNA decapping enzyme.Mediates the connection between RNA turnover and retrograde chloroplast-to-nucleus signaling. Catalyzes the hydrolysis of RNAs bearing a 5 -hydroxyl group (5-OH RNA). |
AT3G61760 | DYNAMIN-like 1B;(source:Araport11) |
AT3G60190 | At3g60190 encodes Arabidopsis dynamin-related protein 1E, DRP1E, also known as EDR3, ADL4 and ADL1E, which is 624 amino acid residues long, has a predicted mass of 69.8 kDa and a pI of 7.5. Dynamin-related protein 1E belongs to a plant-specific subclass of dynamin-related proteins (DRP1), consisting of five members in Arabidopsis (A, B, C, D, E). This class is characterized by having an N-terminal GTPase domain, a central `dynamin 2` domain and a C-terminal GTPase effector domain (GED), a typical structure for plant dynamin-related proteins. However, this class lacks a PH domain and a proline-rich domain, which are found in classical animal dynamin-like proteins. Based on work on animal dynamins, the plant DRP1 proteins should be able to form polymeric structures that wrap around membranes to facilitate membrane tubulation and pinching off of vesicles, processes that are essential to vesicle trafficking and membrane compartmentalization. The edr3 mutation causes a P77L substitution in the G2 motif of the GTPase domain of DRP1E. edr3 mutant Arabidopsis plants display enhanced cell death in response to powdery mildew infection. |
AT5G42080 | Encodes a dynamin-like protein related to phragmoplastin. Mutations in this gene, in combination with mutation in ADL1E, result in defects in embryogenesis, cell plate formation and trichome branching. Also controls vascular patterning in combination with VAN3 and GNOM. DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosis. |
AT3G05640 | EGR1 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress.EGR1 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
AT5G27930 | EGR2 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress. EGR2 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
AT3G16800 | EGR3 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress, EGR3 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
AT2G40080 | Encodes a novel nuclear 111 amino-acid phytochrome-regulated component of a negative feedback loop involving the circadian clock central oscillator components CCA1 and LHY. ELF4 is necessary for light-induced expression of both CCA1 and LHY, and conversely, CCA1 and LHY act negatively on light-induced ELF4 expression. ELF4 promotes clock accuracy and is required for sustained rhythms in the absence of daily light/dark cycles. It is involved in the phyB-mediated constant red light induced seedling de-etiolation process and may function to coregulate the expression of a subset of phyB-regulated genes. |
AT5G62640 | nuclear targeted protein involved in flowering time regulation that affects flowering time independent of FLC |
AT5G04240 | Early Flowering 6 (ELF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a repressor in the photoperiod pathway. ELF6 interacts with BES1 in a Y2H assay, in vitro, and in Arabidosis protoplasts (based on BiFC). ELF6 may play a role in brassinosteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. |
AT3G22840 | Encodes an early light-inducible protein. |
AT5G15350 | early nodulin-like protein 17;(source:Araport11) |
AT1G08500 | early nodulin-like protein 18;(source:Araport11) |
AT4G27520 | early nodulin-like protein 2;(source:Araport11) |
AT4G28365 | early nodulin-like protein 3;(source:Araport11) |
AT1G76180 | Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. This gene's expression to cold occurs in two waves, with early induction occurring within 1 h and secondary induction occurring 5 h after the beginning of cold stress. Expression is also induced in response to ABA but not in response to 2,4-D, BA, and GA3. ERD14 protein is capable of binding Ca2+, especially when the protein is phosphorylated. |
AT5G51070 | ATP-dependent Clp protease regulatory subunit The mRNA is cell-to-cell mobile. |
AT1G20450 | Encodes a gene induced by low temperature and dehydration. Inhibits e.coli growth while overexpressed. Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer cold tolerance. Localized to membranes and cytoplasm. |
AT2G41430 | Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2. |
AT3G30775 | Encodes a proline oxidase that is predicted to localize to the inner mitochondrial membrane, its mRNA expression induced by high levels of Al and by osmotic stress. The promoter contains an L-proline-inducible element. |
AT1G18330 | EARLY-PHYTOCHROME-RESPONSIVE1 |
AT4G19120 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G30360 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
AT1G02205 | Expression of the CER1 gene associated with production of stem epicuticular wax and pollen fertility. Biochemical studies showed that cer1 mutants are blocked in the conversion of stem wax C30 aldehydes to C29 alkanes, and they also lack the secondary alcohols and ketones. These suggested the CER1 protein is an aldehyde decarbonylase, but the exact molecular function of this protein remains to be determined. |
AT3G55360 | Enoyl-CoA reductase is involved in all very long chain fatty acids (VLCFA) elongation reactions that are required for cuticular wax, storage lipid and sphingolipid metabolism. The protein is located in the ER, but in contrast to its yeast homolog TSC13 is not particularly enriched in the nuclear envelope-vacuole junction. Mutants in this gene show abnormal organ morphology and stem glossiness. Cells in all tissues are only about 1/3 of the size of wild type cells. The morphological changes are most likely to result from the reduction in the VLCFA content of sphingolipids. Mutants also show abnormalities in the endocytic membrane organization and transport as well as reduced trichome papillae. |
AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
AT5G57800 | encodes a transmembrane protein with similarity to the sterol desaturase family at the N-terminus and to the short-chain dehydrogenase/reductase family at the C-terminus. Mutant analyses indicate this protein is involved in cuticle membrane and wax biosynthesis. The mRNA is cell-to-cell mobile. |
AT4G34100 | Encodes a putative E3 ubiquitin ligase that is involved in cuticular wax biosynthesis and regulates 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) activity. HMGR catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. Lines carrying a recessive mutation in this locus have reduced chain-length distribution, weakly glaucous stem surface, and has reduced fertility in early flowers, non-spreading floret, downward cupped leaves, leaf waxes nearly pure C24 and C26 acid. |
AT1G02190 | Fatty acid hydroxylase superfamily;(source:Araport11) |
AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation. |
AT5G15440 | EID1-like 1;(source:Araport11) |
AT5G39360 | EID1-like 2;(source:Araport11) |
AT3G63060 | EDL3 is an F-box protein involved that mediated the regulation of abscisic acid signalling. |
AT1G54270 | member of eIF4A - eukaryotic initiation factor 4A |
AT4G24800 | MA3 domain-containing protein;(source:Araport11) |
AT3G18910 | EIN2 targeting protein2;(source:Araport11) |
AT2G25490 | Encodes an F-box protein involved in the ubiquitin/proteasome-dependent proteolysis of EIN3. The mRNA is cell-to-cell mobile. |
AT5G25350 | Arabidopsis thaliana EIN3-binding F-box protein 2 (EBF2) mRNA. Part of the SCF complex, it is located in the nucleus and is involved in the ethylene-response pathway. |
AT1G50940 | Encodes the electron transfer flavoprotein ETF alpha, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF beta is At5g43430.1) in Arabidopsis. Mutations of the ETF beta gene results in accelerated senescence and early death compared to wild-type during extended darkness. |
AT2G43400 | Encodes a unique electron-transfer flavoprotein:ubiquinone oxidoreductase that is localized to the mitochondrion. Mutants are more sensitive to sugar starvation when plants are kept in the dark for long periods. |
AT2G29950 | Member of a small family of proteins containing DUF1313 domain. Involved in flowering time. |
AT1G72630 | ELF4-like 2;(source:Araport11) |
AT1G17455 | ELF4-like 4;(source:Araport11) |
AT3G11220 | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. |
AT5G11260 | Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels. |
AT4G26300 | Arginyl-tRNA synthetase, class Ic;(source:Araport11) |
AT1G79350 | Encodes the Arabidopsis thaliana orthologue of metazoan Strawberry notch, a highly conserved co-activator of the developmental regulator Notch. It mediates stress-induced chromatin memory by modulating nucleosome occupancy by interacting with chromatin remodeling proteins of the ISWI and SWI/SNF classes. |
AT2G26830 | Encodes a member of a small family of choline/ethanolamine kinases that is localized to the plasma membrane. Homozygous loss of function alleles are embryo lethal. Overexpression results in altered phospholipid levels suggesting a critical role in phospholipid biosynthesis. |
AT4G23250 | cysteine-rich receptor-like protein kinase 17;(source:Araport11) |
AT1G56200 | Encodes a chloroplast localized protein that is essential for chloroplast development. |
AT1G78630 | Ribosomal protein L13 family protein;(source:Araport11) |
AT1G20960 | Similar to DEAD/DExH box ATP-dependent RNA helicase . Required for proper splicing of FLC. Mutants have reduced FLC levels and are early flowering. |
AT5G27720 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT1G58210 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the plasma membrane. |
AT1G76060 | CIAF1 mitochondrial protein required for assembly of the 1000-kD complex I holoenzyme. |
AT5G08170 | porphyromonas-type peptidyl-arginine deiminase family protein;(source:Araport11) |
AT1G21690 | ATPase family associated with various cellular activities (AAA);(source:Araport11) |
AT3G07060 | NHL domain-containing protein;(source:Araport11) |
AT2G22870 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G10510 | RNI-like superfamily protein;(source:Araport11) |
AT3G05680 | Encodes a splicing/methylation factor that is a homologue to the mammalian VIRILIZER, is member of a core set of mRNA m6A writer proteins and is required for N6-adenosine methylation of mRNA. Analysis of transcriptional profiles of the vir-1 mutant suggests that VIR is likely involved in regulation of gene expression, but the function of VIR is rather general than specific and knock-down of VIR does not affect overall splicing rates. |
AT1G21390 | embryo defective 2170;(source:Araport11) |
AT2G21710 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G30610 | Pentatricopeptide repeat protein .Mutations in this locus result in embryo lethality due to defects in chloroplast development. Embryo shape at seed maturity is globular. |
AT2G25660 | Translocon at the inner-envelope membrane of chloroplasts which binds to the outer-membrane channel TOC75. |
AT4G39620 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G70070 | Allelic to ISE2(increased size exclusion limit of plasmodesmata 2). Mutants maintain dilated plasmodesmata at the embryonic torpedo stage. |
AT5G55940 | Uncharacterized protein family (UPF0172);(source:Araport11) |
AT3G12670 | Cytidine triphosphate synthase; essential for CTP supply in developing embryos. |
AT3G20400 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G63420 | Encodes a member of the metallo-beta-lactamase protein family that plays a vital role in embryo morphogenesis and apical-basal pattern formation by regulating chloroplast development. In bacteria, RNase J plays an important role in rRNA maturation and in the 5′ stability of mRNA. |
AT4G36630 | Vacuolar sorting protein 39;(source:Araport11) |
AT1G34550 | transmembrane protein (DUF616);(source:Araport11) |
AT4G33990 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G63050 | embryo defective 2759;(source:Araport11) |
AT2G39080 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G40480 | embryo defective 3012;(source:Araport11) |
AT2G30200 | Malonyl-ACP expressed in developing seeds. Loss of function mutants are embryo lethal and over expression in seeds leads to increased seed oil content. |
AT2G01860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G00140 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT4G33050 | Encodes a calmodulin-binding protein involved in stomatal movement. |
AT4G37890 | Involved in shoot regenaration from root explants. |
AT3G23440 | embryo sac development arrest 6;(source:Araport11) |
AT3G56990 | embryo sac development arrest 7;(source:Araport11) |
AT4G34200 | Encodes a 3-phosphoglycerate dehydrogenase that is essential for embryo and pollen development. |
AT1G10747 | Encodes a Maternally expressed gene (MEG) family protein |
AT1G10745 | Encodes a Maternally expressed gene (MEG) family protein |
AT5G11530 | Involved in regulating reproductive development |
AT5G64360 | EIP9 interacts with EMF1 to regulate flowering. It functions partially redundantly with SDJ2 and SDJ3 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
AT4G02440 | EID1 is an F-box protein that functions as a negative regulator in phytochrome A (phyA)-specific light signalling. Expressed at all stages of plant development independently of light conditions, localizes to the nucleus, and forms nuclear speckles under continuous far-red light. Forms stable dimeric and trimeric complexes with several ASK proteins and Cullin1 in yeast and in planta. |
AT1G71220 | Encodes UDP-glucose:glycoprotein glucosyltransferase. Non-receptor component required for EFR-mediated immunity. Mutants show de-repressed anthocyanin accumulation in the presence of elf18, and EFR accumulation and signalling. |
AT5G62500 | Encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
AT5G67270 | encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
AT5G66460 | Encodes a endo-beta-mannanase involved in seed germination and silique dehiscence. |
AT3G11040 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
AT1G07670 | TPLATE complex protein involved in clathrin-mediated endocytosis. |
AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
AT1G29330 | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
AT3G25040 | Encodes ERD2b. a homolog of the yeast endoplasmic reticulum retention receptor ERD2. Mutations in ERD2b compromise EFR but not FLS2 signaling. The mRNA is cell-to-cell mobile. |
AT2G01850 | EXGT-A3 has homology to xyloglucan endotransglucosylases/hydrolases (XTHs). Mutants in this gene show a lesion mimic phenotype associated with leaf maturation and a reduction in the number of tertiary veins. Individual tracheary elements in the mutants are shorter, but phloem transport activity is not severely affected. EXGT-A3 plays a role in xyloglucan degradation in the differentiating tracheary elements of rosette leaves. The mRNA is cell-to-cell mobile. |
AT4G19040 | Encodes a PH and START domain-containing protein that mediates resistance to pathogenic fungi. Resistance requires salicylic acid signalling. Mutants are resistant to E. cichoracearum. Expressed throughout plant tissues and possibly localized to membranes /mitochondrion. |
AT3G48090 | Component of R gene-mediated disease resistance in Arabidopsis thaliana with homology to eukaryotic lipases. |
AT5G67160 | Encodes a member of the BAHD acyltransferase superfamily. Mutants have enhanced susceptibility to virulent and avirulent pathogens and are defective in pathogen induced SA biosynthesis. EPS1 may act upstream of SA biosynthesis as application of SA can rescue the mutant phenotype. |
AT1G73840 | Resembles the CstF64 family of RNA processing factors that are conserved between yeast and mammals. In mammals, CstF64 is a component of the CstF complex which is required for mRNA 3'end formation along with other factors. |
AT5G22090 | EAR1 is a negative regulator of ABA signaling that enhances the activity of all six clade A PP2Cs (ABI1, ABI2, HAB1, HAB2, AHG1, AHG3) by interacting with and releasing the N-terminal autoinhibition of these proteins. EAR1 indirectly affects OST1 activity through enhancing ABI1 activity. The EAR1 141-287 fragment is sufficient for the functioning of EAR1 in ABA responses; the 131-248 region harbors an intrinsically disordered region and only 249-278 can form a predicted regular structure. EAR1 is located in the ER, nuclei, and cytoplasm; ABA signaling promotes the translocation of EAR1 from the ER and/or cytoplasm to the nucleus. Mutations showed that it functions in seed germination, primary root growth, and drought tolerance. |
AT3G12680 | Member of the floral homeotic AGAMOUS pathway. |
AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
AT1G31410 | putrescine-binding periplasmic protein-like protein;(source:Araport11) |
AT1G76150 | Encodes a monofunctional enoyl-CoA hydratase 2, involved in the degradation of even cis-unsaturated fatty acids, gene expression is enhanced during the first 2 days of germination, as well as in senescent leaves. |
AT4G16210 | enoyl-CoA hydratase/isomerase A;(source:Araport11) |
AT1G60550 | enoyl-CoA hydratase/isomerase D;(source:Araport11) |
AT1G34245 | Encodes a secretory peptide EPF2 expressed in proliferating cells of the stomatal lineage, known as meristemoids, and in guard mother cells, the progenitors of stomata. Controls asymmetric cell divisions during stomatal development. EPF2 is related to EPF1, also involved in stomatal development. Its transcript levels change after inducing MUTE expression in a mute background. EPF2 binds to the ER receptor triggering MAPK activation that in turn inhibits stomatal development. EPF2 competes with STOMAGEN for binding to receptor protein kinases ER, and TMM. |
AT3G20290 | Encodes AtEHD1, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD2, At4g05520). |
AT1G30630 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
AT5G11710 | EPSIN1 plays an important role in the vacuolar trafficking of soluble proteins at the trans-Golgi network via its interaction with gamma-ADR, VTI11, VSR1, and clathrin. Associated with actin filaments and with the Golgi complex. Expressed in most tissues. The mRNA is cell-to-cell mobile. |
AT3G59290 | Involved in plant trans-Golgi network (TGN) transport. |
AT1G70330 | encodes an adenosine transporter that catalyze a proton-dependent adenosine transport. The mRNA is cell-to-cell mobile. |
AT1G07810 | Encodes an ER-type Ca2+-pumping ATPase. The mRNA is cell-to-cell mobile. |
AT4G00900 | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. |
AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
AT1G75220 | Encodes a vacuolar glucose exporter that is induced in response to factors that activate vacuolar glucose pools like darkness, heat stress and wounding and repressed during conditions that trigger glucose accumulation in the vacuole like cold stress and external sugar supply. |
AT2G26330 | Homologous to receptor protein kinases. Involved in specification of organs originating from the shoot apical meristem. Contains a cytoplasmic protein kinase catalytic domain, a transmembrane region, and an extracellular leucine-rich repeat. ER has been identified as a quantitative trait locus for transpiration efficiency by influencing epidermal and mesophyll development, stomatal density and porosity of leaves. It has been implicated in resistance to the bacterium Ralstonia solanacearum and to the necrotrophic fungus Plectosphaerella cucumerina. Together with ERL1 and ERL2, ER governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. ER binds to the peptides STOMAGEN and EPF2 which compete for the same binding site. The ER-EFP2 complex activates MAPK signaling that inhibits stomatal development. ER-STOMAGEN does not activate MAPK signaling. Plants harboring loss of function alleles of er are more susceptible to heat stress than wild type. In Arabidopsis and other organisms, overexpression of ER confers thermotolerance via as yet undefined mechanisms. |
AT5G62230 | Encodes a receptor-like kinase that, together with ER and ERL2 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. Along with erl2 functionally compensates for loss of erecta during integument development. Its transcript levels change after inducing MUTE expression in a mute background. |
AT5G07180 | Encodes a receptor-like kinase that, together with ER and ERL1 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is also important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. When heterozygous in an er/erl1 null background, plants are female sterile due to cell division defect in the integuments. |
AT1G03800 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-10). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT1G28360 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Regulates floral development. |
AT5G44210 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-9). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT1G19400 | Tail-anchored (TA) OEP membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
AT2G01480 | ESMD1 is a golgi localized putative O-fucosyltransferase. |
AT5G42950 | EXA1 is a GYF domain-containing gene of the SMY2 subgroup. Mutants exhibit resistance to potexviruses. |
AT5G25190 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT5G09410 | calmodulin-binding protein, similar to another ethylene-upregulated calmodulin-binding protein ER1 GI:11612392 from (Nicotiana tabacum) |
AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile. |
AT3G04580 | Ethylene receptor, subfamily 2. Has serine kinase activity. |
AT3G25730 | ethylene response DNA binding factor 3;(source:Araport11) |
AT5G21960 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT5G51190 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture and the response to cold stress. |
AT3G16280 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT3G20310 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-7). The protein contains one AP2 domain. Phosphorylated by PKS3 in vitro. Involved in ABA-mediated responses. Acts as a repressor of GCC box?mediated transcription together with AtSin3 and HDA19. |
AT2G47520 | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. It plays a role in hypoxia-induced root slanting. |
AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT1G33760 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT1G04310 | encodes an ethylene receptor related to bacterial two-component histidine kinases. |
AT4G17500 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
AT5G47220 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box?dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. |
AT3G15210 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. The mRNA is cell-to-cell mobile. |
AT5G47230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-5). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
AT4G17490 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress. Involved in regulating root architecture and the response to cold stress. |
AT1G17870 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. Mediates chloroplastic ROS homeostasis and promotes retrograde signaling in response to salt stress. |
AT1G05010 | Encodes 1-aminocyclopropane-1-carboxylate oxidase |
AT3G20770 | Encodes EIN3 (ethylene-insensitive3), a nuclear transcription factor that initiates downstream transcriptional cascades for ethylene responses. EIN3 interacts with MYC2, MYC3 and MYC4 to inhibit jasmonate-induced expression of wound-responsive genes and herbivory-inducible genes, and plant defense against generalist herbivores. |
AT2G27050 | ethylene-insensitive3-like1 (EIL1) The mRNA is cell-to-cell mobile. |
AT2G31230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT3G60490 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT4G16750 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT2G33860 | ettin (ett) mutations have pleiotropic effects on Arabidopsis flower development, causing increases in perianth organ number, decreases in stamen number and anther formation, and apical-basal patterning defects in the gynoecium. The ETTIN gene encodes a protein with homology to DNA binding proteins which bind to auxin response elements. ETT transcript is expressed throughout stage 1 floral meristems and subsequently resolves to a complex pattern within petal, stamen and carpel primordia. ETT probably functions to impart regional identity in floral meristems that affects perianth organ number spacing, stamen formation, and regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of the gynoecium, consistent with the proposal that ETT is involved in prepatterning apical and basal boundaries in the gynoecium primordium. It is a target of the ta-siRNA tasiR-ARF. ETT is also a target of AP2; integrateing the functions of AGAMOUS and APETALA2 in floral meristem determinacy. Positive regulation of drought stress response genes. |
AT1G13950 | Encodes eukaryotic translation initiation factor 5A (EIF-5A).In mammalian cells it functions as a shuttle protein that translocates mRNA from the nucleus to cytoplasmic ribosomes. Overexpression results in an increase in both primary and secondary xylem formation. In RNAi suppressed lines, xylem formation is reduced. |
AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
AT3G19760 | Encodes an RNA helicase that may be a component of the Exon Junction Complex. Subcellular localization is modulated by stress. Under normal conditions it is localized to the nuceloplasm but under hyopoxic conditions it localizes to the nucleolus and splicing speckles. |
AT1G12920 | Encodes a eukaryotic release factor one homolog. |
AT3G26400 | member of eIF4B - eukaryotic initiation factor 4B The mRNA is cell-to-cell mobile. |
AT3G13460 | Physically interacts with CIPK1. ECT2 regulates the mRNA levels of the roteasome regulator PTRE1 and of several 20S proteasome subunits, resulting in enhanced 26S proteasome activity. YTHDF protein which togeteher with ECT3 and ECT4 is involved in cell proliferation during plant organogenesis. |
AT5G61020 | YTHDF protein which togeteher with ECT2 and ECT4 is involved in cell proliferation during plant organogenesis. |
AT1G79270 | evolutionarily conserved C-terminal region 8;(source:Araport11) |
AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
AT4G33630 | Encodes one of the two plastid proteins EXECUTER (EX1, AT4G33630) and EX2 (AT1G27510). Mediates singlet oxygen induced programmed cell death. |
AT1G10180 | LOW protein: exocyst complex component-like protein;(source:Araport11) |
AT4G02350 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. The mRNA is cell-to-cell mobile. |
AT1G47550 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. It binds phosphoinositide lipids. |
AT5G58430 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. Targeted by AvrPtoB to manipulate the defense molecule secretion machinery. |
AT1G07000 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G13150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and, together with EXO70C2, is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane. |
AT5G13990 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane and is not found to colocalize with or interact with core exocyst subunits. |
AT5G50380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT1G07725 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G59730 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. The mRNA is cell-to-cell mobile. |
AT2G28650 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT4G08950 | Phosphate-responsive 1 family protein;(source:Araport11) |
AT5G64260 | EXORDIUM like 2;(source:Araport11) |
AT5G51550 | EXORDIUM like 3;(source:Araport11) |
AT5G09440 | EXORDIUM like 4;(source:Araport11) |
AT1G54490 | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. The mRNA is cell-to-cell mobile. |
AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT2G28950 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT4G28250 | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT3G45970 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) The mRNA is cell-to-cell mobile. |
AT5G17020 | Encodes a member of the exportin protein family (XPO1A) which functions as receptors for nuclear export. Binds to a variety of proteins having leucine rich export signals.Along with XPO1B involved with development of the male and female gametophytes. Sensitive to heat and oxidative stress. |
AT1G26250 | Proline-rich extensin-like family protein;(source:Araport11) |
AT3G57630 | Encodes a glycoprotein glycosyl transferase ExAD. Knockout mutants show truncated root hair phenotype. |
AT2G23460 | encodes a novel G-alpha protein that shares similarity to plant, yeast, and animal G-alpha proteins at the C-terminus. It contains an N-terminus that is as large as the C-terminus, is a member of a small family, and is expressed in all tissues examined, including roots, leaves, stems, flowers, and fruits. |
AT4G34390 | extra-large GTP-binding protein 2;(source:Araport11) |
AT3G14100 | Triple RNA Recognition Motif protein involved in the dynamic and reversible aggregation of translationally repressed mRNAs during hypoxia.During hypoxia, UBP1C association with non? uracil-rich mRNAs is enhanced concomitant with its aggregation into microscopically visible cytoplasmic foci, referred to as UBP1 stress granules (SGs). This mRNA association occurs as global levels of protein synthesis decline during hypoxia. Upon reoxygenation, rapid UBP1 SG disaggregation coincides with the return of the stabilized mRNAs to polysomes. |
AT1G21760 | This gene is predicted to encode an F-box protein that is evolutionarily conserved between Arabidopsis and other eukaryotes including S.cerevisiae and humans. It may play a role in regulating translation under conditions of temperature stress. FBP7 transcript levels are increased at high and low temperatures. The mRNA is cell-to-cell mobile. |
AT3G07870 | FBX92 is an F-box containing protein. Overexpression produces plants with smaller leaves while reduced expression is correlated with increased leaf size and increased rates of cell proliferation. |
AT4G21510 | F-box family protein;(source:Araport11) |
AT4G05010 | F-box family protein;(source:Araport11) |
AT4G35930 | F-box family protein;(source:Araport11) |
AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
AT1G57906 | F-box protein;(source:Araport11) |
AT4G10820 | F-box family protein;(source:Araport11) |
AT5G66830 | F-box protein (DUF295);(source:Araport11) |
AT2G37678 | Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus. |
AT3G22170 | A component of the PHYA signaling network, mediates the FR-HIR response to far-red light in concert with FAR1. Expression is induced by age; involved in negative regulation of leaf senescence. |
AT4G19990 | FAR1-related sequence 1;(source:Araport11) |
AT1G10240 | FAR1-related sequence 11;(source:Araport11) |
AT5G18960 | Transcriptional repressor that accumulates in short-day conditions. Regulates together with FRS7 and NINJA glucosinolate biosynthesis. |
AT2G32250 | FAR1-related sequence 2;(source:Araport11) |
AT2G43280 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. |
AT3G44870 | Encodes a protein with 93% identity to a farnesoic acid methyl transferase. SABATH family methyltransferase. |
AT5G58560 | FOLK is a farnesol kinase that can phosphorylate farnesol using an NTP donor. It can also phosphorylate geraniol, or geranylgeraniol, but it prefers farnesol in experiments performed using yeast membranes. folk loss-of-function mutants show ABA hypersensitivity in a seed germination assay and the mutants also exhibit abnormal flower development, including extra carpel formation, when subjected to water stress. The mRNA is cell-to-cell mobile. |
AT5G47770 | Encodes a protein with farnesyl diphosphate synthase activity. |
AT4G17190 | Encodes a protein with farnesyl diphosphate synthase activity, which catalyzes the rate limiting step in isoprenoid biosynthesis. Its mRNA is most abundantly expressed in flowers. |
AT4G38580 | putative farnesylated protein (At4g38580) mRNA, complete |
AT4G12730 | AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds. Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT3G12660 | fasciclin-like arabinogalactan-protein, family (FLA14). Possibly involved in embryogenesis and seed development. |
AT2G35860 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT5G06390 | FASCICLIN-like arabinogalactan protein 17 precursor;(source:Araport11) |
AT3G11700 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT2G45470 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT1G03870 | fasciclin-like arabinogalactan-protein 9 (Fla9). Possibly involved in embryogenesis and seed development. |
AT3G25110 | Encodes a FatA acyl-ACP thioesterase |
AT1G74960 | Encodes a plastidic beta-ketoacyl-ACP synthase II, involved in fatty acid elongation from 16:0-ACP to 18:0-ACP. Homozygous knock-out mutants are embryo lethal, indicating early embryo development is sensitive to elevated 16:0. |
AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
AT2G29980 | Endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids. Uses cytochrome b5 as electron donor. |
AT3G15850 | Chloroplastic enzyme responsible for the synthesis of 16:1 fatty acids from galactolipids and sulpholipids. Uses ferredoxin as electron donor. The mRNA is cell-to-cell mobile. |
AT3G11170 | Chloroplastic enzyme responsible for the synthesis of 16:3 and 18:3 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene expression is induced by wounding in shoot and root. The wound-response in shoot is independent of jasmonic acid mediated pathway whereas the root response is mediated by jasmonic acid. The mRNA is cell-to-cell mobile. |
AT4G27030 | Encodes an unusual palmitate desaturase that is highly substrate specific. It introduces a delta-3 trans double bond at palmitate at the sn-2 position of phosphatidylglycerol. The mRNA is cell-to-cell mobile. |
AT2G34770 | encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death. |
AT4G20870 | encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death. |
AT1G08510 | Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer. |
AT5G63560 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G63170 | Encodes a plastid stroma localized fatty acid binding protein involved in fatty acid metabolism. |
AT2G26310 | Encodes a plastid stroma localized fatty acid binding protein. |
AT1G78020 | FCS like zinc finger 6 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
AT1G31420 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. |
AT2G35620 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.Mucilage is easily detached from fei2 mutants seeds, and forms a capsule that is >50% smaller relative to wild-type. |
AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
AT3G51550 | Encodes a synergid-expressed, plasma-membrane localized receptor-like kinase that accumulates asymetrically in the synergid membrnane at the filiform apparatus and mediates male-female gametophyte interactions during pollen tube reception. Also involved in powdery mildew infection. Mutants show faster root elongation under dim light, the protein is required for intracellular accumulation of AHA2 under dim-light growth conditions. Positively regulates flowering by modulating the transcript accumulation and mRNA alternative splicing of certain flowering-related genes, including FLOWERING LOCUS C (FLC) and its homolog MADS AFFECTING FLOWERING (MAF). However, the RALF1 ligand negatively regulates flowering compared with FER. |
AT1G10960 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT4G14890 | 2Fe-2S ferredoxin-like superfamily protein;(source:Araport11) |
AT1G32550 | Encodes FdC2, a ferredoxin protein capable of alternative electron partitioning. FdC1 level increases in conditions of acceptor limitation at PSI. |
AT1G15140 | FAD/NAD(P)-binding oxidoreductase;(source:Araport11) |
AT5G01600 | Encodes a ferretin protein that is targeted to the chloroplast. Member of a Ferritin gene family. Gene expression is induced in response to iron overload and by nitric oxide. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
AT5G49730 | Encodes a plasma membrane-located ferric chelate reductase. Its mRNA is expressed in green aerial tissues (shoot, flower and cotyledon) in a light- and cell differentiation-specific manner. |
AT5G49740 | Encodes a chloroplast ferric chelate reductase. Shows differential splicing and has three different mRNA products. Expressed in the shoot, flower and cotyledon. |
AT3G11050 | ferritin 2;(source:Araport11) |
AT3G56090 | Encodes FERRITIN 3, AtFER3. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool. |
AT3G09350 | Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). Fes1A is cytosolic and associates with cytosolic Hsp70. Mutants showed increased heat-sensitive phenotype suggestion the involvement of Fes1A in acquired thermotolerance. Does not have nucleotide exchange factor activity in vitro. |
AT3G53800 | Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). |
AT4G25630 | encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.2f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated. The mRNA is cell-to-cell mobile. |
AT4G22240 | Involved in photoprotection of photosystem II. The RVSI and twin-positive motifs in the transit peptide are necessary for efficient leucoplast import of prFB. |
AT5G19940 | Enables plants to cope with moderate light stress and affects cadmium tolerance. |
AT4G26700 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
AT5G13840 | FIZZY-related 3;(source:Araport11) |
AT5G46330 | Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile. |
AT3G51240 | Encodes flavanone 3-hydroxylase that is coordinately expressed with chalcone synthase and chalcone isomerases and is involved in flavonoid biosynthesis. Not responsive to auxin or ethylene stimulus (qRT-PCR). |
AT1G12200 | Putative flavin monooxygenase. |
AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
AT5G54500 | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
AT5G43935 | flavonol synthase 6;(source:Araport11) |
AT2G19190 | Encodes a receptor-like protein kinase that is involved in early defense signaling. Expression of this gene is strongly induced during leaf senescence. It is a target of the transcription factor AtWRKY6. |
AT4G28300 | Encodes a protein with 13.6% proline amino acids that is predicted to localize to the cell wall. The mRNA is cell-to-cell mobile. |
AT3G01560 | proline-rich receptor-like kinase, putative (DUF1421);(source:Araport11) |
AT5G64870 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot3 is found in membrane nanodomains. |
AT1G50370 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT3G19980 | Encodes catalytic subunit of serine/threonine protein phosphatase 2A. It can associate with phytochromes A and B in vitro. Mutant plants display an accelerated flowering phenotype.Acts antagonistically to SnRK2 to regulate ABI5 phosphorylation. It inteacts with NRP which results in tethering to endosomes leading to its degradation. |
AT1G35460 | Encodes a bHLH transcription factor involved in CFL1-mediated regulation of cuticle development. Overexpression leads to abnormal cuticle development. |
AT4G09180 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G51140 | Encodes a basic helix-loop-helix-type transcription factor involved in photoperiodism flowering. Binds to the E-box cis-element in the CONSTANS (CO) promoter to regulate flowering. Interacts with CFL1 and along with CFLAP2 negatively regulates cuticle development. Binds to the potassium channel gene KAT1 as a dimer. The DNA-binding capacity is inhibited in response to ABA through phosphorylation-dependent monomerization. |
AT2G41705 | Encodes a fluoride export protein. |
AT3G14750 | structural maintenance of chromosomes domain protein;(source:Araport11) |
AT1G67170 | Coiled coil domain protein required for phase separation of FCA. |
AT4G28370 | Encodes an E3 ubiquitin ligase that is involved in plant cell wall modification, seed mucilage extrusion, and controls the degree of pectin methylesterification in seed mucilage. fly1 mutant seeds release more compact mucilage capsules and detached outer tangential primary walls when hydrated in water. Fly1 is located in the endomembrane system, likely localized in late endosome/multivesicular bodies/prevacular compartment. It has been shown to ubiquitinate proteins in conjunction with UBA1 and UBC8. |
AT4G27760 | Encodes an oxidoreductase required for vegetative shoot apex development. Mutants display disruptions in leaf positioning and meristem maintenance. |
AT4G16670 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT5G57770 | FORKED-LIKE family member, part of Group 2 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT5G14780 | Encodes a NAD-dependent formate dehydrogenase. |
AT1G70140 | Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton. |
AT5G07780 | Encodes a class II formin that nucleates actin assembly, binds to the barbed-end of actin filaments and antagonizes the effect of FH1 on actin dynamics. The mRNA is cell-to-cell mobile. |
AT5G67470 | formin homolog 6;(source:Araport11) |
AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
AT5G54650 | Encodes a protein with similarity to formins that is involved in cytokinesis. Loss of function mutations exhibit delayed cellularization during endosperm development. FH5 is expressed in the endosperm and the protein localizes to the cell plate. FH5 was shown to be a maternally expressed imprinted gene. |
AT4G33240 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
AT3G14270 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
AT1G71010 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the proposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile. |
AT4G31380 | encodes a small protein with unknown function and is similar to flower promoting factor 1. This gene is not expressed in apical meristem after floral induction but is expressed in roots, flowers, and in low abundance, leaves. |
AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
AT2G28110 | Homolog to AT5G22940, a member of glycosyltransferase family 47 that is involved in secondary cell wall biosynthesis. It exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. Protein has a domain that shares significant similarity with the pfam03016 domain. It is expressed specifically in developing vessels and fiber cells, and FRA8 is targeted to Golgi. Mutants have irregular xylem formation, reduced cellulose levels and plants are smaller than normal siblings. |
AT1G65580 | Endonuclease/exonuclease/phosphatase family protein;(source:Araport11) |
AT5G01100 | O-fucosyltransferase family protein;(source:Araport11) |
AT4G00650 | Encodes a major determinant of natural variation in Arabidopsis flowering time. Dominant alleles of FRI confer a vernalization requirement causing plants to overwinter vegetatively. Many early flowering accessions carry loss-of-function fri alleles .Twenty distinct haplotypes that contain non-functional FRI alleles have been identified and the distribution analyzed in over 190 accessions. The common lab strains- Col and Ler each carry loss of function mutations in FRI. |
AT4G17060 | Encodes one of the FRI interacting proteins: FRIGIDA INTERACTING PROTEIN 1 (FIP1)/At2g06005, FIP2/ At4g17060. FRI (At4G00650) is a major determinant of natural variation in Arabidopsis flowering time. |
AT1G31814 | family member of FRI-related genes that is required for the winter-annual habit. Genbank accession BK004885 |
AT2G33835 | Encodes a zinc finger domain containing protein that is expressed in the shoot/root apex and vasculature, and acts with FRI to repress flowering.FES1 mutants in a Col(FRI+) background will flower early under inductive conditions. |
AT1G63930 | EXO70 interactor and presumed negative secretion regulator. |
AT5G51830 | Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development. |
AT1G43670 | Encodes a fructose-1,6-bisphosphatase. This enzyme, in addition to catalyzing the formation of fructose-6-phosphate for sucrose biosynthesis, appears to play a role in fructose-mediated signaling that is independent of its enzymatic activity. atcfbp-1/fins1 mutants have reduced photosynthetic rates, elevated levels of starch and reduced levels of sucrose during the day. Although the protein is expected to be cytosolic, a GFP-tagged version localizes to the cytoplasm and the nucleus. The mRNA is cell-to-cell mobile. |
AT1G07110 | Encodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase. |
AT4G26530 | Aldolase superfamily protein;(source:Araport11) |
AT1G50250 | encodes an FTSH protease that is localized to the chloroplast. Involved in the D1 repair cycle of Photosystem II. FtsH1 and FtsH5 are interchangeable in thylakoid membranes. |
AT5G53170 | encodes an FtsH protease that is localized to the chloroplast and the mitochondrion |
AT1G06430 | encodes a FtsH protease that is localized to the chloroplast |
AT5G58870 | encodes an FtsH protease that is localized to the chloroplast |
AT1G17220 | Encodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal. The mRNA is cell-to-cell mobile. |
AT1G71990 | This gene encodes a Lewis-type alpha 1,4-fucosyltransferase |
AT1G14100 | member of Glycosyltransferase Family- 37. FUT8 was previously associated to AT1G14110 |
AT4G05120 | Encodes an equilibrative nucleoside transporter AtENT3. Mutations of this locus allow mutants to grow on uridine analogue fluorouridine. |
AT2G47510 | Encodes a mitochondrial-localized protein. The FUM1 gene appears to be essential, suggesting that FUM1 may play a crucial role as a fumarase in the tricarboxylic acid cycle. |
AT1G12050 | Encodes a fumarylacetoacetase that converts fumarylacetoacetate to acetoacetate and fumarate and is likely to be involved in tyrosine catabolism. |
AT4G15940 | Fumarylacetoacetate hydrolase homolog; involved in seed redox regulation and to affect seed quality traits such as seed thermo-dormancy and longevity. |
AT4G24740 | a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins. |
AT2G26990 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. |
AT3G61140 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Component of the nuclear-localized COP9 complex. Mutants display striking purple coloration due to anthocyanin accumulation in their cotyledons, first become defective during embryogenesis and exhibit limited seedling development. |
AT1G20110 | Encodes a protein that is localized to the peripheral membrane of late endosomal compartments. Involved in the regulation of mulitivesicular/prevacuolar compartment protein sorting. Loss of function mutations are embryo lethal. Regulates IRT1-dependent metal transport and metal homeostasis. The mRNA is cell-to-cell mobile. |
AT2G26300 | Encodes an alpha subunit of a heterotrimeric GTP-binding protein. The active GTP-bound form of GPA1 binds to the GTG1 and GTG2 abscisic acid (ABA) receptors and appears to affect their GTPase and GTP-binding activity, and hence, ABA binding abilities. GPA1 is a positive regulator in ABA-mediated inhibition of stomatal opening. Plants with recessive mutant alleles have complex phenotypes including: reduced brassinolide response, reduced cell divisions, round leaves, short hypocotyls. It is likely to be involved in the signaling events that trigger unfolded protein response-associated cell death. GPA1 is also involved in sugar signaling. The mRNA is cell-to-cell mobile. |
AT4G36730 | member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box |
AT4G01120 | bZIP (basic leucine zipper) transcription factor that binds to the G-box regulatory element found in many plant promoters. GBF2 nuclear localization is increased by blue light |
AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
AT5G10450 | Encodes a member of the 14-3-3 gene family that is a lambda isoform (14-3-3λ). Interacts with APX3 (ascorbate peroxidase) and AKR2 , suggesting a role in mediating oxidative metabolism in stress response. This protein was shown to colocalize and interact with SERK1 by which it is phosphorylated. This protein is also reported to interact with the phosphorylated form of the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Interacts with JAZ10.4 which lacks the Jas motif. It is also phosphorylated by CRPK1 as part of the response to cold and translocates to the nucleus after phosphorylation. |
AT1G48270 | encodes a protein similar to G-coupled receptor with 7 transmembrane regions. Overexpression studies suggest this gene is involved in dormancy and flowering. Reduction of expression results in decreased sensitivity to cytokinin. |
AT3G05120 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The DELLA region alone can interact with GID1A in GA-dependent manner in a Y2H assay. |
AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The mRNA is cell-to-cell mobile. |
AT4G02780 | Catalyzes the conversion of geranylgeranyl pyrophosphate (GGPP) to copalyl pyrophosphate (CPP) of gibberellin biosynthesis |
AT5G25900 | Encodes a member of the CYP701A cytochrome p450 family that is involved in later steps of the gibberellin biosynthetic pathway. |
AT1G74670 | Gibberellin-regulated family protein;(source:Araport11) |
AT2G33570 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT1G56600 | GolS2 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS2 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS2 have increased tolerance to salt, chilling, and high-light stress. |
AT1G09350 | Predicted to encode a galactinol synthase |
AT5G23790 | Predicted to encode a galactinol synthase. |
AT1G60450 | Predicted to encode a galactinol synthase. |
AT3G53950 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
AT5G19580 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
AT1G26810 | Encodes a protein with β1,3-galactosyltransferase activity involved in the biosynthesis of the Lewis a epitope of certain glycoproteins. |
AT5G15470 | Encodes a protein with putative galacturonosyltransferase activity. |
AT5G47780 | Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell mobile. |
AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
AT3G50760 | Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell mobile. |
AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
AT4G02130 | Encodes a protein with putative galacturonosyltransferase activity. |
AT3G62660 | Encodes a protein with putative galacturonosyltransferase activity. |
AT5G48030 | encodes a mitochondrially targeted DNAJ protein involved in female gametophyte development. |
AT1G19580 | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
AT3G52115 | Induced in response to ionizing radiation, shows basal expression in mitotically active cells and high expression in endoreduplicating cells. May be involved in DNA damage-induced growth arrest. Protein sequence contains a PEST destruction box. |
AT2G33040 | gamma subunit of Mt ATP synthase;(source:Araport11) |
AT4G32940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death. |
AT1G23900 | Encodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane. |
AT1G78660 | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
AT1G78680 | The Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
AT1G78670 | gamma-glutamyl hydrolase 3;(source:Araport11) |
AT4G30530 | Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. The mRNA is cell-to-cell mobile. |
AT4G39640 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in vascular tissues (predominantly phloem) of leaves and is involved in the degradation of glutathione. The encoded enzyme also mitigates oxidative stress by metabolizing GSSG (oxidized form of GSH - glutathione) in the apoplast. |
AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
AT3G02885 | GASA5, is involved in the regulation of seedling thermotolerance. |
AT3G24050 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT1G08010 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT3G16870 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G26930 | Encodes a member of the GATA factor family of zinc finger transcription factors. Controls lateral root founder cell specification. |
AT5G56860 | Encodes a member of the GATA factor family of zinc finger transcription factors. Modulate chlorophyll biosynthesis and glutamate synthase (GLU1/Fd-GOGAT) expression. |
AT4G16141 | GATA type zinc finger transcription factor family protein;(source:Araport11) |
AT2G20570 | Encodes GLK1, Golden2-like 1, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK2, Golden2-like 2, is encoded by At5g44190. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. GLK1 is also a member of the GARP transcription factor family. |
AT3G13222 | Encodes a protein that binds to G-box binding transcription factors and enhances their binding affinities to G-box in vitro. This protein localizes to the nucleus and is expressed predominantly in the root. |
AT4G19985 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT4G28030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT5G65280 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor. Loss of function mutations in GCL1 show no ABA response defects based on assays of seed germination and seedling development.GCL1 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
AT5G28840 | Encodes a protein with GDP-D-mannose 3',5'-epimerase activity. The enzyme is involved in ascorbate biosynthesis. It catalyzes the conversion of GDP-D-mannose to GDP-L-galactose. |
AT5G66280 | GDP-D-mannose 4,6-dehydratase |
AT3G14225 | Contains lipase signature motif and GDSL domain. |
AT4G10950 | GDSL-type esterase/lipase. Required for pollen development. |
AT2G36340 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT2G03800 | encodes a D-aminoacyl-tRNA deacylase. Involved in detoxification of D-aminoacyl-tRNA. Mutants also show ethanol-hypersensitive phenotype. |
AT5G13200 | Encodes a protein with unknown function that is involved in hormone mediated regulation of seed germination/dormancy. |
AT3G45240 | Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. Involved in resistance to S. sclerotiorum, fungal sRNA target. |
AT2G18440 | Encodes a noncoding RNA, a member of an emerging class of transcripts that lack significant open reading frames and encode RNA as their final product. Has been identified as a translated small open reading frame by ribosome profiling. |
AT1G22300 | Encodes a 14-3-3 protein. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Might act as a stabilization factor to mediate the oligomerization of REM on the plasma membrane. |
AT1G26480 | 14-3-3 protein GF14iota (grf12) |
AT1G78220 | 14-3-3 protein GF14 pi |
AT1G78300 | G-box binding factor GF14 omega encoding a 14-3-3 protein The mRNA is cell-to-cell mobile. |
AT5G65430 | member of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
AT2G31400 | Encodes a a chloroplast-localized pentatricopeptide-repeat protein involved in regulation of nuclear gene expression. |
AT2G18620 | Terpenoid synthases superfamily protein;(source:Araport11) |
AT5G20630 | Encodes a germin-like protein. Its transcripts are more abundant in RNA from leaves collected in the evening, suggesting some kind of circadian regulation. |
AT1G72610 | germin-like protein (GLP1) |
AT1G09560 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. The mRNA is cell-to-cell mobile. |
AT4G32680 | Similar to yeast GET2 encodes an ER localized transmembrane protein that interacts with GET1 receptor via its transmembrane domain. |
AT1G35160 | GF14 protein phi chain member of 14-3-3 protein family. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 The mRNA is cell-to-cell mobile. |
AT1G02400 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins. |
AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
AT1G22770 | Together with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes flowering under long days in a circadian clock-controlled flowering pathway. GI acts earlier than CO and FT in the pathway by increasing CO and FT mRNA abundance. Located in the nucleus. Regulates several developmental processes, including photoperiod-mediated flowering, phytochrome B signaling, circadian clock, carbohydrate metabolism, and cold stress response. The gene's transcription is controlled by the circadian clock and it is post-transcriptionally regulated by light and dark. Forms a complex with FKF1 on the CO promoter to regulate CO expression. The mRNA is cell-to-cell mobile. |
AT2G47790 | Encodes GIGANTUS1 (GTS1), a member of Transducin/WD40 protein superfamily. Controls seed germination, growth and biomass accumulation. |
AT2G37585 | Encodes GlcAT14C. Has glucuronosyltransferase activity adding glucuronic acid residues to beta-1,3- and beta-1,6-linked galactans. |
AT4G10060 | Glucosylceramidase that preferentially hydrolyzes long acyl chain glucosylceramides. |
AT4G34740 | Encodes glutamine 5-phosphoribosylpyrophosphate amidotransferase. Mutants are deficient in leaf, but not cotyledon, plastid and palisade cell development. Mutants exhibit defective chloroplast development under non-low light, suggesting that the defect in chloroplast development is caused by photo-oxidative damage. Plays role in differential development of vascular-associated cells. Demonstrates a cell-specific difference in chloroplast development.Mutant leaves are highly reticulate with a green vascular pattern. |
AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
AT3G27260 | Kinase like protein with similarity to yeast BDF1 and human RING3 protein, which have two bromodomains GTE8 has a single bromodomain |
AT4G04970 | encodes a gene similar to callose synthase The mRNA is cell-to-cell mobile. |
AT3G07160 | Encodes GSL10, a member of the Glucan Synthase-Like (GSL) family believed to be involved in the synthesis of the cell wall component callose. GSL10 is required for male gametophyte development and plant growth. Has a role in entry of microspores into mitosis. GSL10 mutation leads to perturbation of microspore division symmetry, irregular callose deposition and failure of generative cell engulfment by the vegetative cell cytoplasm. Also refer to GSL8 (At2g36850). |
AT3G59100 | encodes a protein similar to callose synthase |
AT2G31960 | encodes a protein similar to callose synthase |
AT4G03550 | Encodes a callose synthase that is required for wound and papillary callose formation in response to fungal pathogens Erysiphe and Blumeria. Mutants are resistant to P. parasitica and exhibit an exaggerated PR1 response.Contributes to PAMP-induced basal defense. The mRNA is cell-to-cell mobile. |
AT5G54800 | Encodes glucose6-Phosphate/phosphate transporter 1. Essential for pollen maturation and embryo sac development. The mRNA is cell-to-cell mobile. |
AT5G13110 | Encodes a plastidic glucose-6-phosphate dehydrogenase that is sensitive to reduction by DTT and whose mRNA is most highly expressed in root. |
AT1G09420 | Encodes a protein similar to glucose-6-phosphate dehydrogenase but, based on amino acid differences in the active site and lack of activity, does not encode a functional G6PDH. The amino acid sequence for the consensus sequence of the G6PDH active site (DHYLGKE) differs in three places in this protein. gc exon splice site at 20574 is based on protein alignment, and is not confirmed experimentally. |
AT2G25450 | Encodes a 2-oxoacid-dependent dioxygenase involved in the production of 2-hydroxybut-3-enyl glucosinolate. |
AT3G01640 | AtGlcAK is a sugar kinase able to phosphorylate D-GlcA to D-GlcA-1-phosphate in the presence of ATP. |
AT1G65960 | glutamate decarboxylase (GAD2) The mRNA is cell-to-cell mobile. |
AT2G02000 | glutamate decarboxylase 3;(source:Araport11) |
AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
AT5G18170 | Encodes the 43 kDa alpha-subunit of the glutamate dehydrogenase with a putative mitochondrial transit polypeptide and NAD(H)- and alpha-ketoglutarate-binding domains. Mitochondrial localization confirmed by subcellular fractionation. Combines in several ratios with GDH2 protein (GDH-beta) to form seven isoenzymes. Catalyzes the cleavage of glycine residues. May be involved in ammonia assimilation under conditions of inorganic nitrogen excess. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
AT3G04110 | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
AT5G48410 | member of Putative ligand-gated ion channel subunit family |
AT5G11210 | member of Putative ligand-gated ion channel subunit family |
AT1G42540 | member of Putative ligand-gated ion channel subunit family |
AT5G04140 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. The mRNA is cell-to-cell mobile. |
AT2G41220 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile. |
AT5G63570 | Encodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced. The mRNA is cell-to-cell mobile. |
AT4G23100 | Encodes the enzyme glutamate-cysteine ligase catalyzing the first, and rate-limiting, step of glutathione biosynthesis. Required for cell proliferation at the root tip. Involved in susceptibility to the bacterial pathogen Pseudomonas syringae. Mutants are phytoalexin defective. |
AT1G23310 | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway. |
AT1G15040 | Encodes a nitrogen regulated putative glutamine amidotransferase that represses shoot branching. |
AT4G25760 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
AT5G37600 | encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
AT3G17820 | encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium The mRNA is cell-to-cell mobile. |
AT1G48470 | Encodes cytosolic glutamine synthase isozyme. Expression of mRNA is not detectable in roots. |
AT5G35630 | chloroplastic glutamine synthetase The mRNA is cell-to-cell mobile. |
AT3G47340 | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
AT2G25080 | Encodes glutathione peroxidase. The mRNA is cell-to-cell mobile. |
AT2G31570 | glutathione peroxidase GPx |
AT2G43350 | Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1. |
AT4G11600 | Encodes glutathione peroxidase. Exhibits moderate binding affinity with dinotefuran. |
AT1G63460 | Encodes GPX8 (glutathione peroxidase 8). Involved in the suppression of oxidative damages in nucleus and cytosol. The mRNA is cell-to-cell mobile. |
AT1G49860 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
AT2G02380 | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). |
AT2G30870 | early dehydration-induced gene ERD13 homologous to tobacco and maize glutathione S-transferases. Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002) |
AT2G47730 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
AT2G30860 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
AT2G29450 | Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002) |
AT2G29490 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G59670 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G59700 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
AT1G10360 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G78380 | Encodes a glutathione transferase that is a member of Tau GST gene family. Expression is induced by drought stress, oxidative stress, and high doses of auxin and cytokinin. naming convention according to Wagner et al. (2002) The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
AT1G78340 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G17170 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). It is involved in the detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plants over-expressing At1g17170 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT. |
AT3G43800 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
AT2G29460 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). Role in the degradation of H2O2 to water using glutathione as electron donor |
AT2G29440 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT2G29420 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). Induced by Salicylic acid. Independent of NPR1 for their induction by salicylic acid. |
AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT2G02390 | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. It functions in vitro as a maleylacetoacetate isomerase and is likely to be involved in tyrosine catabolism. |
AT3G24170 | Encodes a cytosolic glutathione reductase. |
AT3G04120 | encodes cytosolic GADPH (C subunit) involved in the glycolytic pathway but also interacts with H2O2 potentially placing it in a signalling cascade induced by ROS. The mRNA is cell-to-cell mobile. |
AT1G79530 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
AT1G16300 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
AT1G80380 | encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. |
AT4G25840 | glycerol-3-phosphatase 1;(source:Araport11) |
AT3G47420 | Encodes a Pi starvation-responsive protein AtPS3. A member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
AT4G17550 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
AT1G02390 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
AT4G01950 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
AT5G06090 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
AT5G41080 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
AT1G71340 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
AT1G74210 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
AT5G45350 | proline-rich family protein;(source:Araport11) |
AT4G19200 | Glycine and proline rich protein.Mutants have increased size. |
AT5G17650 | glycine/proline-rich protein;(source:Araport11) |
AT4G38680 | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. |
AT2G22660 | Encodes a member of a family of DUF1399 domain containing proteins. GRDP1 is involved in germination and response to ABA. Loss of function mutants have reduced germination in the presence of osmotic stressors. |
AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
AT2G05520 | Encodes a glycine-rich protein that is expressed mainly in stems and leaves. AtGRP3 functions in root size determination during development and in Al stress. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to desiccation. The mRNA is cell-to-cell mobile. |
AT2G05380 | glycine-rich protein 3 short isoform (GRP3S) mRNA, complete The mRNA is cell-to-cell mobile. |
AT2G16260 | pseudogene of glycine-rich RNA-binding protein |
AT3G14420 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. The mRNA is cell-to-cell mobile. |
AT3G14415 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. The mRNA is cell-to-cell mobile. |
AT4G18360 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. |
AT1G21360 | glycolipid transfer protein 2;(source:Araport11) |
AT3G21260 | Glycolipid transfer protein (GLTP) family protein;(source:Araport11) |
AT5G49720 | Encodes a membrane-bound endo-1,4-beta-D-glucanase, involved in cellulose biosynthesis. Loss-of-function mutants have severe cellulose-deficient phenotypes. During cell elongation, KOR1 is associated with Golgi apparatus and early endosome. Inhibition of cellulose biosynthesis promoted a redistribution of KOR1 in subcellular locations. These observations suggest that deposition of cellulose involves the intracellular cycling of KOR1. |
AT1G70710 | endo-1,4-beta-glucanase. Involved in cell elongation. |
AT4G39010 | Cellulase involved in cell wall modification during valve dehiscence. |
AT1G23210 | glycosyl hydrolase 9B6;(source:Araport11) |
AT1G75680 | glycosyl hydrolase 9B7;(source:Araport11) |
AT2G32990 | glycosyl hydrolase 9B8;(source:Araport11) |
AT2G44290 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT2G44300 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT3G22570 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G55260 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G73550 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
AT4G37690 | Unlike its close paralog MUCI10 (At2g22900), GT6 is not required for the biosynthesis of seed coat mucilage. GT6 is preferentially expressed in sub-epidermal cell layers of the seed coat. |
AT1G32930 | Galactosyltransferase family protein;(source:Araport11) |
AT2G31350 | Encodes a mitochondrial glyoxalase 2 that can accommodate a number of different metal centers and with the predominant metal center being Fe(III)Zn(II). |
AT1G11840 | Encodes Ni+ dependent glyoxalase I homolog ATGLX1. |
AT5G41650 | Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl stress. |
AT5G57040 | Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl,drought and high light stress. |
AT2G32090 | Lactoylglutathione lyase / glyoxalase I family protein;(source:Araport11) |
AT1G53580 | Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site. |
AT1G15380 | Glyoxalase which affects ABA?JA crosstalk. |
AT1G80160 | Vicinal oxygen chelate (VOC) superfamily member. |
AT1G13980 | Encodes a GDP/GTP exchange factor for small G-proteins of the ADP ribosylation factor (RAF) class, and as regulator of intracellular trafficking. Homologous to Sec7p and YEC2 from yeast. Involved in the specification of apical-basal pattern formation. Essential for cell division, expansion and adhesion. It appears that heteotypic binding between the DCB and C-terminal domains of two GNOM proteins is required for membrane association, however, GNOM appears to exist predominantly as a heterodimer formed through DCB-DCB interactions. BFA inhibits GNOM trafficking and BFA resistant lines are more resistant to cold stress. |
AT5G44190 | Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. |
AT5G14950 | Encodes a golgi alpha-mannosidase, an enzyme responsible for the formation of major complex-type N-glycans. |
AT2G13650 | Encodes a Golgi-localized GDP-mannose transporter. It can transport ADP-glucose in vitro. |
AT5G19980 | Encodes a Golgi-localized nucleotide-sugar transporter. |
AT1G15880 | Golgi SNARE 11 protein (GOS11) |
AT2G45200 | Encodes a member of the GOS1 (Golgi SNARE) gene family. |
AT1G18190 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC2 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (508?668 aa) portion of the protein. |
AT1G31140 | Encodes a B-sister MADS-box protein, GORDITA which is specific to the Brassicaceae. GOA is the most closely related paralog of ABS. GOA represses fruit growth and contributes to integument development. Over-expression of GOA results in disorganized floral structure and addition of carpel-like features to sepals. |
AT1G64990 | Encodes a GPCR-type G protein receptor with nine predicted transmembrane domains. The protein binds abscisic acid (ABA) and is predicted to function as an ABA receptor. It has GTP-binding and GTPase activity and binds to ABA more effectively in the presence of GDP. GTG1 binds to GPA1, the alpha subunit of the heterotrimeric G protein. GPA1 (in its GTP-bound state) affects the GTP binding and GTPase activity of GTG1 and may act to down-regulate GTG1 binding to ABA. GTG1 is widely expressed throughout the plant and appears to be involved in the regulation of several ABA-dependent responses including seed germination, plant development, and promotion of stomatal closure. GTG1 transcript levels do not appear to change in response to ABA or abiotic stresses. |
AT1G50900 | Encodes GDC1 (Grana Deficient Chloroplast 1), an ankyrin domain containing protein required fro chloroplast thylakoid grana formation. The mRNA is cell-to-cell mobile. |
AT5G58960 | Mutant plants display impaired light-regulation of the hypocotyl randomization response. |
AT5G13370 | IBA - specific acyl acid amido synthetase which conjugates glutamine to IBA. It is involved in generating inactive and/or storage forms of IBA in the seedling, root, and silique. May play a role in auxin homeostasis by modulating the levels of IBA for peroxisomal conversion to IAA. |
AT4G32430 | GRS1 is a mitochondrial PLS-type PRR protein required for RNA editing and plant development. |
AT3G47120 | GDS1is a member of the C3H-type zinc finger family of proteins. Mutants display growth defects due to reduced cell number and size. |
AT2G22840 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower |
AT2G36400 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower. |
AT5G53660 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
AT4G24150 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
AT5G13190 | Encodes a plasma membrane localized LITAF domain protein that interacts with LSD1 and acts as a negative regulation of hypersensitive cell death. |
AT1G06390 | encodes a GSK3/shaggy-like protein kinase. Gene expression is induced by NaCl and ABA but not KCl, suggesting that this gene may be involved in response to osmotic stress. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts. |
AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
AT5G28300 | Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor. |
AT5G64300 | encodes GTP cyclohydrolase II that can functionally complement E. coli mutant deficient in this gene. It also has 3,4-dihydroxy-2-butanone-4-phosphate synthase activity which makes it a bifunctional enzyme involved in the formation of the pyrimidine and of the carbohydrate from GTP and ribulose-5-phosphate, respectively The mRNA is cell-to-cell mobile. |
AT5G28050 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
AT3G57550 | guanylate kinase |
AT2G41880 | Guanylate kinase. Involved in nucleotide metabolism. |
AT2G38840 | Guanylate-binding family protein;(source:Araport11) |
AT5G46070 | Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Within membraneless organelles termed GBPL defence-activated condensates (GDACs), directly binds defence-gene promoters and recruited specifc transcriptional coactivators of the Mediator complex and RNA polymerase II machinery to massively reprogram host gene expression for disease resistance. |
AT5G05930 | guanylyl cyclase 1;(source:Araport11) |
AT2G18960 | Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA. The mRNA is cell-to-cell mobile. |
AT5G62670 | H[+]-ATPase 11;(source:Araport11) |
AT3G60330 | H[+]-ATPase 7;(source:Araport11) |
AT1G17100 | Encodes a cytosolic heme binding protein(cHBP)that can reversibly bind tetrapyrroles including heme, protoporphyrin IX and Mg-protoporphyrin IX dimethyl ester with distinct binding affinities. |
AT5G20140 | Encodes a haem-binding protein, HBP5. HBP5 binds haem and interacts with the haem oxygenase, HY1. Disrupting the binding of HBP5 to HY1 leads to oxidative stress. |
AT4G28490 | Member of Receptor kinase-like protein family. Controls the separation step of floral organ abscission. The mRNA is cell-to-cell mobile. |
AT1G28440 | HAESA-like 1;(source:Araport11) |
AT5G65710 | Encodes a protein controlling the separation step of floral organ abscission.Necessary for pathogen-triggered leaf abscission. |
AT2G35230 | Contains a plant-specific VQ motif. Involved in endosperm growth and seed size determination. IKU1 is expressed in the early endosperm and its progenitor, the central cell.IKU1 interacts with MINI3 in the yeast two-hybrid system. |
AT2G45160 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
AT5G56250 | hapless 8;(source:Araport11) |
AT2G36450 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic overexpression of HRD increases the density of the root network and improves water and salt stress tolerance in Arabidopsis. Overexpression of HRD in rice causes an increase in plant biomass and drought resistance. |
AT2G43910 | HARMLESS TO OZONE LAYER 1;(source:Araport11) |
AT2G43920 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G09450 | Encodes a protein kinase that phosphorylates histone H3 at Thr3 and Thr11 and plays a role in mitotic cell division. |
AT3G61590 | F-box protein that is involved in some aspect of regulation of gene silencing by miRNA. Loss of function mutations have increased levels of some miRNAs. Its activity depends on the presence of functional F-box. |
AT1G06840 | Homomultimers interact with cytoplasmic signaling molecule PBL27, resulting in herbivory resistance, in an ethylene-dependent manner. |
AT5G10010 | myosin-H heavy protein;(source:Araport11) |
AT5G16820 | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. |
AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
AT1G74310 | Encodes ClpB1, which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. Involved in refolding of proteins which form aggregates under heat stress. Also known as AtHsp101. AtHsp101 is a cytosolic heat shock protein required for acclimation to high temperature. |
AT5G59720 | encodes a low molecular weight heat shock protein that contains the heat shock element in the promoter region. Expression is induced in response to heat shock. |
AT1G11660 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
AT1G16030 | heat shock protein 70B;(source:Araport11) |
AT4G18880 | Encodes a member of Heat Stress Transcription Factor(Hsf) family that is a substrate of the MPK3/MPK6 signaling and regulates stress responses. |
AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
AT3G22830 | member of Heat Stress Transcription Factor (Hsf) family |
AT3G51910 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
AT1G67970 | member of Heat Stress Transcription Factor (Hsf) family |
AT5G54070 | A member of Heat Stress Transcription Factor (Hsf) family. Not responding to heat stress. Is regulated by the seed-specific transcription factor ABI3. In turn, it regulates other heat stress proteins including Hsp17.4-CI, Hsp17.7-CII and Hsp101 during seed maturation. |
AT5G62020 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
AT3G24520 | member of Heat Stress Transcription Factor (Hsf) family |
AT3G02990 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
AT5G03720 | Member of Heat Stress Transcription Factor (Hsf) family. Expression is regulated by DREB2A and in turn HSFA3 regulates the expression of hsps Hsp18.1-CI and Hsp26.5-MII35S. Involved in establishing thermotolerence. |
AT1G22990 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G35060 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G35730 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G05220 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G06130 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G48970 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G16380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G23882 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G03380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
AT2G19110 | Encodes a protein with similarity to Zn ATPase. Can rescue Zn deficiency in yeast and Cd resistance, suggesting a role in Zn and Cd transport. The mRNA is cell-to-cell mobile. |
AT1G63440 | The Arabidopsis P-type ATPase HMA5 is involved in Cu detoxification. hma5 mutant plants exhibit Cu hypersensitivity, which is especially dramatic in roots where HMA5 is mostly expressed. |
AT5G67060 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development and acts as a local modulator of auxin and cytokinin responses to control gynoecium development. HEC1 affects auxin transport by acting as a transcriptional regulator of PIN1 and PIN3. Inhibits thermomorphogenesis. |
AT3G13440 | Encodes a HemK class glutamine‐methyltransferase that is involved in the termination of translation and essential for iron homeostasis. |
AT4G32690 | Encodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast. |
AT2G24150 | heptahelical transmembrane protein HHP3 |
AT4G37680 | heptahelical transmembrane protein HHP4 |
AT4G30850 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
AT3G46290 | Encodes HERCULES1 (HERK1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
AT5G63620 | Encodes an oxidoreductase involved in transducing the perception of E-2-hexenal, which changes the redox status of the mitochondria. |
AT2G19860 | Encodes a protein with hexokinase activity (AtHXK2) and acts as a sensor for plant sugar responses. |
AT5G14570 | Encodes ATNRT2.7, a nitrate transporter that controls nitrate content in seeds. Expression is detected in reproductive organs and peaks in seeds. Localized to the vacuolar membrane. |
AT5G62940 | HCA2 induces the formation of interfascicular cambium and regulates vascular tissue development in the aerial parts of the plant. Evidence from both gain of function and dominant negative alleles. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT5G15802 | chaperone;(source:Araport11) |
AT3G15095 | Encodes HCF243 (high chlorophyll fluorescence), a chloroplast-localized protein involved in the D1 protein stability of the photosystem II complex1. |
AT5G36170 | Required for normal processing of polycistronic plastidial transcripts |
AT1G14900 | Encodes a protein belonging to the subgroup of HMGA (high mobility group A) proteins that interact with A/T-rich stretches of DNA. |
AT1G48620 | This gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation. |
AT1G20693 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile. |
AT1G20696 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile. |
AT2G17560 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
AT1G07430 | Encodes a member of the group A protein phosphatase 2C (PP2C) family that is responsible for negatively regulating seed dormancy. |
AT1G23200 | ProPME pectin methyl esterase involved in embryo development. |
AT1G18370 | Encodes a kinesin HINKEL. Required for cytokinesis in pollen. Mutant has cytokinesis defects; seedling lethal. |
AT1G27320 | Encodes a histidine kinases, a cytokinin receptor that controls cytokinin-mediated leaf longevity through a specific phosphorylation of the response regulator, ARR2. The mRNA is cell-to-cell mobile. |
AT1G80100 | AHP6 lacks the conserved histidine residue (Asn83 in AHP6b), which is required for phosphotransfer, present in the other AHPs. AHP6 does not appear to have phosphotransfer activity. Acts as an inhibitor of cytokinin signaling by interacting with the phosphorelay machinery. Expressed in developing protoxylem and associated pericycle cell files. Negative regulator of cytokinin signaling. Expression is down-regulated by cytokinins. There are two alternatively spliced genes for this locus, AHP6a and AHP6b, differing in the length of the first exon. In ahp6-2 seedlings, only the AHP6a transcript is present. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
AT1G61270 | Involved in transport of 1-Aminocyclopropane-1-carboxylic acid (ACC). |
AT5G48545 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
AT5G63890 | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |
AT3G46100 | histidyl-tRNA synthetase |
AT1G06760 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
AT3G27360 | Histone superfamily protein;(source:Araport11) |
AT4G40030 | Histone superfamily protein;(source:Araport11) |
AT4G40040 | Histone superfamily protein;(source:Araport11) |
AT1G79000 | Homologous to CREB-binding protein, a co-activator of transcription with histone acetyl-transferase activity. No single prior lysine acetylation is sufficient to block HAC1 acetylation of the H3 or H4 peptides, suggesting that HAC1, HAC5, and HAC12 can acetylate any of several lysines present in the peptides. HAM2 acetylates histone H4 lysine 5. A plant line expressing an RNAi construct targeted against HAC1 has reduced rates of agrobacterium-mediated root transformation. |
AT3G54610 | Encodes a histone acetyltransferase that plays a role in the determination of the embryonic root-shoot axis. It is also required to regulate the floral meristem activity by modulating the extent of expression of WUS and AG. In addition, it is involved in stem cuticular wax accumulation by modulating CER3 expression via H3K9/14 acetylation. In other eukaryotes, this protein is recruited to specific promoters by DNA binding transcription factors and is thought to promote transcription by acetylating the N-terminal tail of histone H3. The enzyme has indeed been shown to catalyse primarily the acetylation of H3 histone with only traces of H4 and H2A/B being acetylated. Non-acetylated H3 peptide or an H3 peptide that had been previously acetylated on K9 both serve as excellent substrates for HAG1-catalyzed acetylation. However, prior acetylation of H3 lysine 14 blocks radioactive acetylation of the peptide by HAG1. HAG1 is specific for histone H3 lysine 14. |
AT5G64610 | Encodes an enzyme with histone acetyltransferase activity. HAM1 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM1. HAM1 acetylates histone H4 lysine 5. |
AT4G33470 | Encodes HDA14, a member of the histone deacetylase family proteins that can deacetylate a-tubulin, associates with a/b-tubulin and is retained on GTP/taxol-stabilized microtubules, at least in part, by direct association with the PP2A-A2 subunit. The association of a histone deacetylase with PP2A suggests a direct link between protein phosphorylation and acetylation. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. |
AT1G08460 | histone deacetylase 8;(source:Araport11) |
AT1G51060 | Encodes HTA10, a histone H2A protein. The mRNA is cell-to-cell mobile. |
AT5G02560 | Encodes HTA12, a histone H2A protein. |
AT5G27670 | Encodes HTA7, a histone H2A protein. |
AT2G38810 | Encodes HTA8, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA9 and HTA11) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z. |
AT3G59960 | histone-lysine N-methyltransferase ASHH4;(source:Araport11) |
AT3G21820 | histone-lysine N-methyltransferase ATXR2;(source:Araport11) |
AT3G01470 | Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33). |
AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile. |
AT3G01220 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Expressed during seed germination in the micropylar endosperm and in the root cap, and increases ABA sensitivity and seed dormancy when mutated. The mRNA is cell-to-cell mobile. |
AT1G26960 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Participates in the gene regulatory network controlling root branching by mediating the regulation of LAX3 by ARF7/19. |
AT5G39760 | Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation. |
AT2G18350 | homeobox protein 24;(source:Araport11) |
AT5G42780 | Zinc finger and homeobox domain protein which interacts with RMB1 and ROS1 acting in the base excision repair pathway through DNA methylation. |
AT5G15210 | Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family. |
AT3G28920 | homeobox protein 34;(source:Araport11) |
AT5G65310 | Encodes a class I HDZip (homeodomain-leucine zipper) protein that is a positive regulator of ABA-responsiveness, mediating the inhibitory effect of ABA on growth during seedling establishment. |
AT5G53980 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
AT2G22430 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. |
AT5G46880 | homeobox-7;(source:Araport11) |
AT3G60390 | Encodes homeobox protein HAT3. |
AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
AT3G61150 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT1G05230 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Mutants have trichomes that appear glass-like under a dissecting microscope as compared to the wild-type trichomes. The mutations do not affect trichome growth or branch number. |
AT2G32370 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Together with ATML1 and PDF2, it is involved in cotyledon development. |
AT5G54080 | Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism. |
AT1G66240 | homolog of anti-oxidant 1;(source:Araport11) |
AT2G18300 | DNA-binding bHLH protein involved in positive regulation of cell elongation and proliferation and, negative control of plant immunity.One component of PRE-IBH1-HBI1 tripartite module. |
AT1G55805 | BolA-like family protein;(source:Araport11) |
AT3G50450 | Homolog of RPW8 |
AT3G50480 | Homolog of RPW8 |
AT3G07740 | encodes a transcriptional adaptor ADA2a that interacts with histone acetyltransferase GCN5 homolog and CBF1 |
AT4G30510 | yeast autophagy 18 B-like protein;(source:Araport11) |
AT3G56440 | yeast autophagy 18 D-like protein;(source:Araport11) |
AT5G54730 | yeast autophagy 18 F-like protein;(source:Araport11) |
AT1G54710 | autophagy 18h-like protein;(source:Araport11) |
AT1G10030 | Encodes a protein that functions as a scaffolding platform for coassembling the sterol C4 demethylation enzyme complex. It also plays an essential role in the maintenance of polar auxin transport (PAT) by restricting the release and accumulation of 4-carboxy-4-methyl-24-methylenecycloartanol (CMMC), a PAT inhibitor. |
AT1G65040 | Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). |
AT5G19855 | Encodes a chloroplast stromal localized RbcX protein that acts as a chaperone in the folding of Rubisco. |
AT1G17550 | Protein Phosphatase 2C |
AT4G37580 | involved in apical hook development. putative N-acetyltransferase |
AT1G70690 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
AT4G31750 | Encodes HopW1-1-Interacting protein 2 (WIN2). Interacts with the P. syringae effector HopW1-1. WIN2 has protein phosphatase activity. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320). |
AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
AT4G32010 | Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing. |
AT5G10630 | Transcripts of this gene are alternatively spliced to encode either HBS1, a decoding factor translational GTPase, or SKI7, a component of the cytosolic RNA exosome. |
AT3G63070 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. The mRNA is cell-to-cell mobile. |
AT1G17560 | Encodes HUELLENLOS (HLL), a mitochondrial ribosome protein, similar to L14 ribosomal protein of eubacteria. HLL is essential for normal ovule development. |
AT3G49660 | Encodes a structural core component of a COMPASS-like H3K4 histone methylation complex. |
AT5G62490 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. |
AT4G24960 | Homologous to a eukaryote specific ABA- and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. The mRNA is cell-to-cell mobile. |
AT1G75700 | HVA22-like protein G;(source:Araport11) |
AT1G20050 | C-8 sterol isomerase that also plays a role in miRNA function. |
AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile. |
AT5G48930 | At5g48930 has been shown to encode for the hydroxycinnamoyl-Coenzyme A shikimate/quinate hydroxycinnamoyltransferase (HCT) both synthesizing and catabolizing the hydroxycinnamoylesters (coumaroyl/caffeoyl shikimate and quinate) involved in the phenylpropanoid pathway. Influence on the accumulation of flavonoids which in turn inhibit auxin transport and reduce plant growth. The mRNA is cell-to-cell mobile. |
AT4G20930 | Encodes a 3-hydroxyisobutyrate dehydrogenase. |
AT5G08280 | Encodes a protein with porphobilinogen deaminase activity. This protein is targeted to the chloroplast. Mutants spontaneously develop chlorotic leaf lesions in the absence of pathogen attack, resembling the phenotype of lesion-mimic mutants. It has been shown to interact with the PPR protein AtECB2 for chloroplast RNA editing. |
AT2G45630 | Hydroxyphenylpyruvate reductase (HPPR) family member with low activity. |
AT5G13500 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
AT5G53340 | Encodes a hydroxyproline O-galactosyltransferase. |
AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT5G51570 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT1G72770 | mutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C; regulates the activation of the Snf1-related kinase OST1 by abscisic acid. The mRNA is cell-to-cell mobile. |
AT1G67700 | multidrug resistance protein;(source:Araport11) |
AT5G61460 | Encodes SMC6B (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6B), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
AT3G21760 | Encodes HYR1, a UDP glycosyltransferase (UGT). HYR1 glucosylates hypostatin, an inhibitor of cell expansion in vivo to form a bioactive glucoside. |
AT3G01100 | unknown protein, has cDNAs and ESTs associated to it |
AT5G24650 | HP30/Tric1 is a component of the mitochondrial protein translocation complex and is involved in tRNA transport along with HP30-2/Tric2.It interacts with several members of the TOM complex such as TOM40 and this interaction is mediated by the SAM domain. Role in protein import into chloroplasts. |
AT5G66985 | hypothetical protein;(source:Araport11) |
AT3G27770 | plant/protein;(source:Araport11) |
AT1G05575 | transmembrane protein;(source:Araport11) |
AT3G10020 | plant/protein;(source:Araport11) |
AT1G33055 | hypothetical protein;(source:Araport11) |
AT4G24110 | NADP-specific glutamate dehydrogenase;(source:Araport11) |
AT3G10040 | Encodes HRA1 (HYPOXIA RESPONSE ATTENUATOR1), a low oxygen-inducible transcription factor. |
AT3G03270 | HRU1 is a hypoxia induced universal stress protein. It exists as two splice variants with AT3G03270.2 , which contains a putative dimerization domain, the predominant transcript found under anoxia. It is induced by RAP2.12. Subcellular localization is dynamic; under anoxia the localization of HRU1 shifts from cytoplasm to the plasma membrane. |
AT3G48030 | Mitochondria localized, hypoxia induced gene similar to rice HIGD. |
AT5G27760 | Hypoxia-responsive family protein;(source:Araport11) |
AT1G24180 | Arabidopsis thaliana pyruvate dehydrogenase E1a-like subunit. 81% identical to a previously characterized Arabidopsis mitochondrial PDH E1a-subunit, At1g59900. Serine 296 phosphorylation of IAR4 has critical function in root hair formation and root development. Changing Ser296 in IAR4 to Ala resulted in a phenotype intermediate between mutant and wild-type, while substitution to Asp was either lethal or caused an extreme dwarf phenotype. |
AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
AT1G44350 | encodes a protein similar to IAA amino acid conjugate hydrolase. |
AT3G02875 | Hydrolyzes amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA), including IAA-Leu and IAA-Phe. Uses Mg and Co ions as cofactors. |
AT5G54140 | encodes a protein similar to IAA amino acid conjugate hydrolase |
AT1G18660 | Membrane localized protein of unknown function. Involved in negative regulation of immune response. Mutants have increased resistance to pathogens. |
AT4G30410 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT2G31580 | ICA1 is a nuclear localized member of the tRNA(His) guanylyl transferase superfamily. Loss of function alleles show increased sensitivity to growth at high temperatures defects in cell cycle progression and DNA repair. |
AT2G43060 | ILI1 binding bHLH 1;(source:Araport11) |
AT1G33950 | Avirulence induced gene (AIG1) family protein;(source:Araport11) |
AT1G33970 | IAN9 is a member of a small family of proteins. It's expression is repressed upon pathogen infection and loss of function mutants show increased resistance to bacterial pathogens. |
AT4G31180 | The IBI1 gene encodes an aspartyl tRNA synthetase (AspRS). In addition, the IBI1 protein acts as a receptor protein of the chemical plant defence activator beta-aminobutyric acid (BABA). Binding of IBI1 to the active R-enantiomer of BABA primes non-canonical defence activity of the AspRS protein against pathogen attack. |
AT1G18670 | Encodes a cyclin-dependent kinase-like protein with a ser/thr protein kinase domain and an N-terminal myristoylation sequence. Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
AT5G03070 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
AT1G48490 | Protein kinase which together with IREH1 plays an important role in controlling root skewing and maintaining the microtubule network. |
AT5G11470 | SG1 is a Bromo-Adjacent Homology (BAH) domain containing protein involved in CHG methylation within genebodies. Loss of function results in pleiotrophic developmental effects that increase after 4 generations. |
AT4G18570 | Microtubule associated protein involved in cortical microtubule organization. |
AT3G13810 | indeterminate(ID)-domain 11;(source:Araport11) |
AT1G68130 | Encodes the longer of two splice variants of a transcription factor involved in regulating starch metabolism in response to cold. |
AT3G50700 | zinc finger protein, similar to maize Indeterminate1 (ID1) |
AT2G02080 | C2H2 BIRD transcription factor family. |
AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
AT1G55110 | indeterminate(ID)-domain 7;(source:Araport11) |
AT1G21100 | O-methyltransferase family protein;(source:Araport11) |
AT1G21120 | O-methyltransferase family protein;(source:Araport11) |
AT1G21110 | O-methyltransferase family protein;(source:Araport11) |
AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
AT4G14560 | auxin (indole-3-acetic acid) induced gene (IAA1) encoding a short-lived nuclear-localized transcriptional regulator protein. The mRNA is cell-to-cell mobile. |
AT4G28640 | Auxin induced gene, IAA11 (IAA11). Check the Comments field on the locus page to view updated sequence annotation. |
AT1G04550 | IAA12/BDL plays a role in auxin-mediated processes of apical-basal patterning in the embryo. bdl mutants lack a primary root meristem |
AT1G51950 | indole-3-acetic acid inducible 18;(source:Araport11) |
AT3G15540 | Primary auxin-responsive gene. Involved in the regulation stamen filaments development. |
AT3G23030 | auxin inducible gene expressed in the nucleus |
AT2G46990 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA20 lacks the conserved degron (domain II) found in many family members, and IAA20 fusion proteins are stable in Arabidopsis seedlings. IAA20 transcripts are induced by auxin treatment, and overexpression of IAA20 leads to defects in gravitropism, root development, root meristem maintenance, etiolation, and cotyledon vascular development. |
AT1G15050 | Belongs to auxin inducible gene family. |
AT1G15580 | auxin induced protein |
AT4G05530 | Encodes a peroxisomal member of the short-chain dehydrogenase/reductase (SDR) family of enzymes. Loss of IBR1 function causes increased resistance to indole-3-butyric acid without affecting plant responses to IAA, NAA, and 2,4-D. This enzyme may be responsible for catalyzing a dehydrogenation step in the beta-oxidation-like conversion of IBA to IAA. The mRNA is cell-to-cell mobile. |
AT4G14430 | Encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation. This enzyme might also be involved in the conversion of indole-3-butyric acid to indole-3-acetic acid via a beta-oxidation-like pathway. |
AT2G22670 | Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. The mRNA is cell-to-cell mobile. |
AT3G26744 | Encodes a MYC-like bHLH transcriptional activator that binds specifically to the MYC recognition sequences in the CBF3 promoter. It also binds to and inhibits the expression of ABI3. Mutants are defective in cold-regulated gene expression and ABA signaling druing seed germination.. Cold stress triggers protein degradation of nuclear GFPICE1 protein, and the RING finger protein HOS1 is required. Sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance. Together with ZOU, ICE1 determines primary seed dormancy depth independently of their joint role in endosperm development.ICE1 interacts with ABI5. Also members of the DELLA family, which repress ICE1 function. |
AT3G56370 | LRR-RLK with distinct polar localization within the plasma membrane in different cell types of the root. Mutants show defects in cell divisions within the root ground tissue. |
AT1G28760 | Encodes an orthlog of the Xenopus inner nuclear membrane (INM) protein Nemp1/TMEM194A. |
AT5G16760 | Encodes a inositol 1,3,4-trisphosphate 5/6-kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
AT4G08170 | Inositol 1,3,4-trisphosphate 5/6-kinase family protein;(source:Araport11) |
AT2G43980 | inositol 1,3,4-trisphosphate 5/6-kinase 4;(source:Araport11) |
AT1G47510 | Encodes a phosphatidylinositol polyphosphate 5-phosphatase. It can dephosphorylate PI(4,5)P2, PI(3,5)P2, and PI(3,4,5)P3, but, it is not active against PI(5)P or the water soluble inositol(1,4,5)P3 or inositol(1,3,4,5)P4. The transcript levels for this gene rise in response to auxin, ABA, and JA. |
AT2G01900 | Encodes an inositol polyphosphate phosphatidylinositol 5-phosphatase that is expressed in roots and is involved in mediating salt tolerance through endocytosis. |
AT2G43330 | Encodes a tonoplast-localized myo-inositol exporter, involved in efflux of myo-inositol from the vacuole to the cytosol. The gene is ubiquitously expressed. Reduced root growth in knock-out mutants grown on low inositol agar medium. |
AT1G30220 | Inositol transporter presenting conserved extracellular loop domains homologs of plexins/semaphorin/integrin (PSI) domains from animal type I receptors. |
AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
AT5G42810 | Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. Is also required for growth and modulates phosphate homeostasis at the transcriptional level. |
AT2G43900 | Encodes a 5-inositol-phosphate phosphatase, that, in vitro, shows activity against IP(1,4,5). |
AT1G17140 | Encodes a ROP/RAC effector, designated interactor of constitutive active ROPs 1 (ICR1), that interacts with GTP-bound ROPs. ICR1 is a scaffold mediating formation of protein complexes that are required for cell polarity. ICR1 is comprised of coiled-coil domains and forms complexes with itself and the exocyst vesicle-tethering complex subunit SEC3. |
AT3G05820 | Encodes a putative plastid-targeted alkaline/neutral invertase.Expression is induced by salt, osmotic and ABA treatments. Loss of function affects mitochondrial functioning and ROS production. |
AT3G07170 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT1G48280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G09710 | Ca(2+)-dependent calmodulin-binding protein. Targeted to the nucleus. Involved in glucosinolate metabolism in response to biotic challenge. Expressed in vascular tissue.Member of IQ67 (CaM binding) domain containing family. |
AT3G59690 | Member of IQ67 (CaM binding) domain containing family. |
AT2G43680 | Member of IQ67 (CaM binding) domain containing family. |
AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
AT4G00820 | Member of IQ67 (CaM binding) domain containing family. |
AT1G01110 | Member of IQ67 (CaM binding) domain containing family. |
AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
AT5G03040 | Member of IQ67 (CaM binding) domain containing family. |
AT3G51380 | Ca2+ dependent Calmodulin binding protein. |
AT3G49260 | IQ-domain 21;(source:Araport11) |
AT4G23060 | Member of IQ67 (CaM binding) domain containing family. |
AT5G62070 | Member of IQ67 (CaM binding) domain containing family. |
AT5G07240 | Member of IQ67 (CaM binding) domain containing family. |
AT3G16490 | Member of IQ67 (CaM binding) domain containing family. |
AT1G14380 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
AT3G52290 | Member of IQ67 (CaM binding) domain containing family. |
AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
AT2G38460 | Encodes IRON REGULATED1 (IREG1/FPN1), one of the Arabidopsis orthologs (AT2G38460/IREG1/FPN1 and AT5G03570/IREG2/FPN2) the iron efflux transporter ferroportin (FPN) identified in animals. |
AT1G60960 | Encodes a plasma membrane localized zinc/iron transporter. |
AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
AT5G67230 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
AT5G15630 | Encodes a member of the COBRA family, similar to phytochelatin synthetase. Involved in secondary cell wall biosynthesis. Mutants make smaller plants with reduced levels of cellulose and cell wall sugars. |
AT4G30370 | RING/U-box superfamily protein;(source:Araport11) |
AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
AT2G17130 | Encodes a regulatory subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. |
AT5G03290 | Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. The mRNA is cell-to-cell mobile. |
AT3G02780 | Encodes a protein with isopentenyl diphosphate:dimethylallyl diphosphate isomerase activity. There is genetic evidence that it functions in the mevalonate, but not the MEP biosynthetic pathway. |
AT5G19040 | Encodes cytokinin synthase. |
AT5G14200 | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. Encodes methylthioalkylmalate dehydrogenase. Involved in glucosinolate biosynthesis, in methionine chain elongation. The mRNA is cell-to-cell mobile. |
AT3G45300 | Encodes isovaleryl-coenzyme a dehydrogenase. Mutants have increases in 12 seed free amino acids, accumulation of seed homomethionine and 3-isovaleroyloxypropyl-glucosinolate, with a concomitant decrease in seed 3-benzoyloxypropyl-glucosinolate. The mRNA is cell-to-cell mobile. |
AT1G34220 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT2G19710 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT1G79910 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
AT2G39330 | jacalin-related lectin 23;(source:Araport11) |
AT3G16450 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
AT3G22160 | VQ motif-containing protein. JAV1 is a repressor of jasmonate-mediated defense responses. |
AT5G13220 | Plants overexpressing At5g13220.3, but not At5g13220.1 showed enhanced insensitivity to MeJa. |
AT3G43440 | jasmonate-zim-domain protein 11;(source:Araport11) |
AT5G20900 | jasmonate-zim-domain protein 12;(source:Araport11) |
AT3G17860 | JAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine. |
AT1G48500 | Jasmonate zim domain transcription factor family protein.Involved in freezing tolerance and JA iduceed leaf senesence. |
AT1G17380 | jasmonate-zim-domain protein 5;(source:Araport11) |
AT1G72450 | JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. |
AT2G34600 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
AT5G10650 | JUL1 encode a RING-type E3 ubiquitin ligase that is involved in JA responses. It ubiquitinates the JAV1 jasmonic acid response repressor which is then degraded by the proteosome. Participates in ABA-mediated microtubule depolymerization, stomatal closure, and tolerance response to drought stress. |
AT2G26490 | JGB contains seven WD40 repeats and is highly conserved in flowering plants. Overexpression inhibits pollen germination. suggesting JGB is a negative regulator of pollen germination |
AT1G30810 | JMJ18 encodes a novel JmjC domain- containing histone H3K4 demethylase. PHD finger-containing protein. |
AT1G60160 | Member of the KT/KUP/HAK family of proton-coupled potassium transporters which have potential effect on cellular expansion. |
AT4G00630 | Encodes a K(+)/H(+) antiporter that modulates monovalent cation and pH homeostasis in plant chloroplasts or plastids. |
AT4G04850 | Encodes a potassium efflux antiporter; has three splice forms KEA3.1, KEA3.2, and KEA3.3, KEA3.2 is the most abundant splice form in all plant organs (silique, flower, leaf and root). KEA3.1 and KEA3.3 are minor variants that can be found in flowers and in leaves. KEA3 is localized to the thylakoid membrane and enriched in the stromal lamellae. It allows proton efflux from the thylakoid lumen by proton/potassium antiport. |
AT2G19600 | member of Putative potassium proton antiporter family |
AT5G51710 | member of Putative potassium proton antiporter family |
AT4G33530 | potassium transporter |
AT1G70300 | potassium transporter |
AT5G09400 | Encodes a potassium uptake permease with a functional adenylate cyclase (AC) center. The first 100 aa of this protein can complement AC-deficient E. coli and display AC activity in vitro. KUP7 is localized to the plasma membrane where it functions in potassium uptake and translocation. |
AT4G19960 | Encodes a potassium ion transmembrane transporter. Also mediates cesium uptake when expressed in E. coli. The mRNA is cell-to-cell mobile. |
AT3G02050 | potassium transporter KUP3p (KUP3) |
AT5G16560 | Encodes a KANADI protein (KAN) that regulates organ polarity in Arabidopsis. KAN is required for abaxial identity in both leaves and carpels, and encodes a nuclear-localized protein in the GARP family of putative transcription factors. Together with KAN2, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN2 and KAN4, KAN1 appears to be required for proper regulation of PIN1 in early embryogenesis. |
AT1G32240 | Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis. |
AT4G17695 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G31350 | KAR-UP F-box 1;(source:Araport11) |
AT4G37470 | HTL belonging to the alpha/beta fold hydrolase superfamily. Mutant and over-expression studies indicates its involvement in seedling de-etiolation process. Involved in the perception of karrikins. Interacts with MAX2. Important for cotyledon expansion. |
AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
AT3G61980 | Encodes a Kazal-type serine proteinase inhibitor that is highly expressed in seedlings and flowers. |
AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
AT1G26945 | Encodes a basic helix-loop-helix (bHLH) protein involved in blue/far-red light signaling. Physically interacts with HFR1 and negatively regulates its activity. |
AT4G14950 | KMS1 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
AT2G17220 | Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated. |
AT3G02880 | Probable inactive receptor kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins from the three affinity chromatography systems with LPS chemotype Xcc 8530 as ligand. |
AT5G19280 | kinase associated protein phosphatase composed of three domains: an amino-terminal signal anchor, a kinase interaction (KI) domain, and a type 2C protein phosphatase catalytic region |
AT4G32250 | Encodes a component of the TOC machinery that phosphorylates import receptors, supports pre-protein import, and contributes to efficient chloroplast biogenesis. |
AT4G32295 | histone acetyltransferase;(source:Araport11) |
AT5G54670 | Encodes a truncated KatC polypeptide (KatC(207-754)), which includes the carboxyl-terminal region of KatC. This was expressed in Escherichia coli and was shown to possess microtubule-stimulated ATPase activity. |
AT1G21730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G12020 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G39050 | Kinesin motor family protein;(source:Araport11) |
AT4G10840 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
AT1G67160 | Member of a family of proteins containing an F-box domain at the N-terminal region and three kelch repeats at the C-terminal region. Involved in BR signaling. Co-suppressed KIB1,2,3,4 lines have a dwarf phenotype and resemble BR receptor mutants. |
AT3G50630 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Gene was isolated from a yeast two hybrid screen as an interacting protein of CDC2A. Recombinant protein has a strong kinase inhibitor activity in vitro. Transcript is expressed in all tissues examined but is differentially distributed from ICK1. Controls the onset of the endoreduplication cycle through inhibition of CDKA;1. The KRP2 protein abundance is regulated by proteolysis through CDKB1;1 phosphorylation. |
AT2G32710 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI). A member of seven KRP genes found in Arabidopsis thaliana. Negative regulator of cell division. Expressed in actively dividing cells. |
AT3G19150 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility. |
AT1G80440 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB20, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
AT2G44130 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family. Component of SCF ubiquitin protein ligase, interacts with phenylalanine ammonia-lyase. AtKFB39 is a homolog of previously identified AtKFB50 (At3g59940) and specifically interacts with Arabidopsis PAL3 and PAL4 in vitro. In planta, together with AtKFB01, KFB20 and KFB50, it regulates PAL protein stability thus controlling phenylpropanoid biosynthesis . |
AT4G08150 | A member of class I knotted1-like homeobox gene family (together with KNAT2). Similar to the knotted1 (kn1) homeobox gene of maize. Normally expressed in the peripheral and rib zone of shoot apical meristem but not in the leaf primordia. It is also expressed in the fourth floral whorl, in the region that would become style, particularly in the cell surrounding the transmitting tissue. No expression was detected in the first three floral whorls. Expression is repressed by auxin and AS1 which results in the promotion of leaf fate. |
AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
AT1G65610 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
AT1G73260 | Encodes a trypsin inhibitor involved in modulating programmed cell death in plant-pathogen interactions. |
AT2G46750 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
AT5G11540 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
AT2G46740 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
AT3G62130 | Encodes an enzyme that decomposes L-cysteine into pyruvate, H2S, and NH3. |
AT1G01220 | Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis. |
AT4G33670 | Encodes a L-galactose dehydrogenase, involved in ascorbate biosynthesis |
AT3G10050 | first enzyme in the biosynthetic pathway of isoleucine |
AT5G60270 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G60300 | Encodes a legume-type lectin receptor kinase that is structurally distinct from the mammalian extracellular ATP receptors and acts as an extracellular ATP receptor in Arabidopsis. Extracellular ATP acts as a damage-associated molecular pattern in plants, and its signaling through P2K1 is important for mounting an effective defense response against various pathogenic microorganisms. It also plays a role in cell wall-plasma membrane adhesion. |
AT2G37710 | Induced in response to Salicylic acid. The mRNA is cell-to-cell mobile. |
AT4G02410 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G32800 | protein kinase family protein;(source:Araport11) |
AT3G46760 | Protein kinase superfamily protein;(source:Araport11) |
AT5G55830 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G59700 | Member of Receptor kinase-like protein family. Represses stomatal immunity induced by Pseudomonas syringae pv. tomato DC3000. |
AT3G08870 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G53380 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G01540 | Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity. |
AT5G46250 | RNA-binding protein;(source:Araport11) |
AT5G09360 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT1G13580 | Encodes a ceramide synthase that together with LOH1 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26). |
AT1G01060 | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
AT1G01470 | Encodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against desiccation. |
AT2G35300 | Encodes LEA4-2/LEA18, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. |
AT1G32560 | Encodes LEA4-1, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. |
AT5G06760 | Encodes LEA4-5, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. Most of the diverse set of LEA proteins can be grouped according to properties such as high hydrophilicity and high content of glycine or other small amino acids in what has been termed hydrophilins. LEA4-5 protects enzyme activities from the adverse effects induced by freeze-thaw cycles in vitro. |
AT3G21420 | LATERAL BRANCHING OXIDOREDUCTASE (LBO), encodes an oxidoreductase-like enzyme of the 2-oxoglutarate and Fe(II)-dependent dioxygenase superfamily. It is involved in the biosynthesis of strigolactones. |
AT2G42430 | LOB-domain protein gene LBD16. This gene contains one auxin-responsive element (AuxRE). Regluates lateral root formation. |
AT5G12330 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Expressed in lateral root primordia and induced by auxin. SWP1 is involved in the repression of LRP1 via histone deacetylation. |
AT1G55580 | Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching. |
AT1G67360 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
AT5G16550 | Lipid droplet protein associated with LDAP3. |
AT3G22990 | Armadillo-repeat containing protein. Involved in leaf and flower development. Located in nucleus. Broadly expressed throughout vegetative and floral tissues. LFR is functionally associated with AS2 to mediate leaf development. |
AT1G27340 | Encodes a putative F-box protein that is involved in the regulation of leaf morphology. |
AT1G18390 | Serine/Threonine kinase family catalytic domain protein;(source:Araport11) |
AT1G25390 | Protein kinase superfamily protein;(source:Araport11) |
AT5G61850 | Encodes transcriptional regulator that promotes the transition to flowering.Involved in floral meristem development. LFY is involved in the regulation of AP3 expression, and appears to bring the F-box protein UFO to the AP3 promoter. Amino acids 46-120 define a protein domain that mediates self-interaction. |
AT3G03310 | lecithin:cholesterol acyltransferase 3;(source:Araport11) |
AT1G03475 | Encodes coproporphyrinogen III oxidase, a key enzyme in the biosynthetic pathway of chlorophyll and heme, a tetrapyrrole pathway. Mutants express cytological and molecular markers associated with the defense responses, usually activated by pathogen infection. |
AT4G20380 | LSD1 monitors a superoxide-dependent signal and negatively regulates a plant cell death pathway. contains zinc-finger motifs. LSD1 negatively regulates a basal defense pathway that can act upstream or independently of both NIM1/NPR1 function and SA accumulation following avirulent or virulent pathogen challenge |
AT1G65540 | LETM1-like protein;(source:Araport11) |
AT3G24480 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G18670 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
AT1G07650 | Leucine-rich repeat receptor-like kinase with extracellular malectin-like domain, which possesses cell death induction activity in plant leaves. |
AT1G12040 | encodes a a chimeric leucine-rich repeat/extensin protein that regulates root hair morphogenesis and elongation. Null mutants develop root hairs that frequently abort, swell, or branch. Gene is expressed in root hair cells and protein is specifically localized in the wall of the hair proper. The mRNA is cell-to-cell mobile. |
AT2G15880 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
AT4G33970 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
AT4G13340 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
AT1G49490 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
AT4G30920 | Encodes LAP2, an aminopeptidase playing key roles in senescence, stress response and amino acid turnover. |
AT4G32551 | LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors. |
AT3G04290 | Li-tolerant lipase 1;(source:Araport11) |
AT4G10340 | photosystem II encoding the light-harvesting chlorophyll a/b binding protein CP26 of the antenna system of the photosynthetic apparatus The mRNA is cell-to-cell mobile. |
AT5G01530 | light harvesting complex photosystem II;(source:Araport11) |
AT2G40100 | Lhcb4:3 protein (Lhcb4.3, light harvesting complex of photosystem II The mRNA is cell-to-cell mobile. |
AT1G15820 | Lhcb6 protein (Lhcb6), light harvesting complex of photosystem II. |
AT3G04510 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT2G31160 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT1G07090 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT4G18610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT3G47470 | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
AT5G47110 | Encodes a light-harvesting-like protein that is involved in chlorophyll and tocopherol biosynthesis anchoring geranylgeranyl reductase in the thylakoid membrane. |
AT1G78600 | light-regulated zinc finger protein 1;(source:Araport11) |
AT2G46260 | Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. LRBs physically interact with photoexcited and phosphorylated CRY2, at the CCE domain of CRY2, to facilitate polyubiquitination and degradation of CRY2 in response to blue light. |
AT1G77690 | Encodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia. |
AT5G01240 | Encodes LAX1 (LIKE AUXIN RESISTANT), a member of the AUX1 LAX family of auxin influx carriers. Required for the establishment of embryonic root cell organization. |
AT2G21050 | Encodes LAX2 (LIKE AUXIN RESISTANT), a member of the AUX1 LAX family of auxin influx carriers. Required for the establishment of embryonic root cell organization. |
AT1G43130 | like COV 2;(source:Araport11) |
AT3G01510 | Encodes a putative phosphatase, LSF1, required for normal starch turnover in leaves. |
AT1G15080 | Encodes phosphatidic acid phosphatase. Involved in ABA signaling. Functions as a negative regulator upstream of ABI4. Expressed during germination and seed development. Expressed overall in young seedlings, in roots, hypocotyls, and vascular cells of cotyledons and leaves of 10 day-old seedlings, in flower filaments and stem elongation zones. Not expressed in anthers, pollen nor petals. |
AT5G03080 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene, LPPgamma appears to be more important for diacylglycerol formation than LPPepsilon1 and LPPepsilon2 in the plastids. Heterozygous lppgamma mutants produce pollen that have defects in pollen tube germination and no homozygous mutants have been recovered. The mRNA is cell-to-cell mobile. |
AT2G38530 | Involved in lipid transfer between membranes and plays a role in maintaining the integrity of the cuticle-cell wall interface. Belongs to a family of Lipid transfer proteins. Sequence similarity to other plant/Arabidopsis LPT genes but highest similarity to LPT1. Stress and pathogen-inducible motifs found in the upstream region. Expressed in flower, leaves and siliques but absent in roots. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT4G21220 | Trimeric LpxA-like enzymes superfamily protein;(source:Araport11) |
AT3G45140 | Chloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis.Mutants are resistant to Staphylococcus aureus and accumulate salicylic acid upon infection. The mRNA is cell-to-cell mobile. |
AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
AT1G67230 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
AT1G13220 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
AT5G65770 | Encodes a protein that localizes to the nuclear periphery and affects nuclear morphology. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
AT2G45420 | LOB domain-containing protein 18;(source:Araport11) |
AT3G11090 | LOB domain-containing protein 21;(source:Araport11) |
AT4G00210 | LOB domain-containing protein 31;(source:Araport11) |
AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
AT3G49940 | LOB domain-containing protein 38;(source:Araport11) |
AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
AT5G19080 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
AT5G47040 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
AT2G28305 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT5G06300 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
AT1G77590 | Encodes major plastidic long chain acyl-CoA synthetase with a slight substrate preference of oleic acid over any of the other fatty acids. |
AT5G23670 | Encodes the LCB2 subunit of serine palmitoyltransferase, an enzyme involved in sphingosine biosynthesis. The protein is localized to the endoplasmic reticulum. |
AT2G02450 | NAC domain containing protein 35;(source:Araport11) |
AT3G05970 | encode peroxisomal long-chain acyl-CoA synthetase (LACS) isozymes |
AT5G27600 | Encode peroxisomal long-chain acyl-CoA synthetase. Activates fatty acids for further metabolism. Interacts with PEX5. |
AT2G04350 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT2G46090 | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
AT3G09770 | Encodes a ubiquitin E3 ligase LOG2 (LOSS OF GDU2). Required for GLUTAMINE DUMPER1(GDU1)-induced amino secretion. |
AT4G34120 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. The mRNA is cell-to-cell mobile. |
AT4G36910 | Encodes a single cystathionine beta-synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
AT1G73060 | Low PSII Accumulation 3;(source:Araport11) |
AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
AT3G50970 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer freeze tolerance. Located in membranes. mRNA upregulated by water deprivation and abscisic acid. The mRNA is cell-to-cell mobile. |
AT5G47010 | Required for nonsense-mediated mRNA decay. Involved in RNA interference. lba1 mutants has reduced sugar-induced expression of Atb- amylase, is hypersensitive to glucose and abscisic acid and resistant to mannose, and shows early flowering, short day-sensitive growth, and seed germination phenotypes. The mRNA is cell-to-cell mobile. |
AT5G48543 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT1G28335 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G28405 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G07005 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G28355 | low-molecular-weight cysteine-rich 5;(source:Araport11) |
AT4G30064 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT1G73607 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G02100 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. The mRNA is cell-to-cell mobile. |
AT1G32540 | Encodes a protein with 3 plant-specific zinc finger domains that acts as a positive regulator of cell death. |
AT4G21610 | Contains the same novel zinc finger motif with LSD1, a negative regulator of cell death and defense response. Due to differential splicing, it encodes two different proteins, one of which contains an additional, putative DNA binding motif. Northern analysis demonstrated that LOL2 transcripts containing the additional DNA binding motif are predominantly upregulated after treatment with both virulent and avirulent Pseudomonas syringae pv maculicola strains. |
AT3G13682 | Encodes a homolog of human Lysine-Specific Demethylase1. Involved in H3K4 methylation of target genes including the flowering loci FLC and FWA. |
AT4G35760 | Encodes a bimodular enzyme comprising an integral domain homologous to the catalytic subunit of mammalian vitamin K epoxide reductase (VKORC1, EC 1.1.4.1) that is fused to a soluble thioredoxin-like moiety. Using yeast microsomes as a recombinant system, it was shown that the VKORC1 domain of At4g35760 functions as a stringent naphthoquinone reductase, and that its reduced Trx-like partner can serve as its electron donor. Located in plastid. Required for the assembly of photosystem II. Can catalyze disulfide bond formation in vitro. |
AT4G31080 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
AT5G57030 | Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase |
AT5G40780 | Encodes LHT1 (lysine histidine transporter), a high-affinity transporter for cellular amino acid uptake in both root epidermis and leaf mesophyll. |
AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
AT3G14840 | Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. The mRNA is cell-to-cell mobile. |
AT3G01840 | Encodes a putative LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it was determined to be a pseudo kinase since lack of the ATP-binding P-loop in the kinase domain. |
AT1G51940 | Encodes a LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity.It is required for the suppression of defense responses in absence of pathogen infection or upon abscisic acid treatment. Loss-of-function mutants display enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum. Its expression is repressed by pathogen infection and biological elicitors and is induced abscisic acid.Expression is strongly repressed by elicitors and fungal infection, and is induced by the hormone abscisic acid (ABA). Insertional mutants show increased expression of PHYTOALEXIN-DEFICIENT 3 (PAD3), enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum infection and reduced physiological responses to ABA, suggesting that LYK3 is important for the cross-talk between signaling pathways activated by ABA and pathogens (PMID:24639336). |
AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
AT3G57650 | Encodes an endoplasmic reticulum localized protein with lysophosphatidyl acyltransferase activity. |
AT3G18850 | lysophosphatidyl acyltransferase 5;(source:Araport11) |
AT1G80950 | Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 16:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds. |
AT2G45670 | Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 20:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds. |
AT1G52760 | Encodes caffeoyl shikimate esterase and is involved in lignin biosynthesis. CSE converts caffeoyl shikimate to caffiate. Loss of function mutations have reduced lignin content and collapsed vessel elements. It is also reported to function as a lysophospholipase 2 (LysoPL2) involved in tolerance to cadmium-induced oxidative stress. Binds Acyl-CoA-binding protein 2 (ACBP2). |
AT1G12640 | Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds. |
AT5G04710 | Plastid localized metalloaminopeptidase. |
AT1G22730 | MA3 domain-containing protein;(source:Araport11) |
AT3G48390 | MA3 domain-containing protein;(source:Araport11) |
AT5G65080 | Is upregulated during vernalization and regulates flowering time. Encodes MADS-domain protein. Two variants encoding proteins of 198 and 184 amino acids have been reported. |
AT5G22830 | Transmembrane magnesium transporter that is essential for chloroplast development and photosynthesis. One of nine family members. |
AT1G16010 | Transmembrane magnesium transporter. One of nine family members. |
AT5G09690 | Transmembrane magnesium transporter. One of nine family members. Loss of function mutants exhibit poor growth under magnesium stress conditions. Splice variant AT5G09690.1 (386 aa) is a functional transporter while AT5G09690.4 (371 aa) does not have transporter activity. |
AT5G64560 | Transmembrane magnesium transporter that is located in plasma membrane of microspores to take up Mg from the locule. One of 9 family members. |
AT4G25080 | Encodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope. |
AT3G47700 | Involved in transportation of seed storage proteins from the ER to the vacuole. Mutant seed cell accumulates the precursors of 12S globulin and 2S albumin instead of the vacuolar-located mature proteins. Member of MAG2 complex, involved in the development of vegetative organs. |
AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
AT1G68990 | MGP3 (male gametophyte-defective 3) belongs to a small family of nuclear-encoded Phage type RNA polymerases (RPOTs) involved in the transcription of mitochondrial genes in Arabidopsis thaliana. Mutation in MGP 3 significantly retarded pollen tube growth and caused defective embryo development. |
AT4G01220 | Encodes MGP4 (MALE GAMETOPHYTE DEFECTIVE 4), a rhamnogalacturonan II xylosyltransferase important for growth of pollen tubes and roots. |
AT3G10920 | manganese superoxide dismutase (MSD1) |
AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants. |
AT1G01560 | Member of MAP Kinase family. Flg22-induced activation is blocked by AvrRpt2. |
AT2G01450 | MPK17 Map kinase family member. Mutants have increased numbers of peroxisomes a phenotype that can be suppressed by mutations in PMD1. This and other treatments, suggests a function in control of peroxisome proliferation in salt stress. |
AT3G14720 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
AT2G42880 | member of MAP Kinase |
AT4G11330 | MAP kinase |
AT2G43790 | Encodes a MAP kinase induced by pathogens, ethylene biosynthesis, oxidative stress and osmotic stress.Also involved in ovule development. Homozygous mutants in a MPK3 heterozygous background are female sterile due to defects in integument development.MPK6 appears to be associated with the microsomal compartment and may be involved in mediating secretory processes. The mRNA is cell-to-cell mobile. |
AT2G18170 | MAP kinase 7;(source:Araport11) |
AT3G18040 | Encodes a protein with similarity to MAP kinases (MAPK9).Expressed preferentially in guard cells and appears to be involved in reactive oxygen species mediated ABA signaling. |
AT3G06230 | member of MAP Kinase Kinase |
AT1G73500 | member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3. |
AT1G80180 | Encodes a substrate of the MAPK kinases. Phenotypic analyses of Arabidopsis expressing phosphorylation site mutant forms of At1g80180.1 showed clustered stomata and higher stomatal index in cotyledons expressing the phosphomimetic form of At1g80180.1. Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
AT1G15400 | Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
AT2G15890 | Encodes CBP1, a regulator of transcription initiation in central cell-mediated pollen tube guidance. |
AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
AT2G34090 | maternal effect embryo arrest 18;(source:Araport11) |
AT3G02570 | Encodes a protein with phosphomannose isomerase activity. |
AT4G04040 | Encodes a pyrophosphate-dependent phosphofructokinase B subunit (PFPbeta2). |
AT4G37300 | maternal effect embryo arrest 59;(source:Araport11) |
AT5G45800 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G02240 | F-box family protein;(source:Araport11) |
AT3G10110 | Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11) |
AT4G34830 | Encodes MRL1, a conserved pentatricopeptide repeat protein, required for stabilization of rbcL mRNA. |
AT3G59350 | Pti-like protein. Interacts with CLV1 and functions in CLE peptide signaling pathway in root development. Membrane localization is dependent on palmytolation. |
AT4G08850 | MIK1 encodes a receptor kinase that forms a complex with MDIS1/MIK2 and binds LURE1, the female pollen guidance chemi-attractant. MIK1 phosphorylates MDIS1 and is autophosphorylated. |
AT5G12080 | Encodes a mechanosensitive (or stretch-activated) ion channel in the plasma membrane with a moderate preference for anions.Cell death activity is negatively regulated by phosphorylation while mechanosensitive properties are unaffected. |
AT3G14810 | mechanosensitive channel of small conductance-like 5;(source:Araport11) |
AT5G03220 | Encodes together with its paralog MED7B a subunit of the middle module of the transcriptional co-regulator Mediator complex. Regulates genes required for normal development of etiolated seedlings. |
AT1G02580 | Encodes the imprinted gene MEA that belongs to Polycomb Repressive Complex 2 (PRC2) and has a SET domain for methyltransferase activity and is involved in the stable transcriptional silencing of target genes. It negatively regulates seed development in the absence of fertilization. Mutations in this locus result in embryo lethality. MEA is imprinted in the endosperm. The maternal allele is expressed and the paternal allele is silent. MEA is controlled by DEMETER (DME), a DNA glycosylase required to activate MEA expression, and METHYLTRANSFERASE I (MET1), which maintains CG methylation at the MEA locus. MEA is involved in the negative regulation of its own imprinted gene expression; the effect is not only allele-specific but also dynamically regulated during seed development. In the ovule, the MEA transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization |
AT3G10820 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT5G09850 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT3G09180 | Mediator complex subunit. |
AT2G03070 | Encodes a subunit of the Mediator complex. Regulates plant defense and flowering. |
AT5G07930 | A member of mei2-like gene family; phylogenetic analysis revealed that it belongs to the fourth clade of mei2-like proteins, with conserved C-terminal RNA recognition motif (RRM) only. |
AT2G42890 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML2 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. AML2 is expressed during early embryo development (heart and torpedo stage) and predominantly in vegetative organs; no significant accumulation was detected in floral apices. |
AT5G07290 | AML4 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML4 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM14. AML4 is expressed during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
AT5G61960 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices. |
AT1G29400 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
AT3G02980 | Encodes MEIOTIC CONTROL OF CROSSOVERS1 (MCC1), a GCN5-related histone N-acetyltransferase. MCC1 appeared to be required in meiosis for normal chiasma number and distribution and for chromosome segregation. Activation tagging line has increased level of histone H3 acetylation. |
AT5G54260 | DNA repair and meiotic recombination protein, component of MRE11 complex with RAD50 and NBS1 |
AT5G45420 | The gene encodes a MYB transcription factor belons to R2R3-MYB family of transcription factors. Knock-down mutant analysis indicates its role in root hair elongation. |
AT1G77870 | membrane-anchored ubiquitin-fold protein 5 precursor;(source:Araport11) |
AT1G64080 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT5G52870 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT5G52900 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT2G36900 | member of Membrin Gene Family |
AT4G21750 | Encodes a homeobox protein similar to GL2. It is expressed in both the apical and basal daughter cells of the zygote as well as their progeny. Expression is detected starting the two-celled stage of embryo development and is later restricted to the outermost, epidermal cell layer from its inception. Its promoter is highly modular with each region contributing to specific aspects of the gene's spatial and temporal expression. Double mutant analysis with PDF2, another L1-specific gene, suggests that their functions are partially redundant and the absence of both of the genes result in abnormal shoot development. |
AT3G08880 | Encodes a kinetochore hub-protein that is required for chromosome segregation to ensure proper cell division and the maintenance of plant architecture. |
AT1G79340 | Encodes MCP2d, the predominant and constitutively expressed member of type II metacaspases (MCPs). MCP2d plays a positive regulatory role in biotic and abiotic stress-induced programmed cell death (PCD). Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. The mRNA is cell-to-cell mobile. |
AT1G79310 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
AT3G12100 | Cation efflux family protein;(source:Araport11) |
AT1G07600 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage. |
AT5G56795 | one of the five metallothioneins (MTs) genes identified in Arabidopsis. MTs are cysteine-rich proteins required for heavy metal tolerance. The MT1b gene, however, is indicated to be inactive. |
AT1G07610 | one of the five metallothioneins (MTs) genes identified in Arabidopsis. MTs are cysteine-rich proteins required for heavy metal tolerance. The mRNA is cell-to-cell mobile. |
AT3G09390 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage |
AT5G02380 | cysteine-rich protein with copper-binding activity |
AT3G15353 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage |
AT2G36880 | methionine adenosyltransferase 3;(source:Araport11) |
AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
AT3G17390 | S-adenosylmethionine synthetase |
AT3G01120 | encodes a cystathionine gamma-synthase, which performs the first committed step in methionine biosynthesis. A conserved motif of 13 amino acids in the first exon is required for posttranscriptional autoregulation. This enzyme shares the same substrate as threonine synthase (TS) and its absence transcriptionally affects 8 genes in the genome. |
AT2G18030 | Peptide methionine sulfoxide reductase family protein;(source:Araport11) |
AT4G04800 | methionine sulfoxide reductase B3;(source:Araport11) |
AT4G04810 | methionine sulfoxide reductase B4;(source:Araport11) |
AT4G04840 | methionine sulfoxide reductase B6;(source:Araport11) |
AT5G17920 | Encodes a cytosolic cobalamin-independent methionine synthase, involved in methionine regeneration via the activated methyl cycle (SAM cycle). The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
AT3G29770 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
AT4G16690 | Encodes a protein shown to have carboxylesterase activity, methyl IAA esterase activity, and methyl jasmonate esterase activity in vitro. This protein does not act on MeSA, MeGA4, or MEGA9 in vitro. Although MES16 is similar to MES17, a MeIAA hydrolase, two mes16 mutant lines (SALK_151578) and (SALK_139756) do not show altered sensitivity to MeIAA in root growth assays. MES16 transcripts appear to be more than 10-fold less abundant than those of MES17 in roots. |
AT2G23610 | Encodes a protein shown to have carboxylesterase activity, methyl IAA esterase activity, and methyl jasmonate esterase activity in vitro. This protein does not act on methyl salicylate, MeGA4, or MEGA9 in vitro. |
AT4G37150 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES9 appears to be involved in MeSA hydrolysis in planta. Expression of MES9 can restore systemic acquired resistance in SAR-deficient tobacco plants. This protein does not act on MeGA4, or MEGA9 in vitro. |
AT1G15340 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT3G15790 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT3G63030 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT5G59380 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. The mRNA is cell-to-cell mobile. |
AT1G22310 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT3G01460 | Encodes a protein with a methyl-CpG-binding domain. Has sequence similarity to human MBD proteins. Involved in the modification of the FLC chromatin acetylation state to affect FLC expression. Mutants show an early flowering, and enhanced shoot branching phenotypes. |
AT3G02790 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT5G16470 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT3G12290 | MTHFD1 encodes a cytoplasmic bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase that is involved in one carbon metabolism and control of DNA methylation. |
AT3G59970 | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
AT4G34840 | Encodes one of the 5'-methylthioadenosine nucleosidases (AT4G38800/MTN1; AT4G34840/MTN2). Double mutant, mtn1-1mtn2-1, retains approximately 14% of the MTN enzyme activity present in the wild type and displays a pleiotropic phenotype that includes altered vasculature and impaired fertility. |
AT2G38700 | Encodes mevalonate diphosphate decarboxylase, the enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in sterol and isoprenoid biosynthesis. The protein appears to form a homodimeric complex. Incidentally, it was shown that the Arabidopsis MVD protein could also interact with its yeast homolog to form a heterodimer. |
AT4G36270 | Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. |
AT5G10945 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC |
AT5G26147 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. miR156 limits plastochron length in developing leaf primordia. |
AT5G55835 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAAAGAGAGCAC |
AT3G10745 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCCAAAUGUAGACAAAGCA. Pri-mRNA coordinates for MIR158a (converted to TAIR10 based on PMID19304749): Chr3: 3366553-3366019 (reverse), length: 535 bp; exon coordinates: exon 1: 3366553 to 3366303, exon 2: 3366185 to 3366019; mature miRNA and miRNA* are located on exon 1. |
AT1G73687 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCUA. Functions redundantly with MIR159B. Plants that are doubly mutated for MIR159AB have curled leaves and reduced stature. Pri-mRNA coordinates for MIR159a (converted to TAIR10 based on PMID19304749): Chr1: 27713700-27712893 (reverse), length: 808 bp; exon coordinates: exon 1: 27713700 to 27712893, mature miRNA and miRNA* are located on exon 1. |
AT1G18075 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCUU. Functions redundantly with MIR159A. Plants that are doubly mutated for MIR159AB have curled leaves and reduced stature. |
AT5G08185 | Encodes a microRNA that targets DCL1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGAUAAACCUCUGCAUCCAG |
AT1G66725 | Encodes a microRNA that targets several SAMT family members. miR163, is highly expressed in A. thaliana diploids but down-regulated in A. thaliana autotetraploids and repressed in A. arenosa and A. suecica. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGAAGAGGACUUGGAACUUCGAU |
AT2G47585 | Encodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA. The miR164a pri-mRNA also encodes a regulatory peptide miPEP164a (AT2G47584) that regulates accumulation of its own miRNA. |
AT5G01747 | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA |
AT2G46685 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. This particular miRNA is involved in the regulation of vascular development in inflorescence stems, primarily through the regulation of mRNA cleavage of the class III homeodomain-leucine zipper transcription factor ATHB15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166a (converted to TAIR10 based on PMID19304749): Chr2: 19175959-19177071 (forward), length: 1113 bp; exon coordinates: exon 1: 19175959 to 19176341, exon 2: 19176820 to 19177071; mature miRNA and miRNA* are located on exon 1. |
AT3G61897 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166b (converted to TAIR10 based on PMID19304749): Chr3: 22921936-22923122 (forward), length: 1187 bp; exon coordinates: exon 1: 22921936 to 22922389, exon 2: 22922485 to 22922566, exon 3: 22922653 to 22923122; mature miRNA and miRNA* are located on exon 1. |
AT5G08717 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
AT3G22886 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. Essential for fertility of both ovules and anthers. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGAAGCUGCCAGCAUGAUCUA. Pri-mRNA coordinates for MIR167a (converted to TAIR10 based on PMID19304749): Chr3: 8108021-8108622 (forward), length: 602 bp; exon coordinates: exon 1: 8108021 to 8108622; mature miRNA and miRNA* are located on exon 1. |
AT1G31173 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAAGCUGCCAGCAUGAUCUGG |
AT4G19395 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
AT2G39885 | Encodes a microRNA that targets several TIR1/AFB family members and one bHLH family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCAAAGGGAUCGCAUUGAUCC. Targets are F-box proteins and bHLH transcription factor. Specifically cleaves AFB3 transcripts, controlling AFB3 mRNA accumulation in roots in response to nitrate exposure. Pri-mRNA coordinates for MIR393a (converted to TAIR10 based on PMID19304749): Chr2: 16652027-16652572 (forward), length: 546 bp; exon coordinates: exon 1: 16652027 to 16652572; mature miRNA and miRNA* are located on exon 1. |
AT5G35407 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUU. Expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
AT2G03445 | Encodes a microRNA that targets both CSD and CytC oxidase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGUGUUCUCAGGUCACCCCUU. Down-regulated by biotic and abiotic stress. |
AT5G14565 | Encodes a microRNA that targets both CSD and CytC oxidase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGUGUUCUCAGGUCACCCCUG. Down-regulated by biotic and abiotic stress. |
AT5G62162 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAGUUGCCCUG |
AT1G31358 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATTAACGCTGGCGGTTGCGGCAGC |
AT2G22668 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATGAGTTGGGTCTAACCCATAACT |
AT2G47015 | Encodes a microRNA that targets both a Laccase and Plantacyanin-like family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AUGCACUGCCUCUUCCCUGGC |
AT1G67195 | miRNA (MIR414). Has been identified as a translated small open reading frame by ribosome profiling. |
AT4G24415 | Encodes a microRNA that targets AGL16. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGACCAUUUGUGAGAAGGGA |
AT4G03039 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGUCCGGUUUUGGAUACGUG |
AT4G27765 | Encodes a microRNA that targets several MYB family members and the tasiRNA-generating transcript TAS4. Cleavage of the TAS4 transcript by miR828 initiates processing of TAS4 transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUUGCUUAAAUGAGUAUUCCA |
AT1G76062 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUCUUGCAUAUGUUCUUUAUC |
AT2G23347 | Encodes a microRNA that targets a ubiquitin ligase complex-associated protein kinase family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AAUGGUAAGAUUGCUUAUAAG |
AT3G48201 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: GAUGGAUAUGUCUUCAAGGAC |
AT5G15833 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AUGAAUUUGGAUCUAAUUGAG |
AT1G23060 | hypothetical protein;(source:Araport11) |
AT2G35630 | Member of the MAP215 family of microtubule-associated proteins required to establish interphase arrays of cortical microtubules.Mutants have defects in cytokinesis during pollen development. Vegetative phenotypes observed in temperature sensitive mutants include left-handed organ twisting, isotropic cell expansion and impairment of root hair polarity. The mRNA is cell-to-cell mobile. |
AT5G44610 | Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+. |
AT2G38720 | microtubule-associated protein 65-5;(source:Araport11) |
AT1G14690 | microtubule-associated protein 65-7;(source:Araport11) |
AT2G01750 | Encodes a microtubule associated protein (MAP70-3). Expressed in all tissues. |
AT1G14840 | Encodes a microtubule associated protein (MAP70-4). Expressed in all tissues. |
AT5G57170 | Chemokine-like MDL protein; modulates flowering time and innate immunity. |
AT3G51660 | Chemokine-like MDL protein; modulate flowering time and innate immunity in plants. |
AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G11310 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2. |
AT2G17430 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. Controls pollen tube reception in synergids. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO7 belongs to the clade III, with AtMLO5, AtMLO8, AtMLO9, and AtMLO10. The gene is expressed in vegetative organs (RT-PCR experiments)and in pollen grains, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT2G17480 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO8 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO9, and AtMLO10. The gene is expressed during seedling growth, in cotyledons and hypocotyl, and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G74660 | Encodes MINI ZINC FINGER 1 (MIF1) which has a zinc finger domain but lacks other protein motifs normally present in transcription factors. MIF1 physically interact with a group of zinc finger-homeodomain (ZHD) transcription factors, such as ZHD5 (AT1G75240), that regulate floral architecture and leaf development. Gel mobility shift assays revealed that MIF1 blocks the DNA binding activity of ZHD5 homodimers by competitively forming MIF1-ZHD5 heterodimers. Constitutive overexpression of MIF1 caused dramatic developmental defects, seedlings were non-responsive to gibberellin (GA) for cell elongation, hypersensitive to the GA synthesis inhibitor paclobutrazol (PAC) and abscisic acid (ABA), and hyposensitive to auxin, brassinosteroid and cytokinin, but normally responsive to ethylene. |
AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
AT2G20980 | Similar to MCM10, which in other organism was shown to be involved in the initiation of DNA replication. |
AT2G16440 | Regulates DNA replication via interaction with BICE1 and MCM7. |
AT1G26800 | MPSR1 is cytoplasmic E3 ligase that senses misfolded proteins independently of chaperones and targets those proteins for degradation via the 26S proteasome. Involved in the regulation of the homeostasis of sensor NLR immune receptors. |
AT1G09575 | Mitochondrial calcium channel. |
AT3G07480 | Forms an accessory complex I subunit that is part of the bridge domain, which connects the membrane and the peripheral arm of mitochondrial complex I. |
AT3G02330 | Involved in cytidine to uridine editing of the mitochondrial mRNA AtMg00510. |
AT2G46050 | E-PPR protein involved in mitochondrial RNA editing.It is involved in editing of the mitochondrial tatC transcript at site 581. |
AT4G14050 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G09950 | Encodes a DYW-class PPR protein required for RNA editing at four sites in mitochondria of A. thaliana. |
AT5G09590 | heat shock protein 70 (Hsc70-5); nuclear |
AT4G01400 | Pentatricopeptide Repeat Protein involved in splicing of nad4, nad 5, nad 1 and nad2 introns which affects biogenesis of the respiratory complex I. |
AT1G07030 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT3G15020 | Lactate/malate dehydrogenase family protein;(source:Araport11) |
AT5G64710 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT3G16480 | mitochondrial processing peptidase alpha subunit;(source:Araport11) |
AT1G54220 | Encodes a subunit of the mitochondrial pyruvate dehydrogenase complex. |
AT4G35490 | mitochondrial ribosomal protein L11;(source:Araport11) |
AT5G52630 | Encodes a member of the DYW subfamily of pentatricopeptide repeat (PPR) proteins. Loss of MEF1 function affects RNA editing at specific sites in the mitochondrial genome but do not exhibit obvious phenotypes. |
AT4G30700 | Encodes a pentatricopeptide repeat protein involved in mitochondrial RNA editing. |
AT2G46070 | Encodes a MAP kinase protein. MPK12 interacts with the IBR5 protein phosphatase in vitro and in vivo, and it can be dephosphorylated and inactivated by IBR5. MPK12 appears to be a negative regulator of auxin signlaing. MPK12 RNAi lines are hypersensitive to auxin in root elongation and transcriptional response assays, but they appear to have normal sensitivity to ABA. MPK12 is a nuclear protein and its kinase activity is increased following auxin treatment. MPK12 transcripts are widely expressed in seedlings, but MPK12 expression is stronger in guard cells than in other cell types in mature plants. |
AT4G36450 | member of MAP Kinase |
AT5G19010 | member of MAP Kinase |
AT1G53510 | Member of MAP Kinase familly. Target of MPKKK20 phosphorylation. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization. |
AT3G45640 | Encodes a mitogen-activated kinase whose mRNA levels increase in response to touch, cold, salinity stress and chitin oligomers.Also functions in ovule development. Heterozygous MPK3 mutants in a homozygous MPK6 background are female sterile due to defects in integument development. MPK3 can be dephosphorylated by MKP2 in vitro. The mRNA is cell-to-cell mobile. |
AT1G59580 | encodes a mitogen-activated kinase involved in innate immunity The mRNA is cell-to-cell mobile. |
AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
AT1G05100 | member of MEKK subfamily. Negatively regulated by RGLG1 and RGLG2; involved in drought stress tolerance. |
AT5G67080 | member of MEKK subfamily |
AT3G50310 | Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5. |
AT4G36950 | member of MEKK subfamily |
AT1G53570 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
AT1G01453 | HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals. |
AT2G41660 | Essential for hydrotropism in roots. Mutant roots are defective in hydrotropism, and have slightly reduced phototropism and modified wavy growth response. Has normal gravitropism and root elongation. |
AT1G35260 | MLP-like protein 165;(source:Araport11) |
AT5G45550 | Encodes a gene product involved in both sporogenesis and gametogenesis and is required for the normal progression of megasporogenesis and microsporogenesis. Additional alleles were isolated in a screen for enhancers of PID and genetic analysis indicates a role for MOB1A in auxin mediated signaling. |
AT3G16270 | Involved in the plant trans-Golgi network (TGN), where it is part of an adaptor protein (AP) complex to promote vesicle generation with different cargo specificity and destination. Interacts with AP-4, whose function is required for MTV1 recruitment. |
AT1G54030 | Encodes a vacuolar protein. Mutation causes organizational defects in the endoplasmic reticulum and aberrant protein trafficking in the plant secretory pathway. The mRNA is cell-to-cell mobile. |
AT4G24680 | Encodes MOS1 (MODIFIER OF snc1). MOS1 contains a BAT2 domain that is conserved in plants and animals. MOS1 associates with the promoter of SNC1 and regulates its expression. |
AT3G18165 | Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity. |
AT1G80310 | MOT2 encodes a molybdate transporter which locates to the vacuolar membrane. Loss-of-function (knock out) mutants show elevated molydate levels in rosette leaves and in fully senescent leaves, but decreased MoO4 levels in seeds. Under conditions of molybdate deficiency leaves from mot2::tDNA mutants show strongly reduced nitrate reductase activity. The mot2 gene is slightly expressed in young and mature leaves, but strongly in senescing leaves. This observation points to a function of MOT2 in molybdate transfer from leaves to seeds during plant senescence. |
AT3G27820 | Encodes a peroxisome membrane-bound monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
AT1G63940 | monodehydroascorbate reductase 6;(source:Araport11) |
AT4G31780 | Encodes an A-type monogalactosyldiacylglycerol (MGDG) synthase. It represents the isoform responsible for the bulk of MGDG synthesis in Arabidopsis. |
AT4G15760 | Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA). |
AT1G19850 | Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder. |
AT2G42620 | The mutations at MAX2 cause increased hypocotyl and petiole elongation in light-grown seedlings. Positional cloning identifies MAX2 as a member of the F-box leucine-rich repeat family of proteins. MAX2 is identical to ORE9, a proposed regulator of leaf senescence. Involved in positive regulation of light responses. The mRNA is cell-to-cell mobile. |
AT1G21920 | MRF1 is related to SET7/9 proteins but contains an atypical SET domain. It is expressed in phloem and mutants have a weak late flowering phenotype. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT4G02720 | Encodes an ortholog of NKAP (NF-kB activating protein), that interacts with splicing and ribosome biogenesis proteins, colocalizes with the 45S rDNA at the nucleolar organizer regions (NORs) and negatively regulates 45S rDNA expression. |
AT4G37295 | Encodes an 86 AA polypeptide sequence that produces an 11 AA secreted, bioactive peptide. It is induced by BD16. The peptide is bound by the RLK7 receptor kinase and inhibits the formation of lateral root founder cells. Homolog of prePIP1. |
AT1G28280 | VQ motif-containing protein;(source:Araport11) |
AT5G53830 | VQ motif-containing protein;(source:Araport11) |
AT5G10490 | A member of MscS-like gene family, structurally very similar to MSL3, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL2-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. |
AT1G58200 | A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity. |
AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
AT1G53500 | encodes a putative NDP-L-rhamnose synthase, an enzyme required for the synthesis of the pectin rhamnogalacturonan I, the major component of Arabidopsis mucilage. Gene is involved in seed coat mucilage cell development. Mutant analyses suggest that MUM4 is required for complete mucilage synthesis, cytoplasmic rearrangement and seed coat development. |
AT3G10320 | MUCI21 is a GT61 protein required for the production of highly branched xylan in seed coat mucilage. MUCI21 likely decorates xylan with xylose side chains that seem to be necessary for pectin attachment to the seed surface. |
AT1G28240 | strawberry notch protein (DUF616);(source:Araport11) |
AT2G22900 | Encodes MUCI10, a galactomannan-1,6-galactosyltransferase. MUCI10 likely decorates glucomannan, synthesized by CSLA2, with galactose residues in vivo. The degree of galactosylation is essential for the synthesis of the GGM backbone, the structure of cellulose, mucilage density, as well as the adherence of pectin. |
AT1G51340 | Encodes a root citrate transporter which together with the root malate transporter ALMT1 are the primary mechanism of aluminum tolerance. |
AT4G35050 | Encodes a WD-40 repeat protein similar to yeast MSI1. The predicted protein has a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
AT2G43290 | Calmodulin-like MSS3.Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
AT3G06860 | Encodes a multifunctional protein. Involved in peroxisomal fatty acid beta oxidation. Loss-of-function mutant lacks hydroxyacyl-CoA dehydrogenase activity and have reduced levels of long-chain enoyl-CoA hydratase activity. The mutant has fewer but larger peroxisomes. The mRNA is cell-to-cell mobile. |
AT1G04150 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
AT5G17980 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT3G57880 | Required for maintenance of inflorescence and shoot SAMs and normal development of the derived vascular cambium, functions in the SAM to promote continuous organogenesis, affects SAM development through STM, where it affects intracellular localization of STM in SAM cells in the peripheral region and prevents STM localization toward the cell wall of SAM cells in the peripheral region. |
AT1G22610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT4G11610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT1G20830 | Encodes MCD1 (MULTIPLE CHLOROPLAST DIVISION SITE 1). Determines the site of chloroplast division in concert with MinD (AT5G24020). |
AT3G06790 | Encodes a protein involved in RNA editing in mitochondria. Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
AT1G11430 | Encodes a protein involved in RNA editing in chloroplasts. The mRNA is cell-to-cell mobile. |
AT5G57880 | Encodes MULTIPOLAR SPINDLE 1 (MPS1), involved in meiotic spindle organization. |
AT2G42680 | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is developmentally regulated. The mRNA is cell-to-cell mobile. |
AT3G51160 | Catalyzes the first step in the de novo synthesis of GDP-L-fucose. Loss of function mutations result in reduced levels of fucosylation and decreased freezing tolerance. |
AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
AT1G75640 | Encodes a Leucine-Rich Repeat Receptor-Like Kinase MUSTACHES (MUS). Regulates stomatal bilateral symmetry. Mutants have abnormally shaped guard cells, absent or skewed stomatal pores. |
AT4G36180 | LRR-RLK which regulates lateral root development. |
AT3G04605 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
AT5G16505 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
AT3G05850 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
AT3G06120 | Encodes a basic helix-loop-helix (bHLH) protein that controls meristemoid differentiation during stomatal development. In the absence of MUTE, meristemoids abort after excessive asymmetric divisions and fail to differentiate stomata. MUTE expression in the meristemoid is required for SLGCs differentiation as pavement cells. Epidermal cells lose their competence to respond to MUTE overexpression during cotyledon development. |
AT3G55730 | putative transcription factor MYB109 (MYB109) mRNA, |
AT3G27785 | MYB118 encodes a myb transcription factor that represses endosperm maturation and, along with MYB115, regulates glucosinolate biosynthesis. |
AT1G06180 | member of MYB3R- and R2R3- type MYB- encoding genes |
AT3G23250 | Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity |
AT5G15310 | Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation. |
AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
AT2G47190 | Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin. |
AT1G66230 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
AT4G34990 | Member of the R2R3 factor gene family. |
AT5G06100 | Encodes a member of the myb family of transcription factors (MYB33), contains Pfam profile: PF00249 myb DNA-binding domain. Double mutants with MYB65 are male sterile- anthers are small, pollen development is defective. Spatial expression appears to be under the control of miR159, contains a target site for this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. When the target site is mutated, expression is detected in leaves, roots, anther filament, pistil. The expression of a translational fusion is specific to anther locules in contrast to constructs lacking the miR159 target site. Phenotype is conditional and can be restored by lower temperature or higher light intensity. |
AT5G60890 | Myb-like transcription factor that modulates expression of ASA1, a key point of control in the tryptophan pathway; mutant has deregulated expression of ASA1 in dominant allele. Loss of function allele suggests ATR1 also functions at a control point for regulating indole glucosinolate homeostasis. |
AT3G09370 | C-myb-like transcription factor (MYB3R3) mRNA. It is a target of CDK phosphorylation and blocks cell division in response to DNA damage. |
AT5G02320 | Encodes a putative c-MYB-like transcription factor of the MYB3R factor gene family (MYB3R5). |
AT4G38620 | Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. The mRNA is cell-to-cell mobile. |
AT3G48920 | Member of the R2R3 factor gene family. |
AT5G12870 | Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea. |
AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
AT5G54230 | MYB49 transcription factor. Binds to and promotes expression of genes involved in cadmium accumulation. Interacts with ABI5 which acts as a repressor preventing MYB49 induced expression of target genes. |
AT3G18100 | Member of the R2R3 transcription factor gene family. |
AT3G13540 | Encodes a member of the MYB family of transcriptional regulators. MYB5 act as a negative regulator of trichome branching and play a role in the correct formation of the seed coat and possibly the formation the underlying endosperm layers. Loss of function mutations have defects in seed coat mucilage and columella cells as well as trichome defects (smaller and reduced number of branches). |
AT1G18570 | Encodes a member of the R2R3-MYB transcription family. Involved in indole glucosinolate biosynthesis. The mRNA is cell-to-cell mobile. |
AT4G09460 | Encodes myb6 DNA-binding protein. The mRNA is cell-to-cell mobile. |
AT1G08810 | putative transcription factor of the R2R3-MYB gene family. Transcript increases under conditions that promote stomatal opening (white and blue light, abi1-1 mutation) and decreases under conditions that trigger stomatal closure (ABA, desiccation, darkness), with the exception of elevated CO2. Expressed exclusively in guard cells of all tissues. It is required for light-induced opening of stomata. Mutant shows reduced stomatal aperture which helps to limit water loss during drought. |
AT3G11440 | Member of the R2R3-MYB gene family. Similar to GA-induced Barley myb gene. May be induced during germination in response to GA. Double mutants with MYB33 are male sterile, showing defects in pollen development and anther development. Contains a binding site for miRNA159 and may be spatially regulated by this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. The male sterile phenotype of the MYB33/MYB65 double mutant is light and temperature sensitive. Fertility can be restored with increased light intensity and lower temperatures. |
AT2G16720 | Encodes a member of MYB3R- and R2R3- type MYB- encoding gene family that acts as a repressor of flavonol biosynthesis. AtMYB7 gene expression is induced by salt treatment. |
AT2G23290 | Member of the R2R3 factor gene family. |
AT4G37260 | Member of the R2R3 factor gene family. The mRNA is cell-to-cell mobile. |
AT4G05100 | Member of the R2R3 factor gene family. |
AT3G50060 | Encodes a member of the R2R3 transcription factor gene family. Expressed in response to potassium deprivation and auxin. Involved in lateral root development. Interacts with ARF7 and regulates the expression of some auxin responsive genes. |
AT4G22680 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
AT4G21440 | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
AT1G71030 | Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves. |
AT5G18240 | Encodes MYR1 (MYR1). |
AT5G18650 | Encodes a RING-type E3 ubiquitin ligase that interacts with and ubiquitinates MYB30, leads to MYB30 proteasomal degradation and downregulation of its transcriptional activity. Since MYB30 is a positive regulator of Arabidopsis HR and defence responses, MIEL1 is involved in the negative regulation of these processes. The mRNA is cell-to-cell mobile. |
AT3G61950 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
AT2G46810 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
AT4G39120 | Encodes a chloroplast-localized member of the myo-inositol monophosphatase family, IMPL2 (myo-Inositol monophosphatase like 2) that seems to have multiple enzymatic activities. It contributes to histidine biosynthesis based on it histidinol-phosphate phosphatase activity. In addition, the protein can act as an inositol monophosphatase and an L-galactose-1-phosphate phosphatase in vitro. |
AT1G14520 | Encodes MIOX1. Belongs to myo-inositol oxygenase gene family. |
AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
AT4G26260 | Encodes a myo-inositol oxygenase, which is the first enzyme in the inositol route to ascorbate (L‐ascorbic acid, AsA, vitamin C). Overexpression results in enhanced biomass and abiotic stress tolerance. |
AT3G19960 | member of Myosin-like proteins |
AT1G17580 | Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development. |
AT5G54280 | Type VII myosin gene |
AT5G43900 | Encodes a member of the type XI myosin protein family that binds F-actin and co-localizes with actin filaments and peroxisomes. Homozygous mutants are reported to have pleiotropic effects in growth and fertility and may also be lethal. This protein is also involved in root hair growth and organelle trafficking. This protein interacts with RabC2a and RabD1 in a GTP-dependent manner. |
AT1G08800 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT1G70750 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT5G16720 | caldesmon-like protein (Protein of unknown function, DUF593);(source:Araport11) |
AT5G04540 | Myotubularin-like phosphatases II superfamily;(source:Araport11) |
AT5G57020 | Arabidopsis thaliana myristoyl-CoA:protein N-myristoyltransferase. |
AT5G14180 | Myzus persicae-induced lipase 1;(source:Araport11) |
AT5G66900 | RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.2. Exhibits autoimmunity. |
AT5G66910 | RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.1. |
AT3G57560 | encodes a N-acetylglutamate kinase, involved in arginine biosynthesis |
AT4G37670 | N-acetyl-l-glutamate synthase 2;(source:Araport11) |
AT5G56750 | AGB1/AGG dimmer interacting protein, response to water deficit. |
AT2G44170 | pseudogene of myristoyl-CoA:protein N-myristoyltransferase;(source:Araport11) |
AT1G50260 | N-terminal-transmembrane-C2 domain type 5.1;(source:Araport11) |
AT4G17830 | NAOD encodes a functional acetylornithine deacetylase. Silenced lines plants flower early but have reduced fertility (siliques do not develop) as well as reduced ornithine levels.NAOD mediates a linear pathway for ornithine biosynthesis. |
AT1G53210 | Encodes a Na+/Ca 2+ exchanger-like protein that participates in the maintenance of Ca 2+ homeostasis. The mRNA is cell-to-cell mobile. |
AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
AT5G27150 | Encodes a vacuolar sodium/proton antiporter involved in salt tolerance, ion homeostasis, and leaf development. The mRNA is cell-to-cell mobile. |
AT1G33060 | NAC 014;(source:Araport11) |
AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
AT5G39610 | Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510. |
AT1G01010 | NAC domain containing protein 1;(source:Araport11) |
AT1G56010 | Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. |
AT1G28470 | NAC domain containing protein 10;(source:Araport11) |
AT5G61430 | NAC domain containing protein 100;(source:Araport11) |
AT5G63790 | Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. Its expression can be induced by beta-cyclocitral, an oxidized by-product of beta-carotene generated in the chloroplasts, mediates a protective retrograde response that lowers the levels of toxic peroxides and carbonyls, limiting damage to intracellular components. |
AT1G52890 | encodes a NAC transcription factor whose expression is induced by drought, high salt, and abscisic acid. This gene binds to ERD1 promoter in vitro. |
AT5G04410 | NAC family member, functions as a transcriptional activator, regulates flavonoid biosynthesis under high light. The mRNA is cell-to-cell mobile. |
AT1G61110 | NAC transcription regulator. Regulates endosperm cell expansion during germination. |
AT1G02220 | NAC domain transcription factor which functions as a negative regulator of the TDIF-PXY module and fine-tunes TDIF signaling in vascular development. Controls the balance of xylem formation and cambial cell divisions. |
AT3G29035 | Encodes a protein with transcription factor activity. Note: this protein (AT3G29035) on occasion has also been referred to as AtNAC3, not to be confused with the AtNAC3 found at locus AT3G15500. The mRNA is cell-to-cell mobile. |
AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
AT1G02230 | NAC domain containing protein 4;(source:Araport11) |
AT2G33480 | NAC domain containing protein 41;(source:Araport11) |
AT2G43000 | Encodes a NAC transcription factor induced by hydrogen peroxide (H2O2). Involved in senescence. Over expression of the gene strongly delays senescence and enhances tolerance to various abiotic stresses. |
AT3G01600 | NAC domain containing protein 44;(source:Araport11) |
AT3G04060 | NAC046 is a member of the NAC domain containing family of transcription factors. It was identified in a screen for regulators of chlorophyll protein gene expression. Mutants in NAC046 have delayed senescence and increased CHL content suggesting a role in regulation of senescence and chlorophyll degradation. |
AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
AT3G04430 | NAC domain containing protein 49;(source:Araport11) |
AT1G02250 | Encodes a member of the NAC family of transcription factors. ANAC005 contains sequences specifying both nuclear and plasma membrane targeting. Overexpression results in increased xylem differentiation suggesting ANAC005 promotes xylem formation. |
AT3G10480 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. It binds the NAC-binding site, the Mitochondrial Dysfunction Motif. |
AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
AT3G49530 | Transcription factor that serves as a molecular link between cold signals and pathogen resistance responses. Undergoes proteolytic processing triggered by cold-induced changes in membrane fluidity.It relocates from the plasma membrane to the nucleus in response to ER stress. NAC062 is phosphorylated by SnRK2.8 at Thr-142. |
AT4G28530 | Member of NAC family of transcription factors. Along with NAC2, KIR1 positively regulates programmed cell death of stigmatic tissue. |
AT5G04400 | NAC domain protein;(source:Araport11) |
AT5G07680 | NAC domain containing protein 80;(source:Araport11) |
AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
AT5G14000 | NAC domain containing protein 84;(source:Araport11) |
AT1G32870 | Expression in rosette leaves is activated by high concentration of boron. |
AT4G35580 | Encodes a calmodulin-binding NAC protein (CBNAC). Contains calmodulin-binding domain in the C-terminus of the protein. Functions as a calmodulin-regulated transcriptional repressor. |
AT1G69490 | Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. The mRNA is cell-to-cell mobile. |
AT5G07710 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G21070 | Encodes a protein with NAD(H) kinase activity. |
AT1G21640 | Encodes a protein with NAD kinase activity. The protein was also shown to bind calmodulin. |
AT1G04280 | Encodes a mitochondrial CaM/Ca2+-dependent NAD+ kinase. |
AT1G78590 | Encodes a NADH kinase which can synthesize NADPH from NADH; also utilizes NAD+ as substrate although NADH is the preferred substrate. |
AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
AT2G47490 | Encodes a chloroplast-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro. |
AT1G25380 | Encodes a mitochondrial-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro. |
AT4G00570 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the beta family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the alpha-type NAD-ME2 (At2g13560). NAD-ME2 transcript and protein levels are higher during the night than during the day. |
AT5G53460 | NADH-dependent glutamate synthase The mRNA is cell-to-cell mobile. |
AT5G17770 | Encodes NADH:cytochrome (Cyt) b5 reductase that displayed strict specificity to NADH for the reduction of a recombinant Cyt b5 (AtB5-A), whereas no Cyt b5 reduction was observed when NADPH was used as the electron donor. |
AT5G11670 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME2 is presumably a cytosolic enzyme involved in malate metabolism and possibly assisting the oxidative pentose phosphate pathway. AtNADP-ME2 counts for the major part of NADP-ME activity in mature tissues of Arabidopsis. |
AT1G79750 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME4 is localized to chloroplasts. The gene is expressed throughout the whole plant and during embryogenesis and germination. A possible involvement in the fatty acid biosynthesis has been proposed. |
AT4G15545 | NAI1 interacting protein, involved in ER body formation. |
AT1G16520 | NAI1 interacting protein, involved in ER body and vesicle formation. |
AT5G67440 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
AT3G12700 | Encodes an aspartic protease has an important regulatory function in chloroplasts that not only influences photosynthetic carbon metabolism but also plastid and nuclear gene expression. |
AT1G18800 | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP1. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. Plant mutated in both NRP1 and NRP2 genes show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. NRP genes act synergistically with NAP1 genes in promoting somatic homologous recombination. |
AT5G13850 | nascent polypeptide-associated complex subunit alpha-like protein 3;(source:Araport11) |
AT1G33040 | nascent polypeptide-associated complex subunit alpha-like protein 5;(source:Araport11) |
AT5G67330 | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp3, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. The mRNA is cell-to-cell mobile. |
AT1G80830 | Thought to be involved in iron homeostasis. Induced in leaves in response to iron deficiency. Transgenic plants accumulate toxic levels of iron. Gene complements yeast iron uptake mutants. |
AT2G23150 | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp4, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. |
AT3G11660 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus. Localization of the gene product is similar to that of NHL3 (plasma membrane) but it is yet inconclusive. |
AT3G11650 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus and spermine. Overexpression of the gene induces the expression of PR-1 gene and shows light-dependent 'speck disease-like' symptom on leaves. The gene product is localized to the chloroplast |
AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
AT1G28380 | This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. The mRNA is cell-to-cell mobile. |
AT1G53430 | Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy. |
AT2G17730 | Intrinsic thylakoid membrane protein that fixes RPOTmp on the stromal side of the thylakoid membrane. |
AT4G02710 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT1G03080 | kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT5G10500 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT1G03470 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the nuclear membrane and the vacuolar membrane. |
AT2G30500 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT1G07380 | Encodes a neutral ceramidase that is involved in sphingolipid homeostasis and responses to oxidative stress. |
AT4G24690 | Encodes NBR1, a selective autophagy substrate. The mRNA is cell-to-cell mobile. |
AT1G10170 | Encodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response. |
AT4G01940 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast. |
AT1G51390 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion. The mRNA is cell-to-cell mobile. |
AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
AT1G01030 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT5G04950 | Encodes a nicotianamide synthase. |
AT5G23230 | nicotinamidase 2;(source:Araport11) |
AT5G64170 | LNK1 is a member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex.Functions as a transcriptional coactivator. |
AT3G54500 | Member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK2 along with LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex. Functions as a transcriptional coactivator. |
AT3G12320 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism. |
AT5G06980 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK3 in having affects on biomass accumulation and phototrophism. |
AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
AT3G25882 | encodes a kinase that physically interacts with NPR1/NIM1 |
AT1G09415 | encodes a kinase that physically interacts with NPR1/NIM1 |
AT3G04810 | Encodes AtNek2, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
AT5G28290 | Encodes AtNek3, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
AT3G63280 | Encodes AtNek4, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
AT4G24020 | Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile. |
AT1G20640 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
AT1G30100 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
AT3G60320 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
AT1G12940 | member of High affinity nitrate transporter family |
AT1G62580 | Encodes a flavin monooxygenase that binds NO, has a higher affinity for NO than for O(2) and can generate cGMP from GTP in vitro in an NO-dependent manner. |
AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
AT5G22300 | encodes a nitrilase isomer. The purified enzyme shows a strong substrate specificity for beta-cyano-L-alanine, a intermediate product of the cyanide detoxification pathway. The mRNA is cell-to-cell mobile. |
AT3G16410 | Encodes a nitrile-specifier protein NSP4. NSP4 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile. |
AT5G48180 | Encodes a nitrile-specifier protein NSP5. NSP5 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. |
AT5G65720 | Encodes a cysteine desulfurase whose activity is dependent on AtSufE activation. It requires pyridoxal phosphate (PLP) for proper folding. Its catalytic efficiency is increase three-fold in the presence of AtFH (frataxin). |
AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
AT3G16350 | MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1. |
AT3G54360 | Encodes a catalase chaperon that is essential for catalase activity. Required for multiple stress responses. |
AT2G43040 | encodes a calmodulin-binding protein that is expressed specifically in pollen and is required for pollen development. |
AT4G10380 | Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells. |
AT2G03440 | Induced at the transcriptional level by Pseudomonas syringae pv. tomato infection. |
AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
AT5G45410 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
AT4G25030 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
AT5G64330 | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
AT4G13250 | Encodes a chlorophyll b reductase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
AT4G22920 | Similar to the tomato senescence-inducible chloroplast stay-green protein 1. It is upregulated during maximal senescence in the Arabidopsis life cycle, especially in senescent leaves. Acts antagonistically with SGR2 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
AT1G80460 | Encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1. |
AT1G44575 | Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. |
AT5G11630 | The mutant is insensitive to oxylipin 9-HOT treatment. Involved in plant defense. |
AT4G11910 | Acts antagonistically with SGR1 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
AT5G52820 | Encodes a NOTCHLESS homolog, a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit, that is required for female gametogenesis. The mRNA is cell-to-cell mobile. |
AT4G28910 | Encodes a transcriptional repressor that functions in the jasmonic acid (JA) signalling pathway, root development, and has a key role in leaf development, likely due to the transcriptional regulation of CYCD3 expression. Transcriptional repressor that accumulates in short-day conditions. Regulates together with FRS7 and FRS12 glucosinolate biosynthesis. |
AT3G17440 | member of NPSN Gene Family |
AT5G45110 | Encodes NPR3, a paralog of NPR1. Involved in negative regulation of defense responses against bacterial and oomycete pathogens. npr3 mutants has elevated level of PR1 expression. Interacts with TGA2, TGA3, TGA5 and TGA6 in yeast two hybrid assays. NPR3 and NPR4 are receptors for the immune signal salicylic acid. The mRNA is cell-to-cell mobile. |
AT4G19660 | Encodes NPR4, a ankyrin repeat BTB/POZ domain-containing protein with 36% sequence identity with NPR1. Mutants are more susceptible to the bacterial pathogen Pseudomonas syringe pv. tomato DC3000 and to the fungal pathogen Erysiphe cichoracearum, but do not differ markedly from wild type in interaction with virulent and avirulent strains of the oomycete Peronospora parasitica. NPR4 is required for basal defense against pathogens, and may be implicated in the cross-talk between the SA- and JA-dependent signaling pathways. NPR3 and NPR4 are receptors for the immune signal salicylic acid. |
AT5G67385 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
AT3G47960 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
AT5G62680 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile. |
AT3G45650 | Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots. |
AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
AT1G69850 | Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems. |
AT1G72125 | Major facilitator superfamily protein;(source:Araport11) |
AT1G72120 | Major facilitator superfamily protein;(source:Araport11) |
AT5G46050 | Encodes a di- and tri-peptide transporter involved in responses to wounding, virulent bacterial pathogens, and high NaCl concentrations. The protein is predicted to have 12 transmembrane helicies. |
AT2G26690 | Major facilitator superfamily protein;(source:Araport11) |
AT3G21670 | Major facilitator superfamily protein;(source:Araport11) |
AT4G21680 | Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance. |
AT1G32450 | Transmembrane nitrate transporter. Involved in xylem transport of nitrate from root to shoot. Induced in response to high and low concentrations of nitrate. Not involved in nitrate uptake. Expressed in root pericycle cells under the control of MYB59. Also functions as a proton-coupled H+/K+ antiporter for K+ loading into the xylem. |
AT3G54140 | Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. GFP-tagged PTR1 localizes to the plasma membrane and has 8 to 11 predicted transmembrane domains. PTR1 is expressed in a number of different vascular tissues throughout the plant based on promoter:GUS expression analysis. ptr1 mutants have a lower dry weight than wild type plants when both are grown with Pro-Ala or Ala-Ala dipeptides as their nitrogen source, suggesting that PTR1 plays a role in dipeptide uptake in the roots. Furthermore N content of ptr1 mutants is lower than that of wild type plants when grown with Pro-Ala or a mixture of dipeptides as nitrogen source |
AT2G02040 | Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. Expression of the transcripts for this gene can be detected in the embryo through in situ hybridization. This protein does not have nitrate transporter activity based on oocyte transport assays. Enhances water uptake during early seed germination. |
AT1G62200 | Major facilitator superfamily protein;(source:Araport11) |
AT4G13350 | Encodes a GTPase that interacts with nuclear shuttle proteins (NSPs) from a number of different plant viruses. The gene is widely expressed and NIG transcript levels do not rise in response to viral infection. This cytoplasmic protein does not directly interact with a viral movement protein (MP), but, it does promote the movement of NSP from the nucleus to the cytoplasm. Overexpression of NIG in Arabidopsis plants renders them more sensitive to geminivirus infection. |
AT5G16000 | NSP-interacting kinase (NIK1), receptor-like kinase, involved in defense response against geminivirus It acts as a virulence target of the begomovirus nuclear shuttle protein (NSP). |
AT1G60800 | Encodes one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis. |
AT4G14350 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT4G33080 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT1G30640 | Protein kinase family protein;(source:Araport11) |
AT1G02560 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
AT5G12840 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
AT3G05690 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
AT2G34720 | nuclear factor Y, subunit A4;(source:Araport11) |
AT3G14020 | nuclear factor Y, subunit A6;(source:Araport11) |
AT1G30500 | nuclear factor Y, subunit A7;(source:Araport11) |
AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
AT5G08190 | nuclear factor Y, subunit B12;(source:Araport11) |
AT5G47640 | Involved in the regulation of response to nutrient levels. |
AT4G14540 | nuclear factor Y, subunit B3;(source:Araport11) |
AT1G07980 | nuclear factor Y, subunit C10;(source:Araport11) |
AT3G12480 | nuclear factor Y, subunit C11;(source:Araport11) |
AT1G54830 | Encodes a NUCLEAR FACTOR-Y C (NF-YC) homologue NF-YC3. NF-YC3., NF-YC4 and NF-YC9 redundantly modulate GA- and ABA-mediated seed germination. |
AT4G30930 | Encodes a ribosomal RPL21M protein that is localized to the mitochondrion and is involved in karyogamy during female gametophyte development and fertilization. Mutants display defects in both male and female gametophyte development (i.e.collapsed pollen and female gametophytes with unfused central cells). |
AT1G24450 | Putative RNAse III-Like protein; intracellular localization affected by TBSV. |
AT1G31470 | Major facilitator superfamily protein;(source:Araport11) |
AT1G19520 | Ribosomal pentatricopeptide repeat protein |
AT4G32850 | Encodes a nuclear poly(A) polymerase. Located in the nucleus. The mRNA is cell-to-cell mobile. |
AT1G79280 | Encodes a 237-kDA protein with similarity to vertebrate Tpr, a long coiled-coil proteins of nuclear pore inner basket filaments. It is localized to the inner surface of the nuclear envelope and is a component of the nuclear pore-associated steps of sumoylation and mRNA export in plants. Mutations affect flowering time regulation and other developmental processes. Probably acts in the same pathway as ESD4 in affecting flowering time, vegetative and inflorescence development. |
AT1G06790 | Encodes a subunit of RNA polymerase III involved in maintaining global RNA homeostasis, not just that of genes transcribed by RNA pol III. |
AT5G60040 | Encodes a subunit of RNA polymerase III (aka RNA polymerase C). |
AT3G18090 | Encodes a subunit of RNA polymerase IV (aka RNA polymerase D). NRPD2b is closely related to NRPD2a, but has lower levels of transcription and does not affect endogenous siRNA when mutated. |
AT1G27970 | Encodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport. The mRNA is cell-to-cell mobile. |
AT2G05760 | Xanthine/uracil permease family protein;(source:Araport11) |
AT2G27810 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
AT2G18220 | Noc2p family;(source:Araport11) |
AT1G79150 | binding protein;(source:Araport11) |
AT1G14850 | Encodes a protein similar to nucleoporin, a a major component of the nuclear pore complex (NPC) involved in cellular nucleo-cytoplasmic transport |
AT4G31240 | protein kinase C-like zinc finger protein;(source:Araport11) |
AT4G11010 | nucleoside diphosphate kinase 3 (ndpk3), located to the inter-membrane space in mitochondria |
AT3G07050 | Arabidopsis NSN1 encodes a nucleolar GTP- binding protein and is required for maintenance of inflorescence meristem identity and floral organ development. |
AT4G39390 | Encodes a golgi localized nucleotide sugar transporter. |
AT1G80300 | Encodes an ATP/ADP transporter. The mRNA is cell-to-cell mobile. |
AT3G26690 | Encodes AtNUDT13, a mitochondrial Nudix hydrolase specific for long-chain diadenosine polyphosphates. |
AT4G11980 | nudix hydrolase homolog 14;(source:Araport11) |
AT3G12600 | nudix hydrolase homolog 16;(source:Araport11) |
AT2G01670 | nudix hydrolase homolog 17;(source:Araport11) |
AT1G14860 | nudix hydrolase homolog 18;(source:Araport11) |
AT5G47650 | Encodes an ADP-ribose pyrophosphatase that confers enhanced tolerance to oxidative stress. |
AT5G19460 | nudix hydrolase homolog 20;(source:Araport11) |
AT1G73540 | nudix hydrolase homolog 21;(source:Araport11) |
AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
AT1G18300 | nudix hydrolase homolog 4;(source:Araport11) |
AT2G34160 | Alba DNA/RNA-binding protein;(source:Araport11) |
AT5G04900 | Encodes a chlorophyll b reducatase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
AT4G14880 | Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. Lines carrying semi-dominant mutations exhibit early senescence. Required for pollen tube growth and/or fertilization. |
AT3G22460 | Encodes a member of a family of genes with O-acetylserine(thiol)lyase activity. |
AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
AT5G54160 | A caffeic acid/5-hydroxyferulic acid O-methyltransferase. Interacts with 14-4-3 proteins in yeast 2 hybrid assay. AtOMT1 (At5g54160) encodes a flavonol 3?-O-methyltransferase that is highly active towards quercetin and myricetin. The substrate specificity identifies the enzyme as flavonol 3?-methyltransferase which replaces the former annotation of the gene to encode a caffeic acid/5-hydroxyferulic acid O-methyltransferase The mRNA is cell-to-cell mobile. |
AT3G61990 | Encodes a protein methyltransferase. Involved in the methylation of plant transmembrane proteins. |
AT3G07780 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. The mRNA is cell-to-cell mobile. |
AT5G48160 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE1 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. |
AT5G60850 | Encodes a zinc finger protein. |
AT5G53450 | OBP3-responsive protein 1;(source:Araport11) |
AT1G06160 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT5G01170 | hypothetical protein (DUF740);(source:Araport11) |
AT4G25140 | Encodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds. |
AT3G27660 | Encodes oleosin4 (Plant Cell, 2006, 18:1961), a protein found in oil bodies, involved in seed lipid accumulation. Functions in freezing tolerance of seeds. Note: also referred to as OLE3 in Plant Journal 2008, 55:798. |
AT5G55920 | Encodes a homolog of the S. cerevisiae Nop2 that is involved in ribosome biogenesis and plays a role on organ size control by promoting cell proliferation and preventing compensation in normal leaf development. |
AT4G16370 | Encodes a phloem-specific iron transporter that is essential for systemic iron signaling and redistribution of iron and cadmium. It loads iron into the phloem, facilitates iron recirculation from the xylem to the phloem, and regulates both shoot-to-root iron signaling and iron redistribution from mature to developing tissues. |
AT4G27730 | oligopeptide transporter |
AT5G64410 | oligopeptide transporter |
AT4G10770 | oligopeptide transporter |
AT1G17370 | Encodes an RNA?binding protein involved in stress granule formation. Regulated by a transposable element small RNA. |
AT1G34000 | Encodes a novel member of the Lhc family from Arabidopsis with one predicted transmembrane alpha-helix closely related to helix I of Lhc protein from PSI (Lhca4). Gene expression is triggered by light stress and both transcript and protein accumulate in a light intensity-dependent manner. Ohp2 is associated with PSI under low- or high-light conditions. Together with OHP1, OHP2 is essential for the formation of photosystem II reaction center, even though neither is a part of the final PSII RC. It forms a complex with OHP1 and HCF244, D1, D2, PsbI, and cytochrome b559 at an early stage of PSII de novo assembly and of PSII repair under high-light conditions. |
AT3G21140 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
AT1G51560 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
AT1G20510 | OPC-8:0 CoA ligase1;(source:Araport11) |
AT4G33950 | Encodes calcium-independent ABA-activated protein kinase, a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Mutations disrupted ABA induction of stomatal closure as well as ABA inhibition of light-induced stomatal opening. However, regulation of stomatal opening/closing by light or CO(2) is not affected in these mutants. May act in the interval between ABA perception and reactive oxygen species production in the ABA signalling network. |
AT2G41230 | Encodes an ER-localized plant hormone-responsive gene and appears to act redundantly with ARGOS and ARL during organ growth. Over-expression modifies plant sensitivity to ethylene, leading to improved drought tolerance. |
AT4G25270 | Encodes OTP70, a pentatricopeptide repeat protein of the E subgroup involved in splicing of the plastid transcript rpoC1. |
AT3G57430 | Encodes a chloroplast RNA editing factor. |
AT3G63370 | Encodes a chloroplast RNA editing factor. |
AT1G79360 | organic cation/carnitine transporter 2;(source:Araport11) |
AT1G79410 | organic cation/carnitine transporter5;(source:Araport11) |
AT2G35720 | Encodes OWL1, a J-domain protein involved in perception of very low light fluences. |
AT5G16690 | Origin Recognition Complex subunit 3. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
AT1G01880 | Encodes one of two GEN1 homologs in Arabidopsis. It is a member of the class IV Rad2/XPG family of nucleases that processes Holliday junctions in a manner analogous to the HJ resolvases of phages, archaea, and bacteria. |
AT1G01760 | denosine deaminases acting on tRNA;(source:Araport11) |
AT2G31020 | OSBP(oxysterol binding protein)-related protein 1A;(source:Araport11) |
AT4G22540 | OSBP(oxysterol binding protein)-related protein 2A;(source:Araport11) |
AT3G09300 | OSBP(oxysterol binding protein)-related protein 3B;(source:Araport11) |
AT4G11650 | osmotin-like protein |
AT3G63160 | Member of the Arabidopsis 7-kDa OEP family. Tail-anchored (TA) membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
AT2G28120 | Major facilitator superfamily protein;(source:Araport11) |
AT2G38025 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT2G30395 | Member of the plant specific ovate protein family of unknown function. |
AT3G52540 | ovate family protein 18;(source:Araport11) |
AT1G06920 | Encodes OFP4, a member of the plant specific ovate family proteins. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. OFP4 interacts with KNAT7 to regulate secondary cell wall formation. |
AT4G18830 | Member of the ovate protein family.Interacts with BLH1 and KNAT3. Regulates the subcellular localization of BLH1.I May also directly affect microtubule organization via interactions with TON2. |
AT5G11270 | Encodes a homeodomain transcription factor involved in mediating resistance to infection by necrotrophic pathogens dependent on perception of jasmonic acid through COI1. Expressed in the nucleus. Downregulated upon fungal infection. Also involved in drought tolerance. |
AT3G55400 | methionyl-tRNA synthetase / methionine-tRNA ligase / MetRS (cpMetRS);(source:Araport11) |
AT3G13490 | Encodes a dual targeted lysyl-tRNA ligase that is found both in the mitochondrion and the chloroplast. Plants mutated in this gene exhibit an ovule abortion phenotype. |
AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
AT5G06260 | TLD-domain containing nucleolar protein;(source:Araport11) |
AT2G19810 | Encodes Oxidation-related Zinc Finger 1 (OZF1), a plasma membrane protein involved in oxidative stress. |
AT4G29190 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses |
AT5G56550 | Encodes OXIDATIVE STRESS 3 (OXS3), involved in tolerance to heavy metals and oxidative stress. |
AT4G33520 | Encodes a putative metal-transporting P-type ATPase PAA1. An alternative-splicing event of the PAA1 pre-mRNA produces a copper chaperon named PCH1. The mRNA is cell-to-cell mobile. |
AT5G21930 | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport |
AT5G57780 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
AT3G29370 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
AT3G07680 | Encodes an Golgi-localized p24 protein. Interacts with p24delta5 at ER export sites for ER exit and coupled transport to the Golgi apparatus. The mRNA is cell-to-cell mobile. |
AT5G39860 | Encodes PRE1 (PACLOBUTRAZOL RESISTANCE1). PRE1 and IBH1 form a pair of antagonistic HLH/bHLH transcription factors that function downstream of BZR1 to mediate brassinosteroid regulation of cell elongation. BNQ1 is directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
AT1G01860 | dimethyladenosine transferase |
AT2G32240 | PAMP induced protein involved in defense response. Interaction with UBAC2 proteins in the ER, is necessary for PAMP mediated accumulation of the callose synthase PMR4. |
AT1G60440 | The gene AT1G60440 encodes pantothenate kinase 1. Its molecular function was shown to phosphorylate pantothenate to form 4?-phosphopantothenate. |
AT4G32180 | Encodes a protein with pantothenate kinase activity. |
AT1G11400 | The PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus. |
AT1G19300 | The PARVUS/GLZ1 gene encodes a putative family 8 glycosyl transferase that contributes to xylan biosynthesis. Its gene expression shows good co-variance with the IRX3 gene involved in secondary cell wall synthesis. PARVUS/GLZ1 is predicted to have galacturonosyltransferase activity and may be involved in the formation of the complex oligosaccharide sequence present at the reducing end of xylan. PARVUS is expressed in cells undergoing secondary wall thickening, and parvus mutants have thinner cell walls. |
AT2G02710 | Encodes a putative blue light receptor protein. |
AT4G14990 | Topoisomerase II-associated protein PAT1;(source:Araport11) |
AT3G63200 | PATATIN-like protein 9;(source:Araport11) |
AT3G54950 | Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition. |
AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
AT1G22530 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
AT5G06370 | PSE1 is a single copy gene that is induced in response to lead and confers increased tolerance to lead when overexpressed. It is localized to the cytoplasm. The protein has an NC domain. PSE1 appears to regulate tolerance via a GSH dependent phytochelatin synthesis pathway. |
AT3G55450 | PBS1-like 1;(source:Araport11) |
AT1G74490 | Protein kinase superfamily protein;(source:Araport11) |
AT3G01300 | Protein kinase superfamily protein;(source:Araport11) |
AT3G28690 | Protein kinase superfamily protein;(source:Araport11) |
AT1G26970 | Protein kinase superfamily protein;(source:Araport11) |
AT5G56460 | Protein kinase superfamily protein;(source:Araport11) |
AT1G21750 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily; isoform contains non-consensus GA donor splice site at intron 9. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. The mRNA is cell-to-cell mobile. |
AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G05910 | Pectinacetylesterase family protein;(source:Araport11) |
AT3G62060 | Pectinacetylesterase family protein;(source:Araport11) |
AT4G19420 | Pectinacetylesterase family protein;(source:Araport11) |
AT5G23870 | Encodes a pectin acetylesterase that removes cell wall acetate associated with pectin formation in Arabidopsis leaves. |
AT5G62360 | Pectin methylesterase inhibitor expressed throughout the plant. |
AT1G53840 | encodes a pectin methylesterase |
AT1G53830 | encodes a pectin methylesterase |
AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G47500 | predicted to encode a pectin methylesterase |
AT4G25260 | Pectin methylesterase inhibitor. Forms pH dependent complex with PME3. |
AT5G09310 | Encodes a gamma-secretase subunit. Associates with other subunits in intracellular membrane compartments. |
AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
AT1G59870 | ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. Contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration in a salicylic acid?dependent manner. Required for mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and contributes to heavy metal resistance. The mRNA is cell-to-cell mobile. |
AT3G23020 | Encodes a chloroplast nucleoid-localized protein whose absence leads to broadly impaired plastid gene expression and chloroplast development. |
AT1G06580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G06430 | Encodes PPR2, a pentatricopeptide repeat protein. Binds to plastid 23S rRNA and plays an important role in the first mitotic division during gametogenesis and in cell proliferation during embryogenesis. |
AT1G61870 | Generic translation factor involved in mitochondrial translation. |
AT1G11630 | Ribosomal pentatricopeptide repeat protein |
AT5G48470 | hypothetical protein;(source:Araport11) |
AT1G73080 | Encodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks. The mRNA is cell-to-cell mobile. |
AT4G26000 | Encodes a novel Arabidopsis gene encoding a polypeptide with K-homology (KH) RNA-binding modules, which acts on vegetative growth and pistil development. Genetic studies suggest that PEP interacts with element(s) of the CLAVATA signaling pathway. |
AT4G25130 | Encodes a chloroplast-localized methionine sulfoxide reductase that is a member of the MSRA family. Involved in protection of chloroplasts from oxidative stress. |
AT5G49570 | Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants). |
AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT1G15440 | Encodes a nucleolar protein that is a ribosome biogenesis co-factor. Mutants display aberrant RNA processing and female gametophyte development. |
AT5G23940 | Encodes PERMEABLE LEAVES3 (PEL3), a putative acyl-transferase. Mutation in this locus results in altered trichome phenotype (trcichomes become tangled during leaf expansion). Additional phenotype includes altered cuticle layer. |
AT2G41480 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
AT1G14540 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
AT4G33420 | Peroxidase superfamily protein;(source:Araport11) |
AT5G05340 | Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes. |
AT2G26350 | Zinc-binding peroxisomal integral membrane protein (PEX10). Inserted directly from the cytosol into peroxisomes and is involved in importing proteins into the peroxisome. Required for embryogenesis. |
AT1G47750 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
AT2G45740 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile. |
AT3G61070 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
AT3G07560 | Encodes peroxin 13 (PEX13) involved in protein transport into peroxisomes, for example, peroxisomal import of nitric oxide synthase. |
AT1G48635 | peroxin 3;(source:Araport11) |
AT3G18160 | Peroxin 3-1;(source:Araport11) |
AT5G56290 | Encodes the peroxisomal targeting signal type 1 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS1 consensus sequence (tripeptide SKL or a conserved variant) at the extreme C terminus. The protein has several domains, including C-terminal tetratricopeptide repeat motifs which act in binding the C-terminal "SKL" targeting signal. The mechanism of transport has been worked out in other organisms: The receptor recognizes and binds cytosolic PTS1-containing proteins. The PEX5-PTS1 complex binds a PEX14/PEX13 receptor complex at the peroxisome membrane and is translocated into the peroxisome matrix in a process dependent on PEX2,PEX10, and PEX12. In the peroxisome matrix, PEX5 releases its cargo and is recycled to the cytosol in a process dependent on PEX1, PEX4, PEX6 and PEX22. It is also involved, in conjunction with PEX7, in PTS1- and PTS2-dependent peroxisomal protein import. RNAi experiments suggest that PEX5 is necessary for the maintenance of both glyoxysomal and leaf peroxisomal functions. |
AT1G04710 | EC2.3.1.16 thiolase. Its transcript levels change after inducing MUTE expression in a mute background. |
AT2G33150 | Encodes an organellar (peroxisome, glyoxysome) 3-ketoacyl-CoA thiolase, involved in fatty acid b-oxidation during germination and subsequent seedling growth. Mutants have defects in glyoxysomal fatty acid beta-oxidation. EC2.3.1.16 thiolase. |
AT3G05290 | encodes a peroxisomal adenine nucleotide transporter, involved in fatty acid beta-oxidation during early stage of postgerminative growth. |
AT5G27520 | encodes a peroxisomal adenine nucleotide transporter, involved in fatty acid beta-oxidation during early stage of postgerminative growth. |
AT2G39970 | Encodes peroxisomal membrane protein 38 (PMP38). Mutation in this protein results in enlargement of peroxisomes. Delivers NAD+ for optimal fatty acid degradation during storage oil mobilization. |
AT2G22780 | encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
AT5G09660 | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
AT5G03680 | Recessive mutations are defective in organ initiation and orientation in the second whorl. This gene encodes a trihelix transcription factor whose expression is limited to margins of floral and vegetative organs. Overexpression and double mutant analyses suggest that this gene is involved in limiting lateral growth of organs. |
AT5G61770 | A single-copy gene encoding a 346 aa protein with a single Brix domain. Similar to yeast ribosome biogenesis proteins Ssf1/2. |
AT4G11960 | Encodes PGRL1B, a transmembrane protein present in thylakoids. PGRL1B has a highly homologous isoform PGRL1A encoded by At4g22890. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). |
AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
AT3G53260 | Encodes phenylalanine lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
AT5G13800 | Encodes a pheophytinase that is involved in chlorophyll breakdown. Its transcript levels increase during senescence and pph-1 mutants have a stay-green phenotype. |
AT1G64370 | filaggrin-like protein;(source:Araport11) |
AT5G02460 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT1G63090 | phloem protein 2-A11;(source:Araport11) |
AT1G12710 | This gene is predicted to encode a protein with a PP2 domain. This domain in present in lectins found in squash and cucumber, suggesting that this protein could potentially have carbohydrate binding capabilities. |
AT3G61060 | phloem protein 2-A13;(source:Araport11) |
AT5G52120 | phloem protein 2-A14;(source:Araport11) |
AT2G02230 | phloem protein 2-B1;(source:Araport11) |
AT2G02360 | Encodes an F-box protein containing a Nictaba-related lectin domain that can act as a carbohydrate-binding protein.Expression is induced by SA and pathogenic bacteria. |
AT1G80110 | phloem protein 2-B11;(source:Araport11) |
AT2G33770 | Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response and mediates degradation of PHO1 and PHT1s at endomembrane. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
AT5G23630 | A member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure. MIA is also named PDR2 and was shown to be required for proper expression of SCARECROW (SCR), a key regulator of root patterning, and for stem-cell maintenance in Pi-deprived roots. |
AT5G43350 | Encodes an inorganic phosphate transporter Pht1;1. Mutants display enhanced arsenic accumulation. Under high arsenate concentrations, PHT1;1 levels are reduced and it is delocalized from the plasma membrane. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).PHT1;1 expression is transcriptionally regulated by WRKY6 and by PHR1. |
AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
AT3G26570 | low affinity phosphate transporter |
AT3G48850 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
AT2G17270 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
AT5G20380 | Encodes an inorganic phosphate transporter (PHT4;5). |
AT3G52190 | Encodes a plant specific protein structurally related to the SEC12 proteins of the early secretory pathway. Mutation of PHF1 impairs Pi transport. Expression was detected in all tissues, and was induced by Pi starvation. Localized in endoplasmic reticulum (ER), and mutation of PHF1 resulted in ER retention and reduced accumulation of the plasma membrane PHT1;1 transporter. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
AT1G35140 | EXL1 is involved in the C-starvation response. Phenotypic changes of an exl1 loss of function mutant became evident only under corresponding experimental conditions. For example, the mutant showed diminished biomass production in a short-day/low light growth regime, impaired survival during extended night, and impaired survival of anoxia stress. |
AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
AT3G09560 | The PAH1 gene encodes a phosphatidate phosphohydrolase. Mutant analysis revealed its involvement in galactolipid synthesis pathway, and the membrane lipid remodeling. The pah1pah2 double-mutant showed enhanced Al-susceptibility under low-P conditions, but there was no significant differences in Al tolerance between pah1pah2 and wild type when they were grown in a solution containing 35 μM Pi. |
AT5G42870 | The PAH2 gene encodes a phosphatidate phosphohydrolase. Mutant analysis revealed its involvement in galactolipid synthesis pathway, and the membrane lipid remodeling. The pah1pah2 double-mutant showed enhanced Al-susceptibility under low-P conditions, but there was no significant differences in Al tolerance between pah1pah2 and wild type when they were grown in a solution containing 35 μM Pi. |
AT3G09920 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) family member. Family members are key enzymes in the process of phosphatidylinositol signaling pathway and have essential functions in growth, development, and biotic and abiotic stresses responses in plants |
AT5G09350 | Encodes a phosphatidylinositol 4-OH kinase, PI-4Kbeta2. Arabidopsis contains 12 PI-4Ks in three separate families: PI-4Kalphs, PI-4kbeta, and PI-4Kgamma. PI-4Kbeta2 is 83% identical to PI-4kbeta1 encoded by At5g64070. Important for polarized root hair growth as the loss of this gene and its close relative PI-4kbeta1, leads to the formation of abnormal root hairs. |
AT2G41210 | Encodes a protein with phosphatidylinositol-4-phosphate 5-kinase activity that plays a role in pollen tip growth. The enzyme localizes to the apical plasma membrane and adjacent cytosolic region of pollen tubes. Overexpression of this gene leads to increased deposition of pectin in the cell wall at the tip of the pollen tube and causes altered pollen tube morphology. |
AT1G21980 | Type I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution. |
AT3G47290 | phosphatidylinositol-speciwc phospholipase C8;(source:Araport11) |
AT1G15110 | PSS1 encodes a base-exchange-type Phosphatidylserine (PS) synthase. Mutant analysis revealed its role in pollen maturation. |
AT3G01550 | phosphoenolpyruvate (pep)/phosphate translocator 2;(source:Araport11) |
AT4G37870 | Encodes a phosphoenolpyruvate carboxykinase that localizes to the cytosol. |
AT1G53310 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.Plays an important role in carbon and nitrogen metabolism. |
AT2G42600 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.PPC1 and PPC2 are crucial for balancing carbon and nitrogen metabolism. |
AT1G08650 | Encodes a phosphoenolpyruvate carboxylase kinase that is expressed at highest levels in leaves. Expression is induced by light. The mRNA is cell-to-cell mobile. |
AT1G12580 | phosphoenolpyruvate carboxylase-related kinase 1;(source:Araport11) |
AT5G47810 | phosphofructokinase 2;(source:Araport11) |
AT4G26270 | phosphofructokinase 3;(source:Araport11) |
AT5G61580 | Phosphofructokinase Isoform. |
AT4G32840 | phosphofructokinase 6;(source:Araport11) |
AT5G56630 | phosphofructokinase 7;(source:Araport11) |
AT2G46500 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. Phosphorylates PUFD1 and RPN10 in vitro. |
AT2G03890 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. The mRNA is cell-to-cell mobile. |
AT2G26560 | Encodes a lipid acyl hydrolase with wide substrate specificity that accumulates upon infection by fungal and bacterial pathogens. Protein is localized in the cytoplasm in healthy leaves, and in membranes in infected cells. Plays a role in cell death and differentially affects the accumulation of oxylipins. Contributes to resistance to virus. |
AT4G16820 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
AT1G06800 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
AT4G38530 | Encodes a putative phosphoinositide-specific phospholipase C. There are two genes called ATPLC1, one corresponding to AT4g38530 (this one) and one corresponding to AT5g58670. |
AT3G15730 | Encodes phospholipase D alpha 1 (PLD alpha 1). Positive regulator of abscisic acid (ABA) mediated stomatal movements. PLD alpha 1 plays an important role in seed deterioration and aging in Arabidopsis. The mRNA is cell-to-cell mobile. |
AT1G55180 | member of C2-PLD. subfamily Represents a phospholipase D (PLD) gene with four exons, hence it is a member of the alpha class. Its amino acid sequence is quite different from other PLDs, therefore it might possess unique structural and/or catalytic properties. |
AT2G42010 | phospholipase D (PLDbeta) |
AT4G35790 | Encodes a protein with phospholipase D activity. Involved in phospolipase metabolism. Mutants are affected in hydrogen peroxide mediated cell death. |
AT3G16785 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Does not appear to be involved in root hair patterning. Not induced upon Pi starvation. |
AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
AT4G39670 | Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes. |
AT1G80860 | Encodes a single-copy phospholipid N-methyltransferase, involved in phosphatidylcholine biosynthesis. Has specific activity towards phosphatidylmonomethylethanolamine and phosphatidyldimethylethanolamine, but not phosphatidylethanolamine. |
AT2G42910 | Phosphoribosyltransferase family protein;(source:Araport11) |
AT5G05590 | Encodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. |
AT1G29410 | Encodes phosphoribosylanthranilate isomerase which catalyzes the third step in tryptophan biosynthesis. |
AT1G32060 | phosphoribulokinase;(source:Araport11) |
AT3G12810 | Encodes a protein similar to ATP-dependent, chromatin-remodeling proteins of the ISWI and SWI2/SNF2 family. Genetic analyses suggest that this gene is involved in multiple flowering pathways. Mutations in PIE1 results in suppression of FLC-mediated delay of flowering and causes early flowering in noninductive photoperiods independently of FLC. PIE1 is required for expression of FLC in the shoot apex but not in the root.Along with ARP6 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). The mRNA is cell-to-cell mobile. |
AT2G16365 | PCH1 binds and stabilizes the active (Pfr) form of phytochrome B and is involved in the formation of photobodies in the nucleus. PCH1 is expressed in evenings and is associated to the evening complex through binding to phyB, and represses hypocotyl elongation and growth. Using mass spec, the existence of the At2g16365.2 isoform has been verified, however here is no evidence that any of the other three variants are present. Atg2G16365.2 will be assigned PCH1; exon 4 and 5 in the other variants are actually another gene of the F-box/DUF295 family with gene name FDA10. |
AT5G18190 | Casein kinase involved in phosphorylation and ubiquination of RYR/PYLs, resulting in negative regulation of ABA response.Also annotated as MUT9-LIKE kinase that functions as H3-T3 specific histone kinase. |
AT1G25520 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
AT1G15980 | encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron flow around photosystem I to produce ATP. |
AT5G43750 | NAD(P)H dehydrogenase 18;(source:Araport11) |
AT1G71500 | Encodes PSB33, a protein conserved in the plastid lineage. PSB33 is associated with the chloroplast thylakoid membrane and provides stability to Photosystem II. The mRNA is cell-to-cell mobile. |
AT3G54890 | Encodes a component of the light harvesting complex associated with photosystem I. |
AT1G45474 | Encodes a component of the light harvesting complex of photosystem I. |
AT2G46820 | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. Forms oligomers with other members of CURT1 family to modulate grana structure. |
AT1G03130 | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2) |
AT2G20260 | Encodes subunit E of photosystem I. The mRNA is cell-to-cell mobile. |
AT1G55670 | Encodes subunit G of photosystem I, an 11-kDa membrane protein that plays an important role in electron transport between plastocyanin and PSI and is involved in the stability of the PSI complex. PSI-G subunit is bound to PSI-B and is in contact with Lhca1. The protein inserts into thylakoids by a direct or "spontaneous" pathway that does not involve the activities of any known chloroplast protein-targeting machinery. PSI-G appears to be directly or indirectly involved in the interaction between Photosystem I and plastocyanin. |
AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
AT2G05100 | Lhcb2.1 protein encoding a subunit of the light harvesting complex II. Member of a gene family with high degree of sequence similarity. Initially LHCB2.3 was considered as a separate gene but appears to be an allele of LHCB2.1. |
AT3G27690 | Encodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. The mRNA is cell-to-cell mobile. |
AT3G50820 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII. |
AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
AT5G58140 | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. The mRNA is cell-to-cell mobile. |
AT4G32070 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G29000 | MYB-CC family member. PHL1 acts redundantly with PHR1 to regulate responses to Pi starvation. |
AT3G24120 | MYB-CC protein involved in regulation of response to phosphate starvation. |
AT4G14150 | Microtubule motor kinesin PAKRP1/Kinesin-12A. Together with PAKRP1L/Kinesin-12B, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
AT3G58850 | Encodes PHYTOCHROME RAPIDLY REGULATED2 (PAR2), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR1 (At2g42870). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
AT2G26710 | Encodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion. |
AT2G01490 | Encodes a phytanoyl-CoA 2-hydroxylase (PAHX). The mRNA is cell-to-cell mobile. |
AT3G52430 | Encodes a lipase-like gene that is important for salicylic acid signaling and function in resistance (R) gene-mediated and basal plant disease resistance. PAD4 can interact directly with EDS1, another disease resistance signaling protein. Expressed at elevated level in response to green peach aphid (GPA) feeding, and modulates the GPA feeding-induced leaf senescence through a mechanism that doesn't require camalexin synthesis and salicylic acid (SA) signaling. Required for the ssi2-dependent heightened resistance to GPA. The mRNA is cell-to-cell mobile. |
AT1G09570 | Light-labile cytoplasmic red/far-red light photoreceptor involved in the regulation of photomorphogenesis. It exists in two inter-convertible forms: Pr and Pfr (active) and functions as a dimer.The N terminus carries a single tetrapyrrole chromophore, and the C terminus is involved in dimerization. It is the sole photoreceptor mediating the FR high irradiance response (HIR). Major regulator in red-light induction of phototropic enhancement. Involved in the regulation of de-etiolation. Involved in gravitropism and phototropism. Requires FHY1 for nuclear accumulation. |
AT2G18790 | Red/far-red photoreceptor involved in the regulation of de-etiolation. Exists in two inter-convertible forms: Pr and Pfr (active). Involved in the light-promotion of seed germination and in the shade avoidance response. Promotes seedling etiolation in both the presence and absence of phytochrome A. Overexpression results in etiolation under far-red light. Accumulates in the nucleus after exposure to far red light. The phosphorylation state of the Ser-86 residue of the phytochrome B molecule alters dark reversion of the molecule. The mRNA is cell-to-cell mobile. |
AT1G09530 | Transcription factor interacting with photoreceptors phyA and phyB. Forms a ternary complex in vitro with G-box element of the promoters of LHY, CCA1. Acts as a negative regulator of phyB signalling. It degrades rapidly after irradiation of dark grown seedlings in a process controlled by phytochromes. Does not play a significant role in controlling light input and function of the circadian clockwork. Binds to G- and E-boxes, but not to other ACEs. Binds to anthocyanin biosynthetic genes in a light- and HY5-independent fashion. PIF3 function as a transcriptional activator can be functionally and mechanistically separated from its role in repression of PhyB mediated processes. |
AT2G46970 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
AT3G59060 | Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
AT1G14280 | Encodes phytochrome kinase substrate 2. PKS proteins are critical for hypocotyl phototropism. Forms a complex with Phot1, Phot2 and NPH3. |
AT3G16500 | phytochrome-associated protein 1 (PAP1) |
AT1G22280 | Encodes a phytochrome-associated protein, PAPP2C (phytochrome-associated protein phosphatase type 2C). PAPP2C interacts in the nucleus with phyA (phytochrome A) and phyB. Functions as a regulator of phytochrome-interacting factor PIF3 by dephosphorylating phytochromes in the nucleus. |
AT3G46640 | Encodes a myb family transcription factor with a single Myb DNA-binding domain (type SHAQKYF) that is unique to plants and is essential for circadian rhythms, specifically for transcriptional regulation within the circadian clock. LUX is required for normal rhythmic expression of multiple clock outputs in both constant light and darkness. It is coregulated with TOC1 and seems to be repressed by CCA1 and LHY by direct binding of these proteins to the evening element in the LUX promoter. The mRNA is cell-to-cell mobile. |
AT2G31980 | PHYTOCYSTATIN 2;(source:Araport11) |
AT4G16500 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT1G06570 | Mutation of the PDS1 locus disrupts the activity of p-hydroxyphenylpyruvate dioxygenase (HPPDase), the first committed step in the synthesis of both plastoquinone and tocopherols in plants. |
AT2G02220 | Encodes a protein interacting with phytosulfokine, a five amino acid sulfated peptide (YIYTQ). Contains dual guanylate cyclase and kinase catalytic activities that operate in vivo. |
AT1G13590 | Encodes a phytosulfokine-alpha (PSK) precursor, a unique plant peptide growth factor first described in Asparagus. |
AT3G44735 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. |
AT3G49780 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. Plants overexpressing this gene (under a 35S promoter), develop normal cotyledons and hypocotyls but their growth, in particular that of their roots, was faster than that of wildtype. |
AT1G54570 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
AT2G39210 | Major facilitator superfamily transmembrane transporter responsible for the uptake of picolinate herbicides. |
AT2G48060 | Similar to mechanically sensitive ion channel identified in mouse. Mutants display root helical growth phenotype in agar media suggesting a role in mechanoperception at the root cap. |
AT1G80770 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G01190 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT4G32260 | ATPase, F0 complex, subunit B/B, bacterial/chloroplast;(source:Araport11) |
AT1G68450 | VQ motif-containing protein;(source:Araport11) |
AT1G71720 | Encodes a chloroplast localized protein that regulates the translation of Ycf1 by binding to its mRNA. It is involved in the biogenesis of photosynthetic complexes. |
AT2G01140 | Aldolase superfamily protein;(source:Araport11) |
AT2G26510 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
AT1G70940 | A regulator of auxin efflux and involved in differential growth. PIN3 is expressed in gravity-sensing tissues, with PIN3 protein accumulating predominantly at the lateral cell surface. PIN3 localizes to the plasma membrane and to vesicles. In roots, PIN3 is expressed without pronounced polarity in tiers two and three of the columella cells, at the basal side of vascular cells, and to the lateral side of pericycle cells of the elongation zone. PIN3 overexpression inhibits root cell growth. Protein phosphorylation plays a role in regulating PIN3 trafficking to the plasma membrane. The mRNA is cell-to-cell mobile. |
AT2G01420 | Encodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452). |
AT1G23080 | Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux. |
AT1G71090 | Auxin efflux carrier family protein;(source:Araport11) |
AT5G01990 | Auxin efflux carrier family protein;(source:Araport11) |
AT5G65980 | Auxin efflux carrier family protein;(source:Araport11) |
AT2G34650 | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
AT5G54490 | Encodes a PINOID (PID)-binding protein containing putative EF-hand calcium-binding motifs. The interaction is dependent on the presence of calcium. mRNA expression is up-regulated by auxin. Not a phosphorylation target of PID, likely acts upstream of PID to regulate the activity of this protein in response to changes in calcium levels. |
AT1G32100 | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows specificity for pinoresinol and not lariciresinol. |
AT4G13660 | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows preference for pinoresinol and not lariciresinol. The mRNA is cell-to-cell mobile. |
AT4G02075 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G05000 | Encodes an atypical dual-specificity phosphatase. |
AT4G03960 | Encodes an atypical dual-specificity phosphatase involved in the negative regulation of defense response to a bacterial pathogen, P. syringae pv. tomato. |
AT5G15120 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
AT5G39890 | Plant Cysteine Oxidase (PCO). Involved in controlling the stability of Group VII ethylene response factors (ERF-VIIs) via N-Arg/degron pathway through catalyzing the oxidation of their N-Cys for subsequent Arginyl-tRNA--protein transferase 1 (ATE1) mediated arginine installation. |
AT2G42670 | Plant Cysteine Oxidase (PCO). Involved in controlling the stability of Group VII ethylene response factors (ERF-VIIs) via N-Arg/degron pathway through catalyzing the oxidation of their N-Cys for subsequent Arginyl-tRNA--protein transferase 1 (ATE1) mediated arginine installation. |
AT1G55010 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
AT1G08990 | plant glycogenin-like starch initiation protein 5;(source:Araport11) |
AT2G35710 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
AT5G05850 | Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
AT4G35470 | Encodes PIRL4, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
AT2G17440 | Encodes PIRL5, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
AT5G58650 | Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK). |
AT3G46510 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. Can be phosphorylated in vitro by MLPK, ARK1, and ARK2 but not by SD1-29. Involved in ubiquitination of pattern recognition receptor FLS2. |
AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
AT3G19380 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
AT3G47820 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT1G76390 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G18320 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress.Expression in roots is enhanced by auxin and to a lesser extent ABA and cytokinin treatment. |
AT5G67530 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT3G07360 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT1G23030 | Encodes a plant U-Box protein that is capable of binding and ubiquitinating a variety of targets including MYC2,LRR1,KIN and acting as an E3 ligase. Regulates a number of physiological hormonal and environment al responses via selective degradation of targets.Unlike PUB10, its closest homolog in Arabidopsis, it does not appear to play a major role in the MeJA-mediated response. |
AT1G71020 | Encodes a nuclear localized plant U-Box protein that interacts with MYC2 and regulates its stability by acting as an E3 ubiquitin ligase and polyubiquitinating MYC2. By this mechanism, it targets MYC2 for destruction thereby affecting JA signaling. |
AT4G04210 | Arabidopsis thaliana CDC48-interacting UBX-domain protein (PUX4) |
AT1G14570 | Encodes a nuclear UBX-containing protein that can bridge ubiquitin to AtCDC48A. |
AT3G54110 | Member of Uncoupling protein PUMP2 family. Encodes a mitochondrial uncoupling protein AtUCP1 involved in maintain the redox poise of the mitochondrial electron transport chain to facilitate photosynthetic metabolism. Disruption of UCP1 results in a photosynthetic phenotype. Specifically there is a restriction in photorespiration with a decrease in the rate of oxidation of photorespiratory glycine in the mitochondrion. This change leads to an associated reduced photosynthetic carbon assimilation rate. The mRNA is cell-to-cell mobile. |
AT1G67690 | Zincin-like metalloproteases family protein;(source:Araport11) |
AT4G36650 | Encodes a protein with similarity to the general transcription factor TFIIB. pBRP binds rDNA sequences in vitro. pBRP has been localized to the outer face of the plastid membrane with GFP fusion however, under conditions of proteosome inhibition it is found in the nucleus. |
AT5G19930 | PGR is putative plasma membrane glucose- responsive regulator that is expressed in response to glucose stimulation.RNAi knockdown mutant seeds have enhanced sensitivity to glucose and 2-deoxyglucose. |
AT4G00430 | a member of the plasma membrane intrinsic protein subfamily PIP1. involved redundantly with PIP1;1/2/3/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
AT3G61430 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. The mRNA is cell-to-cell mobile. |
AT2G45960 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. Involved redundantly with PIP1;1/3/4/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
AT3G54820 | plasma membrane intrinsic protein 2;(source:Araport11) |
AT2G16850 | plasma membrane intrinsic protein 2;(source:Araport11) |
AT3G53420 | a member of the plasma membrane intrinsic protein subfamily PIP2. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed specifically in the vascular bundles and protein level increases slightly during leaf dev. When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
AT2G39010 | plasma membrane intrinsic protein 2E;(source:Araport11) |
AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
AT4G20260 | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. The mRNA is cell-to-cell mobile. |
AT1G69295 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
AT3G04370 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
AT1G19880 | Encodes a regulator of chromatin condensation 1 (RCC1) family protein; confers plasticity of rosette diameter in response to changes in N availability. |
AT5G53280 | An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid division machinery. Similar to ARC5, PDV1 localized to a discontinuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. Topological analysis showed that the large N-terminal region of PDV1 upstream of the transmembrane helix bearing a putative coiled-coil domain is exposed to the cytosol. Mutation of the conserved PDV1 C-terminal Gly residue did not block PDV1 insertion into the outer envelope membrane but did abolish its localization to the division site. The mRNA is cell-to-cell mobile. |
AT2G16070 | An integral outer envelope membrane protein (its homolog in A thaliana PDV1), component of the plastid division machinery. Similar to ARC6, PDV2 localizes to a continuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. |
AT3G62590 | PLIP3 is a glycerolipid A1 lipase with substrate specificity for phosphatidylglycerol. Expression is induced by ABA. |
AT1G02660 | PLIP2 is a glycerolipid A1 lipase with substrate preference for monogalactosyldiacylglycerol. Expression is induced by ABA. |
AT1G42550 | Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile. |
AT2G24090 | Ribosomal protein L35;(source:Araport11) |
AT3G54210 | Ribosomal protein L17 family protein;(source:Araport11) |
AT5G47190 | Ribosomal protein L19 family protein;(source:Araport11) |
AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
AT1G80480 | plastid transcriptionally active 17;(source:Araport11) |
AT2G32180 | plastid transcriptionally active 18;(source:Araport11) |
AT1G21600 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. essential subunit of the plastid-encoded RNA polymerase (PEP). Mediates phytochrome signaling. |
AT4G20010 | Organellar Single-stranded DNA Binding protein. Decreases MMEJ on long ssDNA templates. |
AT5G17870 | plastid-specific ribosomal protein 6 precursor (Psrp-6) - like |
AT5G16150 | Encodes a putative plastidic glucose transporter. |
AT5G52920 | encodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. The mRNA is cell-to-cell mobile. |
AT1G06870 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
AT4G39730 | PLAT1 domain stress protein family member. Involved in mediating response to stresses such as pathogen infection. It is found in endoplasmic reticulum bodies. PLAT1 is induced by pathogenic fungi and induces the production of scopolin. |
AT5G39570 | Protein of unknown function. Binds phosphatidic acid and acts downstream of PLDalpha. |
AT3G16650 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G45800 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
AT1G22780 | S18 ribosomal protein involved in the binding of f-Met tRNA during initiation of mRNA translation. Expression restricted to meristems. Mutant phenotype-pointed first leaves,reduced fresh weight, growth retardation. |
AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
AT4G39403 | Encodes a 36 amino acid polypeptide that is necessary for correct responses to cytokinins and auxins, correct cell expansion in the root, and for vascular patterning in the leaf. Mutation of PLS results in an enhanced ethylene-response phenotype, defective auxin transport and homeostasis, and altered microtubule sensitivity to inhibitors. |
AT1G67960 | POD1 is involved in pollen tube guidence and early embryo patterning. |
AT4G35540 | Encodes a novel plant-specific TFIIB-related protein that can interact with TBP2 and bind DNA. It can also form a homodimer and interact with the subunits of RNA polymerases. Mutant pollen fails to germinate. |
AT3G22200 | Genetically redundant with POP3;mediates pollen tube guidance. Double mutants are self sterile; gamma-aminobutyrate transaminase subunit precursor; nuclear gene for mitochondrial product. Encodes gamma-aminobutyrate transaminase that uses pyruvate instead of alpha-ketoglutarate as cosubstrate. Mutations in POP2/HER1 render roots resistant to the inhibitory growth effects of the volatile organic compound E-2-hexenal implicated in plant defense. |
AT2G46920 | Pol mutations are recessive, partial suppressors of meristem defects in strong clv1 and clv3 mutants, and nearly complete suppressors of weak clv1 mutants. Single mutants appear normal. Acts downstream of the CLV signaling pathway in meristem development and is required together with PLL1 for stem-cell maintenance through the regulation of WUS. |
AT2G35350 | Encodes a protein most similar to the POLTERGEIST locus. Double mutant analysis of loss of function alleles indicate PLL1 functions redundantly with POL to regulate meristem size and pedicel length. Acts in a dose dependent manner with POL to suppress the clv1, clv2 and clv3 phenotypes. |
AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
AT4G34110 | Putative poly-A binding protein. Member of a gene family .Expressed in stele and root meristem and post-fertilization ovules.Member of the class II family of PABP proteins. The mRNA is cell-to-cell mobile. |
AT2G23350 | polyadenylate-binding protein, putative / PABP, putative.Member of the Class II family of PABP proteins. Highly and ubiquitously expressed. The mRNA is cell-to-cell mobile. |
AT3G16380 | polyadenylate-binding protein, putative / PABP, putative, similar to polyadenylate-binding protein (poly(A)-binding protein) from {Arabidopsis thaliana} SP:P42731, (Cucumis sativus) GI:7528270, {Homo sapiens} SP:Q13310, {Arabidopsis thaliana} SP:Q05196; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Member of the class III family of PABP proteins. |
AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
AT2G43020 | Encodes a polyamine oxidase. |
AT3G59050 | Encodes a polyamine oxidase. |
AT1G65840 | encodes a peroxisomal polyamine oxidase, involved in the back-conversion polyamine degradation pathway. Among the five polyamine oxidases in the Arabidopsis genome, PAO4 is the major isoform in root peroxisomes. The mRNA is cell-to-cell mobile. |
AT1G31820 | Encodes POLYAMINE UPTAKE TRANSPORTER 1, an amino acid permease family protein. |
AT1G31830 | Encodes POLYAMINE UPTAKE TRANSPORTER 2, an amino acid permease family protein. |
AT3G19553 | Encodes POLYAMINE UPTAKE TRANSPORTER 5, an amino acid permease family protein. |
AT1G70370 | Polygalacturonase involved in cell wall modification. |
AT5G06860 | Encodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection. Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
AT5G06870 | Encodes a polygalacturonase inhibiting protein involved in plant defense response. PGIPs inhibit the activity of pectin degrading enzymes such as those produced by fungal pathogens. PGIP2 is induced by fungal infection and methyl jasmonate.Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
AT3G18830 | This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (myo-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily. |
AT4G36670 | Major facilitator superfamily protein;(source:Araport11) |
AT1G72590 | Encodes a polyphenol reductase. |
AT4G05320 | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. The mRNA is cell-to-cell mobile. |
AT5G03240 | encodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. |
AT3G47640 | Encodes POPEYE (PYE), a bHLH transcription factor regulating response to iron deficiency in Arabidopsis roots. |
AT2G18740 | Putative temperature-specific splice regulator of development. Only the first splice form (PCP-alpha) has this function as result of C-terminal addition. |
AT2G31370 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT4G24370 | hypothetical protein;(source:Araport11) |
AT3G15840 | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
AT4G02460 | Encodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination. |
AT1G04690 | potassium channel beta subunit 1;(source:Araport11) |
AT4G22200 | Encodes AKT2, a photosynthate- and light-dependent inward rectifying potassium channel with unique gating properties that are regulated by phosphorylation. Expressed in guard cell protoplasts and in the phloem and xylem of aerial portions of the plant. The channel can coassemble with another K+ channel, KAT1, in vitro. In guard cells, AKT2/3 is responsible for the Ca2+ sensitivity of the K+ uptake channel. In the phloem, it regulates the sucrose/H+ symporters via the phloem potential. AKT2 belongs to the Shaker family K+ channels which include the following groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT2G30070 | Encodes a high affinity potassium transporter. |
AT2G40540 | putative potassium transporter AtKT2p (AtKT2) mRNA, |
AT5G14880 | Potassium transporter family protein;(source:Araport11) |
AT5G58600 | Belongs to a large family of plant-specific genes of unknown function. Involved in resistance to the powdery mildew species Erysiphe cichoracearum and Erysiphe orontii, but not to the unrelated pathogens Pseudomonas syringae or Peronospora parasitica. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G54920 | Powdery mildew resistant mutant encodes a pectate lyase-like protein The mRNA is cell-to-cell mobile. |
AT3G52250 | Encodes a protein with a putative role in mRNA splicing. The mRNA is cell-to-cell mobile. |
AT3G61600 | POZ/BTB containing-protein AtPOB1. Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. The mRNA is cell-to-cell mobile. |
AT2G20630 | PP2C induced by AVRRPM1;(source:Araport11) |
AT5G17070 | Encodes a PP4R2 domain protein that likely functions as a regulatory subunit of PP4, a highly conserved ser/thr protein phosphatase. |
AT5G51700 | Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation. |
AT1G03140 | PRP18a is one of two paralogs (the other being PRP18b) which are highly similar to the step II splicing factors in yeast. Loss of function mutations show defects in alternative splicing, mostly intron retention events. |
AT4G28460 | Activates immune responses through RECEPTOR-LIKE KINASE7 (RLK7). Induces stomatal closure is dependent on RLK7 and the transcription of genes involved in SA production and SA-dependent stomatal closure. SA promotes the flg22-induced expression of PIP1 preligand, prePIP1. |
AT5G23290 | prefoldin 5;(source:Araport11) |
AT5G05987 | prenylated RAB acceptor 1.A2;(source:Araport11) |
AT3G11397 | prenylated RAB acceptor 1.A3;(source:Araport11) |
AT3G56110 | prenylated RAB acceptor 1.B1;(source:Araport11) |
AT5G05380 | prenylated RAB acceptor 1.B3;(source:Araport11) |
AT2G38360 | prenylated RAB acceptor 1.B4;(source:Araport11) |
AT3G13710 | prenylated RAB acceptor 1.F4;(source:Araport11) |
AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
AT4G27540 | prenylated RAB acceptor 1.H;(source:Araport11) |
AT5G15860 | Encodes a protein with prenylcysteine methylesterase activity. |
AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
AT4G38570 | Putative CDP-diacylglycerol-inositol 3-phosphatidyltransferase 2;(source:Araport11) |
AT2G19760 | first member of the Arabidopsis profilin multigene family, expressed in all organs of Arabidopsis. Binds poly-L-proline. The first intron of PRF1 enhances gene expression in vegetative tissues. |
AT4G29340 | Profilin is a low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton in eukaryotes, including higher plants. PRF4 and PRF5 are late pollen-specific and are not detectable in other cell types of the plant body including microspores and root hairs. Immunocytochemical studies at the subcellular level reveal that both the constitutive and pollen-specific profilins are abundant in the cytoplasm. In vegetative cell types, such as root apical cells, profilins showed localization to nuclei in addition to the cytoplasmic staining. |
AT2G19770 | Encodes profilin 5, originally named profilin 4 (PRO4/PFN4). Low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Pollen-specific plant profilin present predominantly in mature pollen and growing pollen tubes. |
AT1G03860 | prohibitin 2 |
AT2G39890 | Encodes a proline transporter with affinity for gly betaine, proline and GABA. Protein is expressed in the vascular tissue, specifically the phloem. |
AT3G55740 | Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed most highly in the roots. |
AT3G24550 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). The mRNA is cell-to-cell mobile. |
AT1G26150 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT1G70460 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT4G32710 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT3G18810 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT3G23170 | PRP is a proline/serine rich protein of unknown function. It interacts with defense related MAP kinase MPK6 and others. It's expression is induced by PAMP elicitors. May play a role in response to pathogens. |
AT3G62120 | Encodes a cytosolic prolyl-tRNA synthetase. |
AT5G02190 | encodes an aspartic protease, has an important role in determining cell fate during embryonic development and in reproduction processes. The loss-of-function mutation of PCS1 causes degeneration of both male and female gametophytes and excessive cell death of developing embryos during torpedo stage. |
AT5G23720 | Encodes a protein tyrosine phosphatase Propyzamide-Hypersensitive 1 (PHS1). One of the mutant alleles, phs1-1, is hypersensitive to the microtubule-destabilizing drug propyzamide, suggesting that PHS1 may be involved in phosphorylation cascades that control the dynamics of cortical microtubules in plant cells. A second allele, phs1-3, is hypersensitive to abscisic acid, indicating a possible involvement of PHS1 in ABA signalling. |
AT3G13330 | Encodes a protein that interacts with the 26S proteasome. Mutants are phenotypically indistinguishable from wild type plants under a variety of growth conditions. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor. |
AT5G35590 | Encodes 20S proteasome subunit PAA1 (PAA1). |
AT1G71140 | MATE transporter that can export the antibiotic norfloxacin. |
AT4G34090 | cyclin delta-3;(source:Araport11) |
AT1G08910 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
AT4G32190 | Encodes a plastid-located coiled coil-containing protein that is required for normal starch granule initiation in Arabidopsis chloroplasts. Mutants lacking MRC have fewer starch granules per chloroplast than the wild type. Interacts with PTST2 (At1g27070), which is also required for normal starch granule initiation (DOI:10.1105/tpc.18.00219). |
AT2G28930 | protein kinase 1B;(source:Araport11) |
AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
AT2G02800 | Encodes protein kinase APK2b. |
AT5G53920 | Protein methyltransferase. One target is PRPL11 which it methylates on Lys 109. |
AT5G19680 | PP1 Regulatory Subunit3. Interacts with members of the Type One Protein Phosphatases (TOPP) family.Facilitates the nuclear localization of TOPP4 which is required for its activity in mediating ABA responses. |
AT2G33700 | Encodes a putative protein phosphatase 2C that positively regulates salt tolerance in abscisic acid-dependent manner. |
AT3G11410 | Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA. |
AT5G55260 | Encodes a protein with similarity to the catalytic subunit of the mammalian PPX protein phospatase. |
AT3G51390 | DHHC-type zinc finger family protein;(source:Araport11) |
AT2G33640 | DHHC-type zinc finger family protein that encodes a functional s-acyl transferase. |
AT3G56930 | Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane. |
AT2G35680 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem. |
AT1G68820 | Putative C3HC4 zinc-finger ubiquitin E3 ligase, negative regulator in ABA and drought stress response. May act as a positive role in regulating the high temperature by mediating the degradation of unknown target proteins. |
AT1G18470 | Putative C3HC4 zinc-finger ubiquitin E3 ligase that is induced by ABA and plays a positive role in ABA signaling. |
AT3G48330 | Encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination. |
AT3G08730 | Encodes a protein-serine kinase that phosphorylates ribosomal protein in vitro. Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Involved in translational up-regulation of ribosomal proteins. Phosphorylated by PDK1. Interacts with RAPTOR1, which in turn interacts with TOR. SPK6 activity is affected by osmotic stress, and plants overexpressing S6k1 are hypersensitive to osmotic stress. The gene is expressed in all tissues examined, with highest expression level detected in metabolically active tissues. |
AT5G54190 | light-dependent NADPH:protochlorophyllide oxidoreductase A |
AT1G03630 | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
AT4G27500 | interacts with H+-ATPase, and regulates its activity The mRNA is cell-to-cell mobile. |
AT5G66570 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. The mRNA is cell-to-cell mobile. |
AT5G02810 | PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
AT4G00760 | Encodes a response-regulator like protein. |
AT2G46790 | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR7 to regulate hypocotyl growth under photoperiodic conditions. |
AT3G13175 | transmembrane protein;(source:Araport11) |
AT5G08660 | D-lactate dehydrogenase (DUF668);(source:Araport11) |
AT1G72300 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by AT5G58650 that promotes cellular proliferation and expansion. |
AT2G47060 | Encodes Pto-interacting 1-4 (PTI1-4), a member of the PTI1-like serine/threonine protein kinases that share strong sequence identity to the tomato PTI1 kinase. |
AT5G56510 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G60180 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G09610 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT2G32080 | similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication |
AT1G28230 | Encodes a transporter that transports purines,cytokinins and other adenine derivatives. Expressed in the leaf hydathodes where it may be involved in re-uptake of cytokinins during guttation. |
AT1G19770 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
AT1G57990 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT2G16430 | Encodes an acid phosphatase involved plant acclimation to Pi deprivation. |
AT2G32770 | purple acid phosphatase 13;(source:Araport11) |
AT3G07130 | Encodes PAP15, a purple acid phosphatase with phytase activity. Expression of PAP15 is developmentally and temporally regulated, with strong expression at the early stages of seedling growth and pollen germination. The expression is also organ/tissue-specific, with strongest expression in the vasculature, pollen grains, and roots. Recombinant PAP protein exhibits broad substrate specificity with moderate phytase activity. PAP15 likely mobilizes phosphorus reserves in plants, particularly during seed and pollen germination. |
AT3G17790 | Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
AT5G34850 | Encodes a root-secreted purple acid phosphatase precursor involved in extracellular phosphate-scavenging. |
AT1G14700 | purple acid phosphatase 3;(source:Araport11) |
AT2G01890 | Encodes a purple acid phosphatase (PAP) belonging to the low molecular weight plant PAP group. |
AT2G47750 | Encodes GH3.9, a member of the GH3 family auxin-responsive genes. gh3.9-1 mutants had greater primary root length, increased sensitivity to indole-3-acetic acid (IAA)-mediated root growth inhibition, but no obvious effects on apical dominance or leaf morphology. |
AT5G40340 | PWWP domain protein involved in regulation of FLC and flowering time. |
AT3G05430 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
AT3G03140 | Encodes a chromatin-associated protein that interacts with plant nuclear lamin-like components to regulate nuclear size. |
AT1G08590 | Encodes one of the two putative eLRR kinase closely related to PXY (At1g08590/PXL1 and At4g28650/PXL2). Insertion mutants in either pxl1 or pxl2 do not exhibit an obvious phenotype in the stem; double-mutant combinations of a Col allele, of pxy (pxy-3) with pxl1 and pxl2, generate a more severe vascular phenotype than pxy-3 alone, suggesting that these genes act synergistically with PXY in regulating vascular-tissue development in the stem. |
AT2G36570 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G41820 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G73000 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. The mRNA is cell-to-cell mobile. |
AT2G40330 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
AT4G01026 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of ABI1 and ABI2. |
AT4G17870 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
AT5G49970 | encodes the bifunctional pyridoxine (pyridoxamine) 5?-phosphate oxidase (PPOX)(EC 1.4.3.5) that is involved in the formation of pyridoxal 5'-phosphate (member of the vitamin B6 group). NAD(P)HX epimerase (AT5G49970) interconverts the two epimers of NAD(P)HX. |
AT3G16050 | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation. |
AT4G22930 | Encodes dihydroorotase (PYR4). |
AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
AT5G12200 | Encodes a protein with dihydropyrimidine amidohydrolase activity. It localizes to the secretory system and plays a role in uracil metabolism. |
AT2G18230 | Encodes a protein that might have inorganic pyrophosphatase activity. |
AT2G46860 | Encodes a protein that might have inorganic pyrophosphatase activity. |
AT3G53620 | Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate. The mRNA is cell-to-cell mobile. |
AT4G01480 | Encodes a protein that might have inorganic pyrophosphatase activity. |
AT5G09650 | Encodes a protein with inorganic pyrophosphatase activity. |
AT5G54960 | pyruvate decarboxylase-2 |
AT1G01090 | pyruvate dehydrogenase E1 alpha subunit |
AT1G30120 | Encodes a putative plastid pyruvate dehydrogenase E1 beta subunit that is distinct from the mitochondrial pyruvate dehydrogenase E1 beta subunit. |
AT4G15530 | Encodes a dual-targeted protein believed to act as a pyruvate, orthophosphate dikinase. These enzymes are normally associated with C4 photosynthesis which does not occur in Arabidopsis. However, PPDK may play a role in remobilizing nitrogen during leaf senescence in Arabidopsis. The product of the long transcript (.1 gene model) was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol. The two proteins were also found to be expressed in slightly different tissues. |
AT1G13860 | Encodes QUASIMODO2 LIKE1 (QUL1), a paralog of QUASIMODO2 (QUA2). AT1G78240 (QUA2), AT1G13860 (QUL1) and AT2G03480 (QUL2) form a clade with a possible role in plant vasculature development. |
AT5G22370 | Encodes QQT1. Required for early embryo development. qqt1 mutant lines are embryo-defective. Participates in the organization of microtubules during cell division. Interacts with QQT2 (encoded by AT4G21800). |
AT4G30710 | QWRF motif protein (DUF566);(source:Araport11) |
AT5G43160 | QWRF motif protein (DUF566);(source:Araport11) |
AT3G06540 | Encodes a cytoplasmic Rab escort protein that preferentially binds the GDP-bound form of Rab and stimulates geranylgeranylation of various Rab GTPases in Arabidopsis extracts in vitro. |
AT3G59920 | RAB GDP DISSOCIATION INHIBITOR 2 The mRNA is cell-to-cell mobile. |
AT1G22740 | GTP-binding protein Rab7 |
AT5G47200 | AtRabD2b encodes a Rab GTPase, which plays important roles in pollen development, germination and tube elongation. The mRNA is cell-to-cell mobile. |
AT4G17530 | AtRabD2c encodes a Rab GTPase, which plays important roles in pollen development, germination and tube elongation. |
AT5G03520 | GTPase that colocalizes with golgi and plasma membranes. |
AT1G16920 | small GTP-binding protein (Rab11)similar to YPT3/RAB11 proteins in yeast and mammals, respectively. YPT3/RAB11 is involved in intracellular protein trafficking. |
AT5G45750 | RAB GTPase homolog A1C;(source:Araport11) |
AT4G18800 | Encodes RabA1d, a member of the RabA subfamily of small Rab GTPases. |
AT5G60860 | RAB GTPase homolog A1F;(source:Araport11) |
AT3G15060 | RAB GTPase homolog A1G;(source:Araport11) |
AT1G07410 | RAB GTPase homolog A2B;(source:Araport11) |
AT3G46830 | RAB GTPase homolog A2C;(source:Araport11) |
AT5G59150 | RAB GTPase homolog A2D;(source:Araport11) |
AT5G65270 | RAB GTPase homolog A4A;(source:Araport11) |
AT4G39990 | Rab GTPase that selectively marks cell wall-containing TGN compartments. Involved in protein trafficking to membranes during tip growth. |
AT5G47960 | Encodes a small molecular weight g-protein. |
AT3G12160 | Encodes RABA4D, a member of the Arabidopsis RabA4 subfamily of Rab GTPase proteins. It is transported in exocytic vesicles to the apical tip of pollen tubes where it appears to promote tip growth. Proper localization of RabA4d depends on ROP1, RIC3, and RIC4 activity. |
AT1G18200 | Rab GTPase-like A1I protein;(source:Araport11) |
AT5G03530 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. CFP:RabC2a appears to co-localize with peroxisomes. |
AT4G20360 | Nuclear transcribed, plastid localized EF-Tu translation elongation factor. Referred to as AtRabE1b in DOI:10.1104/pp.013052. However, wider community usage and more publications assign the symbol RabE1b to At5g59840. |
AT5G39620 | RAB GTPase homolog G1;(source:Araport11) |
AT3G18820 | RAB7 homolog, forms retromer complex with VPS35; ES17 prevents the retromer complex to endosome anchoring, resulting in retention of RABG3f. The interaction of RABG3f?VPS35 functinons as a checkpoint in the control of traffic toward the vacuole. |
AT5G45130 | small GTP binding protein The mRNA is cell-to-cell mobile. |
AT4G35020 | A member of ROP GTPase gene family; Encodes a Rho-like GTP binding protein. |
AT1G71100 | Encodes a ribose 5-phosphate isomerase involved in the formation of uridine used for the synthesis of UDP-sugars. Mutants of this gene are affected in cellulose biosynthesis. |
AT5G66130 | Encodes a homolog to yeast RAD17. Involved in the regulation of DNA damage repair and homologous recombination. Mutant has increased sensitivity to MMS and increased telomere lengths. |
AT5G21900 | Contributes to UV tolerance through nucleotide excision repair. |
AT1G79650 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
AT3G02540 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
AT4G31170 | Protein kinase superfamily protein;(source:Araport11) |
AT3G46930 | Encodes a Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Raf43. Required for tolerance to multiple abiotic stresses. |
AT3G04735 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT3G05490 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT3G25170 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT4G14010 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile. |
AT3G63130 | Encodes a RAN GTPase activating protein involved in nuclear import, cell plate formation and mitotic spindle formation. Associates with nuclear envelope membranes. |
AT1G02900 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. Mediates Ca2+-dependent signaling. Regulates the splicing of flowering genes and exerts an opposite effect on the flowering time compared with FER. |
AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
AT3G05880 | Induced by low temperatures, dehydration and salt stress and ABA. Encodes a small (54 amino acids), highly hydrophobic protein that bears two potential transmembrane domains. |
AT3G05890 | Low temperature and salt responsive protein family;(source:Araport11) |
AT2G45280 | Encodes a protein similar to RAD51C involved in double stranded break repair via homologous recombination. Sensitive to DSB induced by Mitomycin C and gamma irradiation, interacts with Atxrcc3 in yeast two-hybrid assay. Required for female meiosis but not critical for mitosis under normal conditions. |
AT5G48330 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT3G20390 | Encodes a plastidial RidA (Reactive Intermediate Deaminase A) homolog that hydrolyzes the enamines/imines formed by Thr dehydratase from Ser or Thr. RidA accelerates the deamination of reactive enamine/imine intermediates produced by threonine dehydratase (At3g10050) with threonine or serine as substrates. In the absence of RidA, the serine-derived imine inactivates BCAT3 (At3g49680). RidA thus pre-empts damage to BCAT3 by hydrolyzing the reactive imine before it does damage. |
AT1G48630 | Encodes a protein with similarity to mammalian RACKs. RACKs function to shuttle activated protein kinase C to different subcellular sites and may also function as a scaffold through physical interactions with other proteins. RACK1B has no phenotype on its own and probably acts redundantly with RACK1A and RACK1C. |
AT5G66160 | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2. |
AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
AT1G07390 | receptor like protein 1;(source:Araport11) |
AT1G74200 | receptor like protein 16;(source:Araport11) |
AT2G32660 | receptor like protein 22;(source:Araport11) |
AT2G33050 | receptor like protein 26;(source:Araport11) |
AT3G05360 | receptor like protein 30;(source:Araport11) |
AT3G11080 | receptor like protein 35;(source:Araport11) |
AT3G23010 | receptor like protein 36;(source:Araport11) |
AT1G28340 | receptor like protein 4;(source:Araport11) |
AT3G53240 | receptor like protein 45;(source:Araport11) |
AT4G13920 | receptor like protein 50;(source:Araport11) |
AT4G18760 | receptor like protein 51;(source:Araport11) |
AT5G25910 | putative disease resistance protein induced by chitin oligomers. |
AT5G40170 | receptor like protein 54;(source:Araport11) |
AT1G47890 | receptor like protein 7;(source:Araport11) |
AT1G58190 | receptor like protein 9;(source:Araport11) |
AT2G18890 | RLCK VI_A class kinase which activity is regulated by Rho-of-plants (ROP) GTPases. Controls seedling and plant growth in parallel with gibberrellin. |
AT5G67280 | receptor-like kinase;(source:Araport11) |
AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
AT2G48010 | receptor-like serine/threonine kinase (RKF3) The mRNA is cell-to-cell mobile. |
AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
AT3G02130 | Encodes a receptor-like kinase RPK2 (also known as TOADSTOOL 2/TOAD2). Functions as a regulator of meristem maintenance. Mutants are insensitive to synthetic CLV3 peptide. Mutations in the RPK2 also result in stem cell expansion and increased number of floral organs, as seen in the other clv mutants. Forms homo-oligomers. |
AT4G00340 | Encodes a receptor-like protein kinase that is expressed in roots. |
AT3G46530 | Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile. |
AT1G58602 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
AT1G67500 | Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
AT3G05740 | RECQ helicase l1;(source:Araport11) |
AT5G27680 | RECQ helicase SIM;(source:Araport11) |
AT2G47700 | RING/U-box superfamily protein;(source:Araport11) |
AT4G34410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Regulates programmed cell death (PCD) inhibitor genes. Involved in retarding programmed cell death under salt stress due to the regulation of processes participating in ROS inhibition. ERF-regulated transcripts belong to the tryptophan biosynthesis, tryptophan metabolism, and downstream plant hormone signal transduction pathways, where ERF109 potentially acts as a 'master switch' mediator of a cascade of consecutive events across the three pathways, promoting plant growth and re-adjustment to homeostasis due the direct participation in auxin biosynthesis leading to the plants ability to tolerate salt stress. |
AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
AT5G41040 | Encodes a feruloyl-CoA transferase required for suberin synthesis. Has feruloyl-CoA-dependent feruloyl transferase activity towards substrates with a primary alcohol. |
AT1G25260 | Involved in male gamete development. Trans-acting factor in the assembly of the pre-60S particle. |
AT1G75110 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
AT3G18990 | Required for vernalization. Essential for the complete repression of FLC in vernalized plants. Required for the methylation of histone H3 |
AT3G23590 | Encodes a protein shown to physically associate with the conserved transcriptional coregulatory complex, Mediator, and is involved in the regulation of phenylpropanoid homeostasis. Acts redundantly with REF4/MED5b (At2g48110). Required for expression of some dark-upregulated genes. RFR1 is the MED5a subunit of the mediator complex. |
AT5G01720 | RAE1 is an F-box protein component of a SCF-type E3 ligase complex. It is part of an alumium induced regulatory loop: its activity is induced by STOP1 and it in turn ubiquitinates STOP1 which is then targeted for degradation. |
AT2G36890 | Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB38, regulates axillary meristem formation. The mRNA is cell-to-cell mobile. |
AT3G26090 | Encodes AtRGS1, a putative membrane receptor for D-glucose. Also functions as a regulator of G-protein signaling. Has GTPase-accelerating activity. Regulates the activity of AtGPA1. Lines over-expressing the gene are more tolerant to dehydration and root elongation. These phenotypes are dependent on ABA. Nuclear localization of the protein is dependent on ABA. RGS1 endocytosis is induced by JA which promotes its dissociation from GPA1. |
AT1G79950 | Encodes a homologue of human Regulator of Telomere Elongation Helicase1 (RTEL1). Plays a central role in the preservation of genome stability. |
AT1G01360 | Encodes RCAR1 (regulatory components of ABA receptor). Interacts with and regulates the type 2C protein phosphatases (PP2Cs) ABI1 and ABI2. Functions as abscisic acid sensor. The mRNA is cell-to-cell mobile. |
AT5G53160 | Encodes RCAR3, a regulatory component of ABA receptor. Interacts with protein phosphatase 2Cs ABI1 and ABI2. Stimulates ABA signaling. The mRNA is cell-to-cell mobile. |
AT4G38630 | Regulatory particle non-ATPase subunit of the 26S proteasome with multiubiquitin-chain-binding capabilities |
AT5G42040 | regulatory particle non-ATPase 12B;(source:Araport11) |
AT1G53750 | 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, |
AT5G19990 | 26S proteasome AAA-ATPase subunit The mRNA is cell-to-cell mobile. |
AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
AT1G46768 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.1). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.10. |
AT4G36900 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1. |
AT1G78080 | Encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family (RAP2.4). The protein contains one AP2 domain. Role in mediating light and ethylene signaling. The mRNA is cell-to-cell mobile. |
AT1G43160 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT2G28550 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY2 to regulate CO and FT. TOE1 binds to activation domain of CO and binds CORE sequences of the FT promoter.TOE1/TOE2 are also targets of MiR172b and function in regulation of innate immunity. |
AT1G49480 | Encodes a nuclear-localized DNA-binding protein that interacts with ITN1 at the PM and nuclei in vivo and may regulate ITN's subcellular localization. |
AT3G48430 | Relative of Early Flowering 6 (REF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a positive regulator of flowering in an FLC-dependent pathway. REF6 mutants have hyperacetylation of histone H4 at the FLC locus. REF6 interacts with BES1 in a Y2H assay and in vitro. REF6 may play a role in brassinoteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. It is most closely related to the JHDM3 subfamily of JmjN/C proteins. The mRNA is cell-to-cell mobile. |
AT3G61260 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. Negatively regulates the cell-to-cell movement of TuMV via competition with PCaP1 for binding actin filaments. |
AT2G45820 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. |
AT3G57540 | Remorin family protein;(source:Araport11) |
AT2G41870 | Remorin family protein;(source:Araport11) |
AT4G19130 | Replication factor-A protein 1-like protein;(source:Araport11) |
AT5G02030 | Mutant has additional lateral organs and phyllotaxy defect. Encodes a homeodomain transcription factor. Has sequence similarity to the Arabidopsis ovule development regulator Bell1. Binds directly to the AGAMOUS cis-regulatory element. Its localization to the nucleus is dependent on the coexpression of either STM or BP. |
AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
AT5G58130 | Encodes ROS3 (repressor of silencing 3), a RNA-binding protein required for DNA demethylation. |
AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
AT1G15460 | Encodes a efflux-type boron transporter. Over-expression improved plant growth under B toxic conditions. |
AT1G74810 | HCO3- transporter family;(source:Araport11) |
AT4G11170 | Encodes RMG1 (Resistance Methylated Gene 1), a NB-LRR disease resistance protein with a Toll/interleukin-1 receptor (TIR) domain at its N terminus. RMG1 is expressed at high levels in response to flg22 and in naive met1/nrpd2 relative to wild-type plants. Expression of this gene is controlled by DNA methylation in its promoter region. The RMG1 promoter region is constitutively demethylated by active DNA demethylation mediated by the DNA glycosylase ROS1. |
AT3G57710 | Protein kinase superfamily protein;(source:Araport11) |
AT1G64070 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. |
AT1G54470 | Encodes a Cf-like gene in Arabidopsis that confers downy mildew resistance to several isolates of Peronospora parasitica. |
AT5G22330 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
AT1G09090 | NADPH-oxidase AtrbohB plays a role in seed after-ripening. Major producer of superoxide in germinating seeds. AtrbohB pre-mRNA is alternatively spliced in seeds in a hormonally and developmentally regulated manner. ABA caused accumulation of AtrbohB-? mRNA and prevented prevented AtrbohB-a mRNA expression in fresh seeds. |
AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
AT4G31920 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
AT2G25180 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical.The retention of leaf water content, maintenance of cell membrane stability, and enhancement of anthocyanin biosynthesis were found to contribute to the enhanced drought tolerance of the arr1,10,12 triple mutant. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
AT2G01760 | member of Response Regulator: B- Type |
AT2G40670 | response regulator 16 |
AT5G58080 | member of Response Regulator: B- Type |
AT1G59940 | Type A response regulator highly similar to bacterial two-component response regulators. Rapidly induced by cytokinin. Involved in red-light signaling. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
AT2G41310 | Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
AT3G48100 | Encodes a transcription repressor that mediates a negative feedback loop in cytokinin signalling. ARR5 expression is upregulated by Class I KNOX genes. Arr5 protein is stabilized by cytokinin in a two-component phosphorelay. |
AT5G62920 | Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. |
AT1G19050 | Encodes a member of the Arabidopsis response regulator (ARR) family, most closely related to ARR15. A two-component response regulator protein containing a phosphate accepting domain in the receiver domain but lacking a DNA binding domain in the output domain. Involved in response to cytokinin and meristem stem cell maintenance. Arr7 protein is stabilized by cytokinin. |
AT3G57040 | response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2 |
AT3G49570 | response to low sulfur 3;(source:Araport11) |
AT4G39090 | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R?mediated resistance response. |
AT2G21620 | Encodes gene that is induced in response to desiccation; mRNA expression is seen 10 and 24 hrs after start of desiccation treatment. |
AT2G33380 | Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to desiccation. mRNA expression under drought conditions is apparent particularly in leaves and flowers. Isoform of caleosin with a role as a peroxygenase involved in oxylipin metabolism during biotic and abiotic stress. Involved in the production of 2-hydroxy-octadecatrienoic acid. The peroxygenase has a narrow substrate specificity thus acting as a fatty acid hydroperoxide reductase in vivo. |
AT5G59820 | Encodes a zinc finger protein involved in high light and cold acclimation. Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway. The mRNA is cell-to-cell mobile. |
AT1G77570 | Winged helix-turn-helix transcription repressor DNA-binding. Expressed in pollen and mutants show enlarged pollen grain nucleoli. |
AT3G27670 | A novel protein, did not show high similarity to any protein of known function; reveals a novel genetic connection between lipid synthesis and embryo development. Expressed in all tissues examined including leaves, flowers, roots, stems, and siliques, but accumulation levels were not correlated with the degree to which different organs appeared affected by the mutation. Mutant plants showed alterations in the cuticular wax profiles and embryo development. The mRNA is cell-to-cell mobile. |
AT2G41945 | Encodes a novel protein found only in plants. RED1 has two isoforms RED1.1 and RED1.2. It is localized to the nucleus. Loss of function mutants are embryo lethal but can be rescued before desiccation by embryo culture. |
AT1G64090 | Reticulan like protein B3;(source:Araport11) |
AT3G08630 | alphavirus core family protein (DUF3411);(source:Araport11) |
AT3G08640 | alphavirus core family protein (DUF3411);(source:Araport11) |
AT3G56140 | DUF399 family protein, putative (DUF399 and DUF3411);(source:Araport11) |
AT2G46170 | Reticulon family protein;(source:Araport11) |
AT3G12280 | Encodes a retinoblastoma homologue RETINOBLASTOMA-RELATED protein (RBR or RBR1). RBR controls nuclear proliferation in the female gametophyte. Also required for correct differentiation of male gametophytic cell types. Regulates stem cell maintenance in Arabidopsis roots. Involved in the determination of cell cycle arrest in G1 phase after sucrose starvation. RBR1 is also involved in regulation of imprinted genes. Together with MSI1 it represses the expression of MET1. This in turn activates expression of the imprinted genes FIS2 and FWA. Functions as a positive regulator of the developmental switch from embryonic heterotrophic growth to autotrophic growth.ChIP studies indicate that one class of targets of RBR1 are transposable elements. |
AT5G17300 | Myb-like transcription factor that regulates hypocotyl growth by regulating free auxin levels in a time-of-day specific manner. |
AT5G37260 | Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. |
AT4G01280 | RVE5 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
AT5G52660 | Encodes RVE6, a homolog of the circadian rhythm regulator RVE8. rve4 rve6 rve8 triple mutants display an extremely long circadian period, with delayed and reduced expression of evening-phased clock genes. |
AT3G09600 | Encodes a MYB-like transcription factor similar to CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) and ELONGATED HYPOCOTYL (LHY). Involved in the regulation of circadian clock by modulating the pattern of histone 3 (H3) acetylation. Functions as a transcriptional activator of evening element containing clock genes. Involved in heat shock response. |
AT2G26670 | Encodes a plastid heme oxygenase necessary for phytochrome chromophore biosynthesis and for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
AT5G50750 | RGP4 is a reversibly glycosylated polypeptide. Analyses using tagged RGP4 suggest that it is present in the cytosol and in association with the Golgi apparatus. Recombinant RGP4 does not have UDP-arabinose mutase activity based on an in vitro assay even though the related RGP1, RGP2, and RGP3 proteins do have activity in the same assay. RGP4 can form complexes with RGP1 and RGP2. RGP4 is expressed during seed development. |
AT5G16510 | RGP5 is a member of the reversably-glycosylated family of proteins. Analyses using tagged RGP5 suggest that it is present in the cytosol and in association with the Golgi apparatus. Recombinant RGP5 does not have UDP-arabinose mutase activity based on an in vitro assay even though the related RGP1, RGP2, and RGP3 proteins do have activity in the same assay. RGP5 can form complexes with RGP1 and RGP2. |
AT5G60690 | REVOLUTA regulates meristem initiation at lateral positions. a member of a small homeodomain-leucine zipper family. Has overlapping functions with PHAVOLUTA and PHABULOSA. The mRNA is cell-to-cell mobile. |
AT5G15740 | RRT1 is a member of a novel glycosyltransferase famly in plants. It functions as a rhamnosyltransferase, elongating the RG-1 backbone. It functions during seed coat mucilage development. |
AT1G19530 | Direct target of RGA, plays an essential role in GA-mediated tapetum and pollen development. |
AT1G66350 | Negative regulator of GA responses, member of GRAS family of transcription factors. Also belongs to the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. RGL1 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Involved in flower and fruit development. |
AT3G03450 | Encodes a DELLA protein, a member of the GRAS superfamily of putative transcription factors. DELLA proteins restrain the cell proliferation and expansion that drives plant growth. Negative regulator of the response to GA in controlling seed germination. GA triggers the degradation of RGL2 protein in a process blocked by both proteasome inhibitors and serine/threonine phosphatase inhibitors. The protein undergoes degradation in response to GA via the 26S proteasome. RGL2 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Regulates GA-promoted seed germination. Involved in flower and fruit development. |
AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
AT1G34110 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT1G56550 | Encodes a rhamnogalacturonan II specific xylosyltransferase. |
AT4G01750 | Encodes a protein with UDP-xylose-dependent xylosyltransferase activity, which transfers Xyl onto L-fucose and (albeit less efficiently) L-arabinose. The linkage to L-fucose was shown to be preferentially to the O-4 position. Analysis of mutant containing T-DNA insertion in this gene indicate that the RGXT2 protein might be involved in the synthesis of the α-D-Xyl-(1,3)-α-L-Fuc-(1,4)-L-Rha structure in pectic rhamnogalacturonan II. The mRNA is cell-to-cell mobile. |
AT1G78570 | Encodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in E. coli. |
AT3G09970 | Encodes a cytosolic tyrosine phosphatase. |
AT1G12750 | RHOMBOID-like protein 6;(source:Araport11) |
AT4G21470 | Bifunctional enzyme that catalyzes hydrolysis of FMN to riboflavin, and phosphorylation of riboflavin to FMN. The mRNA is cell-to-cell mobile. |
AT1G17160 | RBSK is a plastid localized ribokinase involved in nucleoside metabolism. It is the only member of this gene family in Arabidopsis. |
AT2G02990 | Encodes a member of the ribonuclease T2 family that responds to inorganic phosphate starvation, and inhibits production of anthocyanin. Also involved in wound-induced signaling independent of jasmonic acid. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. |
AT2G39780 | Encodes the main endoribonuclease activity in plant cells and localizes to the endoplasmic reticulum (ER), ER-derived structures, and vacuoles. It is essential for normal ribosomal RNA recycling. The mRNA is cell-to-cell mobile. |
AT5G02870 | Ribosomal protein L4/L1 family;(source:Araport11) |
AT5G15980 | Ribosomal pentatricopeptide repeat protein |
AT1G26910 | Ribosomal protein L16p/L10e family protein;(source:Araport11) |
AT3G27830 | 50S ribosomal protein L12-A The mRNA is cell-to-cell mobile. |
AT3G27840 | 50S ribosomal protein L12-B |
AT3G27850 | 50S ribosomal protein L12-C The mRNA is cell-to-cell mobile. |
AT2G39460 | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it. |
AT2G42740 | encodes a cytosolic ribosomal protein L16, which is a constituent of 60S large ribosomal complex. Gene is expressed in root stele and anthers and expression is induced by auxin treatment. |
AT5G40950 | ribosomal protein large subunit 27;(source:Araport11) |
AT3G22300 | Nuclear-encoded gene for mitochondrial ribosomal small subunit protein S10 |
AT3G46040 | Regulated by TCP20. The mRNA is cell-to-cell mobile. |
AT3G49080 | Mitochondrial ribosomal protein, similar to RPS9 from E.coli. Loss of function results in gametophyte lethality, particularly the megagametophyte. |
AT3G07750 | 3-5-exoribonuclease family protein;(source:Araport11) |
AT3G63190 | The gene encodes a chloroplast ribosome recycling factor homologue. Analysis of mutants revealed its role in the chloroplast development and eary stages of embryo development. |
AT5G44280 | Encodes a nuclear localized protein with similarity to animal polycomb repressive core complex1 (PRC1) core component RING.Appears to function redundantly with ATRING1b, a close paralog. Both interact physically with CLF and LHP1 and appear to function together to repress class I KNOX gene expression. |
AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
AT5G59550 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
AT5G63970 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
AT1G79380 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
AT3G01650 | Encodes RGLG1 (RING domain ligase 1), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. ABA inhibits myristoylation and induces shuttling of the RGLG1 to promote nuclear degradation of PP2CA. |
AT5G14420 | Encodes RGLG2 (RING domain ligase 2), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. |
AT4G03510 | RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. Has E3 ubiquitin ligase activity. |
AT4G28270 | Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro. |
AT4G27470 | Encodes a RING finger E3 ubiquitin ligase. |
AT5G22920 | Encodes a protein with sequence similarity to RING, zinc finger proteins. Loss of function mutations show reduced (15%) stomatal aperture under non stress conditions. |
AT2G01735 | encodes a RING-H2 zinc finger protein essential for seed development. |
AT4G11360 | Encodes a putative RING-H2 finger protein RHA1b. The mRNA is cell-to-cell mobile. |
AT2G17450 | Encodes a putative RING-H2 finger protein RHA3a. |
AT4G35480 | Encodes a putative RING-H2 finger protein RHA3b. |
AT4G00335 | RING-H2 finger B1A;(source:Araport11) |
AT2G40830 | Encodes an E3 ubiquitin ligase for the GA-receptor GID1 that functions as a negative regulator of GA signaling in seedlings and seeds by inducing ubiquitin-dependent proteolysis of GID1s. Tyr321 phosphorylation of GARU by TAGK2 inactivates GARU. |
AT2G39720 | Encodes a putative RING-H2 finger protein RHC2a. |
AT2G01150 | Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils. |
AT5G22000 | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses. |
AT5G44180 | Interacts with CHR11, CHR17, and ARID5, several known subunits of ISWI. JA biosynthesisis is positively regulated by this chromatin remodeling complex, thereby promoting stamen filament elongation. |
AT3G11770 | RICE1 is a 23kDa protein with 3?- 5? exoribonuclease activity. It is expressed ubiquitously and localized to the cytoplasm. When RICE1 and its paralog RICE2 are knocked down, miRNA levels are decreased. RICE1 interacts with AGO1 and AGO10. It may affect miRNA accumulation by clearing RISC by degrading 5? products of AGO cleavage. |
AT5G06450 | RICE2 is cytoplasmically localized and has 3?- 5? exoribonuclease activity. When RICE2 and its paralog RICE1 are knocked down, miRNA levels are decreased. RICE1 interacts with AGO1 and AGO10. It may affect miRNA accumulation by clearing RISC by degrading 5? products of AGO cleavage |
AT1G80670 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
AT1G55150 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT5G63120 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G09720 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G45810 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT3G54490 | NRPE5-like protein of unknown function; homologous to budding yeast RPB5 |
AT4G35800 | Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit. |
AT1G12700 | Encodes RNA PROCESSING FACTOR 1 (RPF1), a pentatricopeptide repeat (PPR) protein of the P-class containing canonical PPR-repeats. RPF1 is required for the 5?-end processing of the nad4 mRNA in mitochondria. Ler and other accessions impaired in processing of the nad4 mRNA 5′-end, contain a single nucleotide polymorphism (SNP) 807 nucleotides downstream of the predicted translation start codon (G807A). The resulting premature translation termination codon abolishes the function of the RPF1 gene in Ler. Required for the formation of nad4L-atp4 transcripts with -318 5′ termini. |
AT1G63130 | Transacting siRNA generating locus. Its derived siR9as targets AT1G62930 for cleavage. Itself is targeted by TAS2-derived ta-siR2140 for cleavage. |
AT3G23830 | encodes a glycine-rich RNA binding protein. Gene expression is induced by cold and reduced by ionic (salt) and non-ionic (mannitol) osmotic stress. Lines overexpressing the gene are slightly more tolerant to osmotic stress during germination. |
AT4G39260 | Encodes a glycine-rich protein with RNA binding domain at the N-terminus. Protein is structurally similar to proteins induced by stress in other plants. Gene expression is induced by cold. Transcript undergoes circadian oscillations that is depressed by overexpression of AtGRP7. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
AT5G61030 | Encodes a glycine-rich RNA binding protein that is involved in C-> U RNA editing in mitochondria. Gene expression is induced by cold. The mRNA is cell-to-cell mobile. |
AT3G26420 | Zinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance. Members of this protein family include AT3G26420 (ATRZ-1A), AT1G60650 (AtRZ-1b) and AT5G04280 (AtRZ-1c). |
AT3G13224 | Belongs to a member of the RNA-binding glycine-rich (RBG) gene superfamily. |
AT1G58470 | Encodes an mRNA-binding protein that contains two RNA recognition motifs (RRMs) and is expressed in proliferating tissues. Preferentially binds UUAGG, GUAGG and/or UUAGU. Loss of function of RBP1 causes decreased root length. |
AT1G60200 | RBM25 is an alternative splicing factor involved in mediation of abiotic stress response and ABA response. Its expression is modulated by a variety of stressors and it in turn appears to affect the ratio of splice variants of stress responsive genes such as HAB1.2/HAB1.1. |
AT1G47490 | RNA-binding protein 47C;(source:Araport11) |
AT4G03110 | Encodes a putative RNA-binding protein that is located in the cytoplasm and is involved in the hypersensitive response and positively regulates salicylic acid-mediated immunity. |
AT1G80650 | RNAse THREE-like protein 1;(source:Araport11) |
AT1G30510 | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
AT3G51460 | Encodes RHD4 (ROOT HAIR DEFECTIVE4), a phosphatidylinositol-4-phosphate phosphatase required for root hair development. The mRNA is cell-to-cell mobile. |
AT1G27740 | Basic helix-loop-helix (bHLH) transcription factor that is sufficient to promote postmitotic cell growth in root-hair cells. RSL4 is a direct transcriptional target of RHD6 |
AT1G66470 | ROOT HAIR DEFECTIVE6;(source:Araport11) |
AT1G12950 | root hair specific 2;(source:Araport11) |
AT1G63450 | Encodes a xyloglucan-specific galacturonosyltransferase (XUT1) that forms the beta-d-galactosyluronic acid-(1->2)-alpha-d-xylosyl linkage. |
AT5G02820 | Involved in the patterning and shape of leaf trichomes. Encodes the DNA topoisomerase VI SPO11-3, involved in endoreduplication |
AT4G16515 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT5G64770 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT4G33495 | A member of the RPD gene family - there are13 annotated genes and one EST encoding RPD1-like proteins in Arabidopsis. Shows no homology to any protein of known function. Abundant expression found in the shoot apex and the root. rpd1 mutant is a temperature-sensitive mutant isolated on the basis of the impairment in adventitious roots formation in hypocotyl region. Also, disruption of the RPD1 gene by a T-DNA insertion caused embryogenesis arrest at the globular to transition stages. This phenotype is consistent with the hypothesized function of RPD1 in the maintenance of active cell proliferation. |
AT4G38430 | Member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity. ropgef1 mutants have defects in auxin transport that result in abnormal development of embryos and growth defects. |
AT5G19560 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT3G55660 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT5G02010 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Required for periodic formation of secondary cell wall pits. |
AT3G24620 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT2G46710 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
AT3G53350 | Encodes RIP3 (ROP interactive partner 3), a microtubule-binding protein that is anchored to the plasma membrane domains and promotes local microtubule disassembly, forming as specific pattern of secondary walls in xylem vessel cells. Localized at microtubules and interacts with the plant-specific kinesin AtKinesin-13A. |
AT1G27380 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Protein most similar to RIC4 (family subgroup V). Gene is expressed in all tissues examined. |
AT1G63240 | Methyl-DNA binding protein which interacts with RMB1 and ROS1 acting in the base excision repair pathway through DNA methylation. |
AT4G38740 | Encodes cytosolic cyclophilin ROC1. |
AT2G16600 | Encodes cytosolic cyclophilin ROC3. The mRNA is cell-to-cell mobile. |
AT5G58710 | Encodes cyclophilin ROC7. The mRNA is cell-to-cell mobile. |
AT4G36380 | Encodes a cytochrome P-450 gene that is involved in leaf blade expansion by controlling polar cell expansion in the leaf length direction. Member of the CYP90C CYP450 family. ROT3 was shown to be involved in brassinosteroid biosynthesis, most likely in the conversion step of typhasterol (TY) to castasterone (CS). As 6-deoxo-CS was unable to restore the phenotype of rot3-1, it has been postulated that ROT3 might be specifically involved in the conversion of TY to CS in the C6-oxidation pathway of brassinolide. Recently, CYP90C1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). |
AT3G25717 | ROTUNDIFOLIA like 16;(source:Araport11) |
AT5G16023 | Encodes a plant peptide that could be involved in the coordination of socket cell development in wild-type plants. |
AT1G67265 | ROTUNDIFOLIA like 21;(source:Araport11) |
AT1G64585 | ROTUNDIFOLIA like 22;(source:Araport11) |
AT5G59510 | ROTUNDIFOLIA like 5;(source:Araport11) |
AT4G35783 | ROTUNDIFOLIA like 6;(source:Araport11) |
AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
AT3G25070 | Encodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation. Major virulence target of the TTSE HopF2Pto. The mRNA is cell-to-cell mobile. |
AT2G05940 | Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor RPM1. |
AT1G12210 | RFL1 has high sequence similarity to the adjacent disease resistance (R) gene RPS5. |
AT4G27490 | 3-5-exoribonuclease family protein;(source:Araport11) |
AT2G32415 | Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain-containing protein;(source:Araport11) |
AT5G38420 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Activated by OXS2 under the treatment of salt. |
AT5G38410 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
AT5G18700 | Encodes a microtubule-associated kinase-like protein RUNKEL (RUK). Contains a putative serine/threonine kinase domain and a microtubule-binding domain. RUK directly binds to microtubules in vitro and colocalizes with mitotic preprophase band, spindle, and phragmoplast in vivo. Required for cell plate expansion in cytokinesis. |
AT5G66990 | RWP-RK domain-containing protein;(source:Araport11) |
AT4G35590 | RWP-RK domain-containing protein;(source:Araport11) |
AT3G02470 | Encodes a S-adenosylmethionine decarboxylase involved in polyamine biosynthesis. |
AT5G15950 | Adenosylmethionine decarboxylase family protein;(source:Araport11) |
AT1G02500 | encodes a S-adenosylmethionine synthetase. SAM1 is regulated by protein S-nitrosylation. The covalent binding of nitric oxide (NO) to the Cys114 residue inhibits the enzyme activity. |
AT1G61380 | Encodes a membrane localized S-domain receptor kinase that is involved in lipopolysaccharide (LPS) sensing. SD1-29 detected LPS of Pseudomonas and Xanthomonas species for which it serves as a microbe associated molecular pattern triggering innate immunity. Loses of function mutants are hyper susceptible to P.syringae. |
AT4G32300 | S-domain-2 5;(source:Araport11) |
AT2G41530 | Encodes a protein with S-formylglutathione hydrolase activity. |
AT3G23700 | Encodes a chloroplast-localized S1 domain-containing protein with RNA chaperone activity that affects the splicing and processing of chloroplast transcripts and plays a role in seedling growth in the presence of ABA. Binds the chloroplast psbA RNA and some other chloroplast RNAs. Required for the stability of the chloroplast ndhC RNA. Inhibits ribosome association with psbA RNA and ycf1 RNA. Not required for the splicing of chloroplast trnL, as had been reported previously. |
AT5G03350 | Belongs to the group of early SA-activated genes. Involved in resistance to Pst Avr-Rpm1 as a component of the SA35 mediated defense processes associated to the ETI response. Involved in resistance to P.syringae pv. tomato Avr-Rpm1 in Arabidopsis, as a component of the SA-mediated defense processes associated with the effector-triggered immunity response. |
AT5G04990 | Encodes a member of the Sad1/UNC-84 (SUN)-domain proteins: AtSUN1(At5g04990), AtSUN2(AT3G10730). SUN domain proteins are part of the cytoskeletal-nucleoskeletal bridging complexes. AtSUN1 and AtSUN2 are localized to the nuclear envelope and are present as homomers and heteromers in vivo.Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with WPP domain interacting-proteins (WIPs). It is involved in maintaining the elongated nuclear shape of epidermal cells. |
AT1G35112 | Member of Sadhu non-coding retrotransposon family |
AT5G14260 | Suppresses singlet oxygen-induced stress responses by protecting grana margins. |
AT5G22450 | SAGA complex subunit. Regulates gene expression by affecting histone H3 acetylation. |
AT5G02020 | Encodes a protein involved in salt tolerance, names SIS (Salt Induced Serine rich). |
AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
AT5G24270 | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium. |
AT5G37850 | Encodes a pyridoxal kinase required for root hair development. Mutants are hypersensitive to Na+, K+ and Li+. |
AT3G46550 | Isolated in a screen for salt hypersensitive mutants. Mutants have thinner cell walls, abnormal siliques and root growth is inhibited under salt stress. The gene has similarity to arabinogalactan proteins and domains associated with cell adhesion.SOS5 is required for normal mucilage adherence to seeds. |
AT1G06040 | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT. |
AT3G07700 | ABC1K7 is a member of an atypical protein kinase family that is induced by salt stress. Loss of function mutations affect the metabolic profile of chloroplast lipids. It appears to function along with ABC1K8 in mediating lipid membrane changes in response to stress. |
AT5G22270 | hypothetical protein;(source:Araport11) |
AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
AT1G27760 | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
AT2G31870 | The gene encodes a poly(ADPribose) glycohydrolase (PARG1). Mutant analysis suggests that PARG1 plays a role in abiotic stress responses and DNA repair. Loss of function mutants accumulate poly(ADPribose) and have increased cell death when treated with bleomycin. |
AT1G75060 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
AT5G52810 | SAR-DEFICIENT4 (SARD4) alias ORNITHINE CYCLODEAMINASE/m-CRYSTALLIN (ORNCD1) is involved in the biosynthesis of pipecolic acid. The reductase converts dehydropipecolic acid intermediates generated from L-Lysine by AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) to pipecolic acid (PMID:28330936). |
AT3G54220 | Encodes a member of a novel family having similarity to DNA binding proteins containing basic-leucine zipper regions; scr is expressed in cortex/endodermal initial cells and in the endodermal cell lineage. Regulates the radial organization of the root. Is required cell-autonomously for distal specification of the quiescent center, which in turn regulates stem cell fate of immediately surrounding cells. SCR appears to be a direct target of SHR. SCR and SCR-LIKE 23 act redundantly in bundle sheath cell fate specification. |
AT1G21450 | Encodes a scarecrow-like protein (SCL1). Member of GRAS gene family. The mRNA is cell-to-cell mobile. |
AT4G17230 | Encodes a scarecrow-like protein (SCL13). Member of GRAS gene family. Regulated by heat shock. |
AT1G07530 | Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm. |
AT5G41920 | Encodes a GRAS family transcription factor that is involved in bundle sheath cell fate specification. |
AT1G50420 | Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
AT5G52510 | SCARECROW-like 8;(source:Araport11) |
AT5G13300 | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin. |
AT3G54990 | Encodes a AP2 domain transcription factor that can repress flowering. SMZ and its paralogous gene, SNARCHZAPFEN (SNZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
AT2G39250 | Encodes a AP2 domain transcription factor that can repress flowering. SNZ and its paralogous gene, SCHLAFMUTZE (SMZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
AT5G46410 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). The mRNA is cell-to-cell mobile. |
AT4G18140 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). |
AT5G11860 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). |
AT2G25685 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT1G14182 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT2G01470 | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER. |
AT3G04240 | Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570). |
AT1G03220 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G20840 | Secretory carrier membrane protein (SCAMP) family protein;(source:Araport11) |
AT1G32050 | SCAMP family protein;(source:Araport11) |
AT3G55800 | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type. The mRNA is cell-to-cell mobile. |
AT5G07190 | Gene is expressed preferentially in the embryo and encodes a unique protein of unknown function. |
AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
AT5G54740 | seed storage albumin 5;(source:Araport11) |
AT4G18520 | Encodes a PPR (pentatricopeptide repeat) protein PDM1/SEL1. Involved in RNA editing and splicing of plastid genes. |
AT3G10420 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G16460 | Membrane protein involved in lipid droplet biogenesis primarily in embryos. |
AT1G29760 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction motif on SEIPIN2 for VAP27-1 is restricted to the N-terminal 30 amino acids that contain an FFAT motif. |
AT4G14030 | selenium-binding protein 1;(source:Araport11) |
AT4G14040 | selenium-binding protein 2;(source:Araport11) |
AT4G35770 | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
AT3G10985 | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. The mRNA is cell-to-cell mobile. |
AT1G66580 | senescence associated gene 24;(source:Araport11) |
AT1G20780 | Encodes a protein containing a U-box and an ARM domain. Homozygous mutant seedlings have a seedling lethal phenotype with widespread cell death lesions throughout the cotyledons and roots. |
AT5G45890 | Senescence-associated gene 12 (SAG12) encoding a cysteine protease influenced by cytokinin, auxin, and sugars.Localized to special vacuole found during senescence called senescence associated vacuoles which are different from central vacuole in the tonoplast composition and pH. |
AT4G02380 | Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses. |
AT4G30520 | Encodes SARK (SENESCENCE-ASSOCIATED RECEPTOR-LIKE KINASE). Regulates leaf senescence through synergistic actions of auxin and ethylene. It is one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis. |
AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
AT3G02040 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. Has glycerophosphodiester phosphodiesterase activity. Functions in maintaining cellular phosphate homeostasis under phosphate starvation. The mRNA is cell-to-cell mobile. |
AT3G06510 | Encodes a protein with beta-glucosidase and galactosyltransferase activity, mutants show increased sensitivity to freezing. Though it is classified as a family I glycosyl hydrolase, it has no hydrolase activity in vitro. |
AT4G04920 | Encodes a nuclear targeted protein that plays a role in the CBF pathway -downstream of CBF translation. Mutants have impaired cold responses, reduced levels of cold induced RNA transcripts, are sensitive to osmotic stress. Required for expression of CBF-controlled cold-upregulated genes and some, but not all, other cold up-regulated genes. Required for recruitment of the Mediator complex and RNA polymerase II to CBF-controlled cold-responsive genes. Required for expression of some dark-upregulated genes. SFR6 was isolated as a suppressor of cell wall defects in cob6 mutant background. |
AT5G43940 | Encodes a glutathione-dependent formaldehyde dehydrogenase (also known as class III type alcohol dehydrogenase) reduces S-nitrosoglutathione (GSNO), the condensation product of glutathione and NO, that is a naturally occurring NO reservoir and also a reactive nitrogen intermediate. Gene expression is reduced by wounding and induced by salicylic acid. Is required for the acclimation of plants to high temperature and for fertility. |
AT3G26680 | involved in a SNM-dependent recombinational repair process of oxidatively induced DNA damage. |
AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. The mRNA is cell-to-cell mobile. |
AT5G22890 | An unique homologue of STOP1 (AT1G34370) in Arabidopsis genome. Transformation to the stop1-mutant activated several genes that are regulated by STOP1, and conferred proton sensitive phenotype. |
AT4G29520 | SES1 is an ER localized chaperone involved in salt and heat stress response. |
AT5G59560 | Encodes a novel protein conserved in higher eukaryotes. Normal function of the protein is required for normal oscillator function during circadian rhythm. Mutant analyses also suggest a role in phytochrome B (phyB)-mediated light signaling. |
AT1G24260 | Member of the MADs box transcription factor family. SEP3 is redundant with SEP1 and 2. Flowers of SEP1/2/3 triple mutants show a conversion of petals and stamens to sepals.SEP3 forms heterotetrameric complexes with other MADS box family members and binds to the CArG box motif. |
AT1G55920 | Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. The mRNA is cell-to-cell mobile. |
AT2G22970 | serine carboxypeptidase-like 11;(source:Araport11) |
AT2G22980 | serine carboxypeptidase-like 13;(source:Araport11) |
AT5G09640 | encodes a serine carboxypeptidase-like (SCPL) protein. Mutants accumulate sinapoylglucose instead of sinapoylcholine, and have increased levels of choline and decreased activity of the enzyme sinapoylglucose:choline sinapoyltransferase. |
AT4G12910 | serine carboxypeptidase-like 20;(source:Araport11) |
AT3G07990 | serine carboxypeptidase-like 27;(source:Araport11) |
AT4G30810 | serine carboxypeptidase-like 29;(source:Araport11) |
AT3G17180 | serine carboxypeptidase-like 33;(source:Araport11) |
AT5G23210 | serine carboxypeptidase-like 34;(source:Araport11) |
AT3G10410 | SERINE CARBOXYPEPTIDASE-LIKE 49;(source:Araport11) |
AT1G15000 | serine carboxypeptidase-like 50;(source:Araport11) |
AT2G27920 | serine carboxypeptidase-like 51;(source:Araport11) |
AT1G73270 | serine carboxypeptidase-like 6;(source:Araport11) |
AT3G10450 | serine carboxypeptidase-like 7;(source:Araport11) |
AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. The mRNA is cell-to-cell mobile. |
AT4G37930 | Encodes a protein with mitochondrial serine hydroxymethyltransferase activity, which functions in the photorespiratory pathway, catalyzes the conversion of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. Involved in controlling cell damage caused by abiotic stress, such as high light and salt and the hypersensitive defense response of plants. |
AT1G09140 | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed. AT1G09140.1 predominantly accumulates in the cytosol in light grown plants.Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT1G02840 | SR34/SR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT4G02430 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT5G01820 | Encodes a CBL-interacting serine/threonine protein kinase. |
AT3G08720 | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
AT3G26030 | protein phosphatase 2A regulatory subunit isoform B' delta The mRNA is cell-to-cell mobile. |
AT4G35780 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
AT4G38470 | Serine/threonine kinase that phosphorylate transit peptides of chloroplast and mitochondria targeted pre-proteins. |
AT2G24360 | STYK serine threonine kinase that phosphorylates several oil body proteins including OLE1 and CLO4/CAL4. |
AT1G64030 | serpin 3;(source:Araport11) |
AT2G27100 | Identified as a leaf form mutant by Redei having serrated leaves. Further analysis of the single loss of function allele indicated pleiotropic effects extending to many aspects of shoot development such as taller meristems, alterations in phase transition, phyllotaxy and branching. Encodes a single zinc finger containing protein that is expressed in meristems and organ primordia and forms a complex with both AtCBC (cap binding complex) proteins to control alternative splicing. |
AT4G30860 | Encodes a member of the trxG protein family. Contains a SET domain which is known to be involved in modification of histone tails by methylation. Interacts physically with AMS, but the implications of this interaction are unknown.Overexpression results in plieotrophic developmental defects. |
AT4G18060 | SH3 domain-containing protein;(source:Araport11) |
AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
AT1G57870 | shaggy-like kinase 42;(source:Araport11) |
AT4G00720 | Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase. Functions in the brassinosteroid signalling pathway. |
AT2G30980 | Encodes a GSK3-like protein kinase. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts. |
AT2G42830 | AGAMOUS [AG]-like MADS box protein (AGL5) involved in fruit development (valve margin and dehiscence zone differentiation). A putative direct target of AG. SHP2 has been shown to be a downstream gene of the complex formed by AG and SEP proteins (SEP4 alone does not form a functional complex with AG). |
AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
AT1G07010 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT3G54430 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
AT3G26900 | Encodes a protein with some sequence similarity to shikimate kinases, but a truncated form of this protein (lacking a putative N-terminal chloroplast transit peptide) does not have shikimate kinase activity in vitro. skl1-3 mutants have a variegated phenotype and skl1-8 mutants have an albino phenotype consistent with the observation of chloroplast defects in these mutants. |
AT1G15360 | Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. This gene is involved in wax biosynthesis. Over-expression of the gene results in glossy leaf phenotype and increased drought tolerance. Two closely related genes, AT5G25390 and AT5G11190 have similar phenotypes when over-expressed. Strong expression levels in flowers. Binds to the promoter of LACS2. |
AT1G31480 | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole. |
AT2G01940 | Encodes a transcription factor that, together with IDD14 and IDD16, regulates auxin biosynthesis and transport and thus aerial organ morphogenesis and gravitropic responses. May be involved in an early event in shoot gravitropism such as gravity perception and/or a signaling process subsequent to amyloplast sedimentation as a putative transcription factor in gravity-perceptive cells. |
AT2G36810 | Specifically involved in gravity perception and/or gravity signal transduction for the shoot gravitropic response. Effects gravitropism only in inflorescence stems but normal in both hypocotyls and roots. |
AT5G39510 | Encodes a member of SNARE gene family. Homologous with yeast VTI1 and is involved in vesicle transport. Mutant alleles such as sgr4/zig are defective in the shoots response to gravity resulting in a zigzag growth pattern of the stem. Involved in protein trafficking to lytic vacuoles. Can conditionally substitute VTI12 in protein storage vacuole trafficking when plants are devoid of VTI12. The mRNA is cell-to-cell mobile. |
AT1G04240 | SHY2/IAA3 regulates multiple auxin responses in roots. It is induced rapidly by IAA, and has been shown to be phosphorylated by oat phytochrome A in vitro. |
AT1G69935 | Encodes a nuclear localized serine-arginine-aspartate-rich protein that acts as a negative regulator of photomorphogenesis. |
AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
AT4G39100 | Encodes a plant-specific histone reader capable of recognizing both H3K27me3 and H3K4me3 via its bromo-adjacent homology (BAH) and plant homeodomain (PHD) domains, respectively. Detailed biochemical and structural studies suggest a binding mechanism that is mutually exclusive for either H3K4me3 or H3K27me3. SHL plays a role in the repression of flowering. |
AT1G10682 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT3G06125 | Unknown gene The mRNA is cell-to-cell mobile. |
AT3G26612 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT5G24735 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT4G20362 | Natural antisense transcript overlaps with AT4G20360. Has been identified as a translated small open reading frame by ribosome profiling. |
AT4G37650 | Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains. SHORT-ROOT forms a network in combination with JACKDAW, BLUEJAY AND SCARECROW to regulate tissue patterning through asymmetric cell division. The ground tissue lineage remains in shortroot mutant, while it is progressively lost in the triple mutant bluejay jackdaw scarecrow and double mutant jackdaw scarecrow. In addition, ground tissue basal identity remains in shortroot mutant while it is defective in the quadruple mutant bluejay jackdaw magpie nutcracker. |
AT2G22540 | Encodes a nuclear protein that acts as a floral repressor and that functions within the thermosensory pathway. SVP represses FT expression via direct binding to the vCArG III motif in the FT promoter. |
AT3G29250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G47140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G12800 | short-chain dehydrogenase-reductase B;(source:Araport11) |
AT2G47130 | Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria. |
AT3G55290 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G03060 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G16930 | AAA-type ATPase family protein;(source:Araport11) |
AT3G10440 | Encodes a protein that protects meiotic centromere cohesion. |
AT5G04320 | Encodes a protein that protects meiotic centromere cohesion. |
AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
AT1G08180 | cyclin-dependent kinase inhibitor;(source:Araport11) |
AT5G02220 | cyclin-dependent kinase inhibitor;(source:Araport11) |
AT4G24500 | Encodes a proline-rich protein SICKLE (SIC). Required for development and abiotic stress tolerance. Involved in microRNA biogenesis. It is involved in mRNA splicing. It is a single copy gene in Arabidopsis and likely specific to higher plants. Along with RCN1, it functions in regulating auxin transport processes in part by regulating the recycling of PIN1 and PIN2 auxin transporters. It is required for circadian clock temperature responses. |
AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
AT1G64860 | Subunit of chloroplast RNA polymerase, confers the ability to recognize promoter sequences on the core enzyme |
AT3G56710 | Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts. |
AT2G41180 | VQ motif-containing protein;(source:Araport11) |
AT2G03120 | homologous to Signal Peptide Peptidases (SPP), required for pollen development and pollen germination. No homozygotes could be recovered from a T-DNA insertion mutant. The mRNA is cell-to-cell mobile. |
AT1G73990 | Encodes a putative protease SppA (SppA). |
AT4G33410 | SIGNAL PEPTIDE PEPTIDASE-LIKE 1;(source:Araport11) |
AT1G63690 | SIGNAL PEPTIDE PEPTIDASE-LIKE 2;(source:Araport11) |
AT1G01650 | SIGNAL PEPTIDE PEPTIDASE-LIKE 4;(source:Araport11) |
AT1G15310 | 54 kDa protein subunit of SRP that interacts with the signal peptide of secreted proteins |
AT3G15390 | Encodes a novel protein that is similar to PRL1 interacting factor and is involved in virus induced silencing. |
AT1G44800 | Encodes Siliques Are Red 1 (SIAR1). Functions as a bidirectional amino acid transporter that is crucial for the amino acid homeostasis of siliques. Member of nodulin MtN21-like transporter family. |
AT3G47720 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
AT5G62520 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
AT5G15020 | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). |
AT5G37890 | Encodes an E3 protein ligase (based on a self-ubiquitination in vitro assay). |
AT2G22990 | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
AT5G45360 | Encodes a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
AT1G10230 | Involved in protein degradation. One target is PHR1. |
AT2G45950 | SKP1-like 20;(source:Araport11) |
AT3G54480 | Encodes an SKP1 interacting partner (SKIP5). |
AT4G28090 | SKU5 similar 10;(source:Araport11) |
AT4G37160 | SKU5 similar 15;(source:Araport11) |
AT1G75790 | SKU5 similar 18;(source:Araport11) |
AT4G22010 | SKU5 similar 4;(source:Araport11) |
AT1G76160 | SKU5 similar 5;(source:Araport11) |
AT4G27970 | Encodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane. |
AT5G24030 | Encodes a protein with ten predicted transmembrane helices. The SLAH3 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. Although it is not expressed in guard cells, it can complement an slac1-2 mutant suggesting that it performs a similar function. SLAH3:GFP localizes to the plasma membrane. |
AT4G24210 | F-box protein that is involved in GA signaling. Regulates seed germination. Component of E3 ubiquitin complex. Interacts with DELLA proteins. |
AT2G22410 | SLOW GROWTH 1;(source:Araport11) |
AT3G14080 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT2G43810 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT3G04090 | Belongs to a family of plant aquaporins. Similar to yeast and radish aquaporins. Located on ER. |
AT1G55270 | SAGL1 is a member of a small family of KELCH domain containing proteins. Loss of function mutants show increased lignin and anthocyanin production suggesting a role in regulation of phenylpropanoid biosynthesis. |
AT4G38850 | mRNA is rapidly induced by auxin and is very short-lived. Has been used as a reporter gene in studying auxin mutants. |
AT2G45210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G79130 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G16510 | Encodes a clade III SAUR gene with a distinctive expression pattern in root meristems. It is normally expressed in the quiescent center and cortex/endodermis initials and upon auxin stimulation, the expression is found in the endodermal layer. Overexpression studies suggest roles in cell expansion and auxin transport. |
AT3G12830 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G38840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G38860 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34790 | Putative OXS2-binding DEGs were constitutively activated by OXS2. |
AT3G61900 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G22620 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G12410 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34800 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G03310 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT2G36210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34750 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G75580 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G60690 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G10990 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G17345 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G72430 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT2G35290 | hypothetical protein;(source:Araport11) |
AT4G36110 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G15258 | Encodes a C/D box snoRNA (snoR37-2). Gb: AJ505638 |
AT5G05540 | small RNA degrading nuclease 2;(source:Araport11) |
AT5G06210 | Encodes a chloroplast protein involved in the responses to salt and oxidative stresses. |
AT2G30942 | Encodes a 56-amino acid polypeptide with low but significant similarity to human small subunit of serine palmitoyltransferase that localizes to the ER and physically interacts with and greatly stimulates the activity of LCB1/LCB2 heterodimer ser palmitoyltransferase complex. |
AT4G34620 | Encodes ribosomal protein S16, has embryo-defective lethal mutant phenotype |
AT4G26840 | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. |
AT2G32765 | Encodes a small ubiquitin-like modifier (SUMO) protein that becomes covalently attached to various intracellular protein targets through an isopeptide bond. SUMOylation typically has a post-translational effect on the behavior of the target protein. |
AT1G56580 | Encodes SMALLER WITH VARIABLE BRANCHES (SVB), a protein with a conserved domain of unknown function (DUF538). The trichomes of the SVB mutants are smaller and exhibit branches of variable length and number. ABA responsive trichome formation regulator. |
AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
AT3G52490 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
AT1G07200 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
AT2G29970 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. The mRNA is cell-to-cell mobile. |
AT2G42030 | Encodes a RING domain E3 ligase. Has overlapping function with MUSE1 in the negative regulation of defence responses. SIKIC2 (and possibly SIKIC1 and 3) is ubiquination target. |
AT3G01090 | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase |
AT1G78290 | encodes a member of SNF1-related protein kinase (SnRK2) family whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress and dehydration. |
AT5G08590 | Encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Similar to the calcium/calmodulin-dependent protein kinase subfamily and the SNF1 kinase subfamily. |
AT1G60940 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
AT5G63650 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
AT3G19570 | Encodes SCO3 (snowy cotyledon3), a member of a largely uncharacterized protein family unique to the plant kingdom. The sco3-1 mutation alters chloroplast morphology and development, reduces chlorophyll accumulation, impairs thylakoid formation and photosynthesis in seedlings, and results in photoinhibition under extreme CO(2) concentrations in mature leaves. SCO3 is targeted to the periphery of peroxisomes. Together with QWRF2 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
AT5G60750 | Encodes a chloroplast endoproteinase, SNOWY COTYLEDON4 (SCO4), required for photosynthetic acclimation to higher light intensities. |
AT1G77180 | Encodes a putative transcriptional factor. Shows transcriptional activator activity in yeast. Involved in response to abscisic acid, salt and osmotic stress. SKIP lengthens period of the circadian clock by impairing the alternative splicing of PRR7 and PRR9. SKIP regulates the splicing of SEF pre-mRNA and suppresses flowering by activation of FLC. |
AT3G05030 | Encodes a vacuolar K+/H+ exchanger essential for active K+ uptake at the tonoplast and involved in regulating stomatal closure. |
AT3G06370 | member of Sodium proton exchanger family |
AT4G32400 | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
AT3G53530 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
AT2G37570 | encodes a protein that can complement the salt-sensitive phenotype of a calcineurin (CaN)-deficient yeast mutant. This gene occurs in a single-copy and is 75% identical to tobacco SLT1 gene. |
AT1G71830 | Plasma membrane LRR receptor-like serine threonine kinase expressed during embryogenesis in locules until stage 6 anthers, with higher expression in the tapetal cell layer. SERK1 and SERK2 receptor kinases function redundantly as an important control point for sporophytic development controlling male gametophyte production. SERK1 interacts with and transphosphorylates EMS1 |
AT1G34210 | Plasma membrane LRR receptor-like serine threonine kinase expressed during embryogenesis in locules until stage 6 anthers, with higher expression in the tapetal cell layer. SERK1 and SERK2 receptor kinases function redundantly as an important control point for sporophytic development controlling male gametophyte production. The mRNA is cell-to-cell mobile. |
AT2G13790 | somatic embryogenesis receptor-like kinase 4;(source:Araport11) |
AT1G03790 | Encodes SOMNUS (SOM), a nucleus-localized CCCH-type zinc finger protein. SOM negatively regulates light-dependent seed germination downstream of PIL5 (AT2G20180). |
AT5G58440 | sorting nexin 2A;(source:Araport11) |
AT5G58380 | Encodes a CBL-interacting protein kinase with similarity to SOS protein kinase. |
AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile. |
AT2G30360 | Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. |
AT2G28150 | DUF966 domain containing protein, expressed during embryogenesis. |
AT3G10130 | Cholorplast plastoglobule localized heme binding protein. |
AT1G09070 | SRC2 specifically binds the peptide PIEPPPHH, and moves from ER to a vacuole fraction where it gets internalized. Involved in Protein Storage Vacuole targeting. The mRNA is cell-to-cell mobile. |
AT3G15354 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA3 (and SPA4) predominantly regulates elongation growth in adult plants. |
AT1G53090 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA4 (and SPA3) predominantly regulates elongation growth in adult plants. |
AT4G36930 | Encodes a transcription factor of the bHLH protein family. Mutants have abnormal, unfused carpels and reduced seed dormancy. |
AT1G23820 | Spermidine synthase. |
AT1G70310 | Spermidine synthase. |
AT5G53120 | encodes a novel spermine synthase and is a paralog of previously characterized spermidine synthases, SPDS1 and SPDS2. SPDS3 forms heterodimers with SDPS2, which in turn forms heterodimers with SDPS1 in vivo. The gene does not complement speDelta3 deficiency of spermidine synthase in yeast but DOES complement speDelta4 deficiency. |
AT1G69640 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
AT3G61580 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
AT4G21540 | Encodes a sphingosine kinase, also has enzyme activity towards other plant long-chain sphingoid bases. Involved in guard cell ABA signalling and seed germination. |
AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
AT5G06680 | Encodes protein similar to yeast SCP98. Yeast SCP98 is essential for the microtubule nucleation activity of the gamma-tubulin ring complexes. Enriched at the post-cytokinetic cell edges in leaves and roots. The mRNA is cell-to-cell mobile. |
AT2G03680 | The SPR1 gene encodes a plant-specific 12-kD protein which has a repeated motif at both ends, separated by a predicted rod-like domain, suggesting that it may act as an intermolecular linker. Ubiquitously expressed and belongs to a six-member gene family in Arabidopsis; expressed in transgenic seedlings localized to microtubules within the cortical array, preprophase band, phragmoplast, and mitotic spindle. |
AT1G69230 | SPIRAL1-LIKE2 belongs to a six-member gene family in Arabidopsis; all members share a high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root and organ growth as a result of defective anisotropic cell expansion. |
AT5G15600 | SPIRAL1-LIKE4 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
AT1G03060 | Encodes a WD/BEACH domain protein involved in cell morphogenesis and ribonucleoprotein particle formation. It interacts with the P-body core component DCP2, associates to mRNA processing bodies (P-bodies), and regulates their assembly upon salt stress. It accumulates at the root hair apex via post-Golgi compartments and positively regulates tip growth by maintaining tip-focused vesicle secretion and filamentous-actin integrity. |
AT2G47580 | encodes spliceosomal protein U1A |
AT5G60230 | putative subunit of tRNA splicing endonuclease |
AT3G13170 | Encodes AtSPO11-1, one of the three Arabidopsis homologues of the archaeal DNA topoisomerase VIA subunit (topo VIA). Required for meiotic recombination. AtSPO11-1 and AtSPO11-2 have overlapping functions (i.e. both required for meiotic recombination) whereas AtSPO11-3 functions in DNA replication. AtSPO11-1 accumulates in foci in early G2. At 1 h post-S phase, no foci are observed, but by 3 h a majority (80%) of meiocytes at this time point contain >50 foci. However, by 5 h, AtSPO11-1 foci are no longer detectable. This suggests that the protein undergoes a rapid cycle of accumulation and disappearance in meiocytes over a period of between 1 and 5 h post-S phase. |
AT5G20150 | Expression is upregulated in the shoot of cax1/cax3 mutant. Additionally, its expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. The mRNA is cell-to-cell mobile. |
AT2G26660 | SPX domain-containing protein 2 (SPX2);(source:Araport11) |
AT4G34640 | Encodes squalene synthase, which converts two molecules of farnesyl diphosphate (FPP) into squalene via an intermediate: presqualene diphosphate (PSPP). It is generally thought to be one of the key enzymes of sterol biosynthesis, since it catalyzes the first pathway-specific reaction of the sterol branch of the isoprenoid pathway. The mRNA is cell-to-cell mobile. |
AT1G69170 | Encodes SPL6. Required for the resistance mediated by the TIR-NB-LRR RPS4 against Pseudomonas syringae carrying the avrRps4 effector. Transcriptome analysis indicates that SPL6 positively regulates a subset of defense genes. |
AT1G27370 | In conjunction with SPL11 and SPL2, SPL10 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. SPL10 also controls lamina shape during vegetative development. |
AT1G20980 | Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. The mRNA is cell-to-cell mobile. |
AT5G43270 | Member of the SPL (squamosa-promoter binding protein-like) gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. In conjunction with SPL10 and SPL11, SPL2 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. |
AT3G15270 | Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR. |
AT5G18830 | Encodes a member of the Squamosa Binding Protein family of transcriptional regulators. SPL7 is expressed highly in roots and appears to play a role in copper homeostasis. Mutants are hypersensitive to copper deficient conditions and display a retarded growth phenotype. SPL7 binds to the promoter of the copper responsive miRNAs miR398b and miR389c. |
AT1G02065 | Encodes an SBP-box gene, a member of the SPL gene family. Mutants are affected in micro- and megasporogenesis, trichome formation on sepals, and stamen filament elongation. |
AT3G60030 | squamosa promoter-binding protein-like 12;(source:Araport11) |
AT2G15790 | SQN encodes the Arabidopsis homolog of cyclophilin 40 (CyP40). It is specifically required for the vegetative but not the reproductive maturation of the shoot. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT4G03430 | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
AT4G01970 | Encodes a a raffinose and high affinity stachyose synthase as well as a stachyose and Gol specific galactosylhydrolase enzyme activity.AtRS4 is a sequential multifunctional RafS and StaS as well as a high affinity StaS, accepting only Raf and Gol for Sta product formation. AtRS4 possesses a Sta and Gol specific galactosylhydrolase enzyme activity. |
AT2G36390 | Encodes a starch branching enzyme (EC.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout plant tissues. The mRNA is cell-to-cell mobile. |
AT5G03650 | Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves. |
AT1G10760 | Encodes an α-glucan, water dikinase required for starch degradation. Involved in cold-induced freezing tolerance. Mutations that eliminate the GWD protein or affect the dikinase domain of the enzyme dramatically reduce both the amount of phosphate in the amylopectin and the rate of starch degradation. Mature leaves of these mutants accumulate amounts of starch up to seven times greater than those in wild-type leaves. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C6 position. |
AT4G18240 | Encodes a starch synthase. In Arabidopsis leaves, the catalytic C-terminal region of STARCH SYNTHASE 4 promotes starch granule initiation while its non-catalytic N-terminal region determines starch granules morphology. |
AT3G52180 | Encodes a plant-specific glucan phosphatase that contains a noncatalytic carbohydrate-binding module as well as a dual specificity protein phosphatase domain. SEX4 can dephosphorylate C6- and C3-glucosyl residues on native starch grains and related maltodextrin compounds in vitro. This protein interacts with the plant SnRK AKIN11, binds starch, and is localized in the chloroplast. sex4 mutants have elevated levels of starch. |
AT5G19690 | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions The mRNA is cell-to-cell mobile. |
AT3G02850 | Encodes SKOR, a member of Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mediates the delivery of K+ from stelar cells to the xylem in the roots towards the shoot. mRNA accumulation is modulated by abscisic acid. K+ gating activity is modulated by external and internal K+. Involved in response to low potassium. |
AT3G57420 | Regulates the assembly and trafficking of cellulose synthase complexes. |
AT5G35770 | A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development. |
AT5G56040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT1G07420 | Arabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA. The sterol 4alpha-methyl oxidase2 family proteins SMO2-1 and SMO2-2 function partially through effects on auxin accumulation, auxin response and PIN1 expression to regulate embryogenesis in Arabidopsis. |
AT2G29390 | Encodes a sterol 4-alpha-methyl-oxidase, specifically a 4-alpha-methyl-delta-7-sterol-4alpha-methyl-oxidase. |
AT5G42890 | sterol carrier protein 2;(source:Araport11) |
AT5G13710 | SMT1 controls the level of cholesterol in plants |
AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
AT1G76090 | Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway. |
AT4G12110 | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase. Works together with SMO1-2 to maintain correct sterol composition and balance auxin and cytokinin activities during embryogenesis. |
AT4G18530 | lysine ketoglutarate reductase trans-splicing-like protein, putative (DUF707);(source:Araport11) |
AT1G79200 | Encodes a nuclear localized protein involved in auxin-dependent control of cell proliferation in pistil development. Loss of function mutations have increased cell proliferation in the stigma. |
AT4G12970 | Encodes a cysteine-rich peptide, a secretory factor that is produced in the mesophyll cells and acts on the epidermis to increase stomatal formation. Its mature form is a 45-aa peptide with three intramolecular disulfide bonds. It is proposed that STOMAGEN increases stomatal number by competing with two negative regulators of stomatal density, EPF1 and EPF2. STOMAGEN has been shown to compete with EPF2 for binding to the ER and TMM receptor kinases.Binding of STOMAGEN to ER prevents induction of the EPF2-ER MAPK cascade. It's transcript levels change after inducing MUTE expression in a mute background. |
AT5G65590 | Encodes a plant-specific Dof-type transcription factor expressed in maturing guard cells, but not in guard mother cells. It regulates essential processes of stomatal guard cell maturation and functions as a key transcription factor regulating the final stages of guard cell differentiation. |
AT3G56480 | myosin heavy chain-like protein;(source:Araport11) |
AT1G49040 | Encodes soluble protein containing N-terminal DENN domain and eight C-terminal WD-40 repeats. Involved in cytokinesis of guard mother cells and leaf epidermal cells. The overall growth and development of mutant plants is severely affected, they are smaller than wt, with defects in seedling development, leaf expansion and flower morphology which renders the mutant conditionally sterile. |
AT3G12630 | Encodes a protein with E3 ligase activity that acts as a positive regulator of stress responses in Arabidopsis. |
AT4G22820 | A member of the A20/AN1 zinc finger protein family involved in stress response.Expression is increased in response to water, salt , pathogen and other stressors.SAP9 can pull down both K48-linked and K63- linked tetraubiquitin chains and functions as a E3 ubiquitin ligase suggesting a role in proteasome-dependent protein degradation. |
AT4G34190 | Encodes a stress enhanced protein that localizes to the thylakoid membrane and whose mRNA is upregulated in response to high light intensity. It may be involved in chlorophyll binding. |
AT4G25380 | stress-associated protein 10;(source:Araport11) |
AT4G12040 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT1G55760 | Expression induced under NaCl, mannitol, ABA and indole-3-acetic acid (IAA) treatment. |
AT1G74020 | Encodes AtSS-2 strictosidine synthase. |
AT1G08470 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
AT3G51420 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
AT4G03390 | STRUBBELIG-receptor family 3;(source:Araport11) |
AT5G07660 | Encodes SMC6A (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6A), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
AT5G04940 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. SUVH1 has been shown to have a preference for binding methylated DNA. |
AT4G13460 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
AT2G05920 | Subtilase family protein;(source:Araport11) |
AT5G67090 | Encodes a subtilisin-like serine protease with in vitro protease activity. |
AT5G66760 | One of two genes in Arabidopsis that encode a flavoprotein subunit of the mitochondrial succinate dehydrogenase complex. The mRNA is cell-to-cell mobile. |
AT2G18450 | Nuclear encoded mitochondrial flavoprotein subunit of succinate dehydrogenase complex . |
AT3G27380 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth. |
AT5G40650 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth. |
AT5G67490 | SDHAF4 acts on FAD-SDH1 and promotes its assembly with SDH2, thereby stabilizing SDH2 and enabling its full assembly with SDH3/SDH4 to form the SDH complex. |
AT2G46505 | Encodes succinate dehydrogenase ,a component of mitochondrial respiratory complex II. Nuclear encoded gene which is imported into the mitochondrion. |
AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile. |
AT5G20280 | Encodes a sucrose-phosphate synthase activity. This is the major leaf isoform. |
AT5G11110 | Encodes a sucrose-phosphate synthase involved in pollen exine formation. This is the dominant SPS isoform in leaves with respect to protein levels. |
AT4G02280 | Encodes a protein with sucrose synthase activity (SUS3). It appears to be important for sucrose metabolism in developing seeds, especially during the late maturation phase, about 18 days after flowering. |
AT1G09960 | low affinity (10mM) sucrose transporter in sieve elements (phloem) |
AT3G52340 | sucrose-phosphatase (SPP2) |
AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
AT1G73660 | Encodes a protein with similarity to MAPKKKs. May function as a negative regulator of salt tolerance. |
AT1G11260 | Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile. |
AT3G19930 | Encodes a sucrose hydrogen symporter that is induced by wounding. The mRNA is cell-to-cell mobile. |
AT5G04040 | Encodes a triacylglycerol lipase that is involved in storage lipid breakdown during seed germination. The mutant plant exhibits a much slower rate of postgerminative growth than the wild type. |
AT3G51895 | Encodes a chloroplast-localized sulfate transporter. |
AT5G13550 | Encodes a sulfate transporter. |
AT5G04590 | A.thaliana gene encoding sulfite reductase. |
AT4G33030 | involved in sulfolipid biosynthesis The mRNA is cell-to-cell mobile. |
AT5G01220 | Encodes a UDP-sulfoquinovose:DAG sulfoquinovosyltransferase that is involved in sulfolipid biosynthesis and whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
AT2G03770 | Encodes a sulfotransferase with sulfating activity toward flavonoids, specifically kaempferol. |
AT5G07010 | Encodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor). |
AT1G04770 | SDI2 is a member of a small family of TPR proteins in Arabidopsis. Like SDI1 it is induced by low sulfer and appears to play a role in negative regulation of glucosinolate biosynthesis. |
AT5G66170 | Encodes a thiosulfate sulfurtransferase/rhodanese. |
AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
AT2G03760 | Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens. |
AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
AT2G21470 | Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein. |
AT1G22882 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology. Secreted peptide which functions in plant growth and pathogen defense. |
AT5G64340 | Encodes a bHLH(basic helix-loop-helix)-type transcription factor SAC51 [suppressor of acaulis 51]. Upregulation of SAC51 reverses the dwarf phenotype caused by a loss-of-function mutation in ACL5 (Arabidopsis thaliana ACAULIS 5) gene, suggesting that activation of SAC51 may lead to the expression of a subset of genes required for stem elongation. |
AT3G59770 | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. |
AT1G80680 | Mutant has early-flowering phenotype, encodes a putative nucleoporin. Required for the activation of downstream defense pathways by the snc1 mutation. Involved in basal resistance against bacterial pathogens. |
AT2G31880 | Encodes a putative leucine rich repeat transmembrane protein that is expressed in response to Pseudomonas syringae. Expression of SRRLK may be required for silencing via lsiRNAs. Regulates cell death and innate immunity. |
AT1G25580 | Encodes suppressor of gamma response 1 (SOG1), a putative transcription factor governing multiple responses to DNA damage. |
AT5G23570 | Required for posttranscriptional gene silencing and natural virus resistance.SGS3 is a member of an 'unknown' protein family. Members of this family have predicted coiled coiled domains suggesting oligomerization and a potential zinc finger domain. Involved in the production of trans-acting siRNAs, through direct or indirect stabilization of cleavage fragments of the primary ta-siRNA transcript. Acts before RDR6 in this pathway. The mRNA is cell-to-cell mobile. |
AT3G60400 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile. |
AT3G06670 | SMEK1 forms a catalytically active complex with PP4 proteins. The complex has been shown to target and dephosphorylate HYL1 which in turn promotes miRNA biogenesis. Mutants have pleiotrophic phenotypes and decreased production of miRNA. SMEK1 accumulation is responsive to ABA. |
AT1G21580 | Encodes a zinc-finger protein that co-localizes with the exosome-associated RNA helicase HEN2 and functions as a co-factor of nuclear RNA quality control by the nucleoplasmic exosome. |
AT2G46340 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA1 is a PHYA signaling intermediate, putative regulator of PHYA signaling pathway. Light responsive repressor of photomorphogenesis. Involved in regulating circadian rhythms and flowering time in plants. Under constant light, the abundance of SPA1 protein exhibited circadian regulation, whereas under constant darkness, SPA1 protein levels remained unchanged. In addition, the spa1-3 mutation slightly shortened circadian period of CCA1, TOC1/PRR1 and SPA1 transcript accumulation under constant light. |
AT5G08150 | Encodes SOB5. Activation tagging lines accumulated higher level of cytokinin. |
AT2G45070 | Sec61 Beta Subunit |
AT1G62970 | SDJ3 functions partially redundantly with SDJ1 and SDJ2 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
AT1G65660 | Encodes a CCHC zinc finger protein that may function as a step II splicing factor. In an epigenetic allele of SMP1 (in which SMP1 and SMP2 mRNA is reduced) organs are smaller and contain fewer cells. |
AT4G02020 | Encodes a polycomb group protein. Forms part of a large protein complex that can include VRN2 (VERNALIZATION 2), VIN3 (VERNALIZATION INSENSITIVE 3) and polycomb group proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE) and CURLY LEAF (CLF). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. Performs a partially redundant role to MEA in controlling seed initiation by helping to suppress central cell nucleusendosperm proliferation within the FG. |
AT1G21700 | a member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003). |
AT5G51330 | Encodes novel protein involved in sister chromatid cohesion and meiotic chromosome organization during both male and female meiosis. Gene has two alternate transcripts which produce two similar proteins, one 57 aa shorter than the other. |
AT2G47210 | myb-like transcription factor family protein;(source:Araport11) |
AT5G05490 | Encodes a RAD21-like gene essential for meiosis. Encodes a 627 a.a. protein that is slightly longer in the N-terminus than SYN1 BP5. |
AT2G20990 | Encodes a protein specifically localized to the ER-PM boundary with similarity to synaptotagmins, a class of membrane trafficking proteins. SYT1 is expressed in all tissues. Loss of function mutations show hypersensitivity to NaCl and electrolyte leakage from the plasma membrane. SYT1 also affects calcium dependent freezing tolerance and mechanical stress response. Regulates endocytosis endosome recycling at the plasma membrane, but not membrane traffic along the secretory pathway. SYT1 may have a role in membrane repair such as membrane resealing after freezing induced damage. SYT1 binds to phosphatidylinositol phosphates in vitro. It is distributed to immobile tubules and likely plays an important role in the formation of the tubular ER network as well as in cellular ER-PM tethering. |
AT5G16830 | member of SYP2 Gene Family. Over-expression of the gene in tobacco protoplasts leads to a disruption of vacuolar transport from the prevacuolar compartment (PVC) to the vacuole, but not from the Golgi apparatus to the plasma membrane. |
AT4G17730 | member of SYP2 Gene Family. Together with SYP23 interacts with Tobacco mosaic virus 126 kDa protein; required for normal local virus accumulation and spread. |
AT3G11820 | Encodes a syntaxin localized at the plasma membrane. SYR1/PEN1 is a member of the SNARE superfamily and functions in positioning anchoring of the KAT1 K+ channel protein at the plasma membrane. Transcription is upregulated by abscisic acid, suggesting a role in ABA signaling. Also functions in non-host resistance against barley powdery mildew. It is a nonessential component of the preinvasive resistance against Colletotrichum fungus. Required for mlo resistance. The syp121 point mutation results in stomatal phenotypes that reduce CO2 assimilation, slow vegetative growth and increase water use efficiency in the whole plant, conditional upon high light intensities and low relative humidity. The R20R21 motif of SYP121 are essential for SEC11 interaction. Mutation of the R20R21 motif blocks vesicle traffic without uncoupling the effects of SYP121 on solute and K+ uptake associated with the F9xRF motif; the mutation also mimicks the effects on traffic block observed on coexpression of the dominant negative SEC11?149 fragment. |
AT1G11250 | member of SYP12 Gene Family |
AT3G05710 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP42, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
AT1G79590 | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
AT5G49010 | Similar to the SLD5 component of GINS complex, which in other organism was shown to be involved in the initiation of DNA replication. |
AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
AT3G05330 | Encodes a protein with moderate sequence similarity to the maize microtubule-binding protein TANGLED1. A single base-pair deletion (-A) at position Chr3:1519176 in Columbia relative to the Landsberg erecta and Achkarren-2 ecotype (see ESTs DR378436 and CB26450) introduces a frame-shift and premature termination codon. The protein encoded from the Columbia gene is truncated by 29 amino acids relative to the Landsberg erecta and Achkarren-2 encoded proteins. Involved in the identification of the division plane during mitosis amd cytokinesis |
AT4G24972 | Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1. |
AT5G60120 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY1 and CRY2 during flowering as part of a regulatory circuit including FT and CO. TOE1/TOE2 are also targets of MiR172b repression and functions in regulation of innate immunity via repression of FLS. |
AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT1G50030 | Related to TOR proteins from yeast and mammals, regulators of cell growth in response to nutrient availability. TOR proteins belong to the family of phosphatidylinositol 3-kinase and are targets of the antiproliferative drug rapamycin. AtTOR binds the yeast FKBP12 protein in the presence of Rapamycin, is involved in embryogenesis and is expressed in embryos, endosperm and meristems. Participates in negatively modulating ethylene signals and the molecular mechanism is likely involved in the regulation of ethylene biosynthesis by affecting ACSs in transcription and protein levels |
AT3G13445 | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex |
AT1G55520 | TATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex. |
AT1G50300 | TBP-associated factor 15;(source:Araport11) |
AT5G25150 | Encodes a putative TATA-binding-protein associated factor TAF5. TAFs are subunits of the general transcription factor IID (TFIID). |
AT1G54360 | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
AT5G51910 | TCP family transcription factor;(source:Araport11) |
AT5G08330 | Circadian oscillator protein which interacts with bZIP63 and regulates a response of the circadian oscillator to sugar. Is not required for the sugar-induced circadian phase advance in the morning; regulates a response of CCA1 to sugars. |
AT1G35560 | Encodes a member of the TCP-P subfamily that is involved in flowering time control and plant development. Mutants present an early flowering phenotype. |
AT5G23280 | Transcription factor which plays an important role during leaf and hypocotyl development, redundantly, with at least six class I TCPs, and regulates the expression of CYCD1;1 to affect endoreplication. |
AT1G58100 | Encodes TCP8, belongs to the TCP transcription factor family known to bind site II elements in promoter regions. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
AT2G45680 | TCP family transcription factor;(source:Araport11) |
AT3G15030 | Arabidopsis thaliana TCP family transcription factor. Regulated by miR319. Involved in heterchronic regulation of leaf differentiation. |
AT4G28840 | Encodes TCP INTERACTOR-CONTAINING EAR MOTIF PROTEIN 1 (TIE1), an important repressor of CINCINNATA (CIN)-like TEOSINTE BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factors, which are key for leaf development. |
AT2G20080 | hypothetical protein;(source:Araport11) |
AT5G24590 | Member of NAc protein family. Interacts with turnip crinkle virus (TCV) capsid protein. Transcription factor involved in regulating the defense response of Arabidopsis to TCV. |
AT4G32700 | Encodes a DNA polymerase required for microhomology mediated repair of DNA double strand breaks and is required for T-DNA integration. The protein contains two conserved functional domains: an N-terminal superfamily II DNA/RNA helicase domain and a C-terminal prokaryotic-type DNA polymerase I domain. Required for regulated cell division and differentiation in meristems. Mutant plants show morphological defects, such as short roots, serrated leaves, and fasciation, as well as defective patterns of cell division and differentiation in the meristem. Mutant plants had 2.5 to 4.5-fold higher expression of ATGR1, ATBRCA1 and RAD51 genes. TEB is required for normal progression of DNA replication and for correct expression of genes during development. |
AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
AT1G25560 | Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. |
AT1G53230 | Encodes a member of a recently identified plant transcription factor family that includes Teosinte branched 1, Cycloidea 1, and proliferating cell nuclear antigen (PCNA) factors, PCF1 and 2. Regulated by miR319. Involved in heterochronic regulation of leaf differentiation. |
AT3G47620 | Encodes a transcription factor AtTCP14 that regulates seed germination. AtTCP14 shows elevated expression level just prior to germination. AtTCP14 is predominantly expressed in the vascular tissue of the embryo, and affects gene expression in radicles in a non-cell-autonomous manner. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
AT1G69690 | AtTCP15 is involved in the regulation of endoreduplication. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
AT4G16740 | Encodes an (E,E)-alpha-farnesene synthase in the Col ecotype of Arabidopsis. This enzyme can also catalyze the formation of (E)-beta-ocimene as well as trace amounts of myrcene and other related compounds in vitro. The cytosolic localization of the protein may make it favor (E,E)-alpha-farnesene biosynthesis because the precursor of this product, FPP, is primarily cytosolic. Transcript levels for this gene increase in response to treatment with the jasmonic acid mimic coronalon or in response to the insect Plutella xylostella. TPS03 transcripts can also be detected in flowers. A similar protein from the C24 ecotype with one amino acid change (S267F) has a different substrate specificity. |
AT2G24210 | terpene synthase 10;(source:Araport11) |
AT1G70080 | Terpene synthase. Expressed in roots and has low enzyme activity in vitro. Products include dolabellane type diterpenes. Sesterterpene synthase which produces various sesterpne backbones via type-B cyclization mechanism. |
AT5G57810 | Member of TETRASPANIN family |
AT2G19580 | Member of TETRASPANIN family |
AT3G45600 | Member of TETRASPANIN family |
AT2G23810 | Member of TETRASPANIN family |
AT1G04530 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT1G58450 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G21990 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Functions as a chaperone receptor at the chloroplast outer envelope, mediating Hsp70-dependent protein targeting to chloroplasts. It has been localized to the ER membrane, interacts with the Sec translocon, and has a potential function in post-translational protein transport into the ER. The mRNA is cell-to-cell mobile. |
AT2G42580 | Encodes a member of the TTL family and contains a thioredoxin like domain and three tandom TPRs. Interacts physically with BRL2/VH1 and appears to play a role in brassiosteroid and auxin signaling. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
AT5G06839 | bZIP transcription factor family protein;(source:Araport11) |
AT1G08320 | bZIP transcription factor family protein;(source:Araport11) |
AT5G10030 | Encodes a member of basic leucine zipper transcription gene family. Nomenclature according to Xiang, et al. (1997). |
AT1G77920 | bZIP transcription factor family protein;(source:Araport11) |
AT1G24460 | Encodes a novel protein that co-immunoprecipitates with SYP41. It is involved in vacuolar trafficking and salt tolerance, potentially via a role in vesicle fusion and in maintaining TGN structure or identity. Mutants display delayed formation of the Brefeldin A (BFA) compartment in cotyledons upon application of BFA. |
AT3G59280 | Encodes the ortholog of yeast PAM16, part of the mitochondrial inner membrane protein import motor. Single mutant plants exhibit a smaller size and enhanced resistance against virulent pathogens. They also display elevated reactive oxygen species (ROS) accumulation. |
AT5G54380 | Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
AT1G02880 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
AT2G29630 | Encodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene. Recessive mutant isolated by Redei. Leaves but not cotyledons white, lethal; restored to normal by thiamine or 2,5-dimethyl-4-aminopyrimidine. |
AT1G45145 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
AT1G03680 | Encodes a m-type thioredoxin (Trx-m1) localized in chloroplast stroma. |
AT2G35010 | Localized in mitochondria; associated with redox-active functions and effects on plant growth in constant light; joint role with Trx h2 in regulating NADPH redox balance and photosynthetic performance in fluctuating light. |
AT1G50320 | encodes a prokaryotic thioredoxin |
AT1G08630 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Primarily expressed in seeds and seedlings. |
AT3G04520 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Expressed in vascular tissue through out the plant. |
AT2G30440 | Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile. |
AT4G27800 | Choroplast protein phosphatase TAP38/PPH1 is required for efficient dephosphorylation of the LHCII anthena and state transition from state 2 to state 1. |
AT1G77490 | Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
AT3G63180 | TIC-like protein;(source:Araport11) |
AT3G15070 | Encodes a RING-type E3 ligase that positively regulates CIN-like TCP activity to promote leaf development by mediating the degradation of the TCP repressor TIE1. |
AT1G08260 | Similar to POL2A, DNA polymerase epsilon catalytic subunit. Essential for Arabidopsis growth. Null homozygotes are embryo lethal, partial loss of function alleles show embryo patterning defects such as root pole displacement. Delayed progression through cell cycle results in embryos with smaller numbers of larger cells. |
AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
AT5G52910 | homolog of Drosophila timeless |
AT5G61380 | Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. The mRNA is cell-to-cell mobile. |
AT5G25810 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family (TINY). The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic or overexpression of this gene in a Ds tagged line has reduced cell expansion. The expression of this gene is induced by ethylene and light and appears to stimulate cytokinin biosynthesis. |
AT4G23640 | Functions as a potassium transporter and is required for the establishment of root tip growth. |
AT5G44920 | Encodes a KASH domain protein that localizes to the nuclear envelope and affects nuclear morphology. |
AT1G72940 | Nucleotide-binding, leucine-rich repeat (NLR) gene regulated by nonsense-mediated mRNA decay (NMD) genes UPF1 and UPF3. |
AT1G72950 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT4G09420 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT5G56220 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G72850 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT3G60740 | Encodes tubulin-folding cofactor D. Mutants arrest during embryogenesis with embryos that are small, mushroom-shaped ('pilz') and consist of only one or few large cells each containing one or more variably enlarged nuclei and often cell wall stubs. Gene product necessary for continuous microtubule organization. |
AT3G54670 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
AT3G20070 | Encodes a plant-specific protein of unknown function. Mutant embryos contain at most four small cells. The endosperm nucleoli are enlarged. Gene is expressed in siliques based on EST information. |
AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
AT3G63500 | Encodes a PHD-finger protein that, with TTA2, is redundantly required for MP-dependent embryonic root meristem initiation. |
AT2G02180 | Necessary for the efficient multiplication of tobamoviruses. The mRNA is cell-to-cell mobile. |
AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
AT1G21380 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT1G76970 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT5G63640 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT2G38410 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT5G01760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT4G32760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT1G63670 | hypothetical protein (DUF3741);(source:Araport11) |
AT3G61380 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
AT4G00440 | GPI-anchored adhesin-like protein, putative (DUF3741);(source:Araport11) |
AT2G39435 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
AT5G62170 | LOW protein: M-phase inducer phosphatase-like protein;(source:Araport11) |
AT2G17550 | RB1-inducible coiled-coil protein;(source:Araport11) |
AT2G36420 | nucleolin-like protein;(source:Araport11) |
AT5G03670 | histone-lysine N-methyltransferase SETD1B-like protein;(source:Araport11) |
AT1G18620 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
AT3G63430 | zinc finger CCCH domain protein;(source:Araport11) |
AT4G00770 | DUF4378 domain protein;(source:Araport11) |
AT5G47560 | Encodes a tonoplast malate/fumarate transporter. |
AT5G47450 | Tonoplast intrinsic protein, transports ammonium (NH3) and methylammonium across the tonoplast membrane, gene expression shows diurnal regulation and is upregulated by ammonium (NH3). |
AT4G35300 | tonoplast monosaccharide transporter2;(source:Araport11) |
AT1G15750 | Encodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. |
AT1G80490 | Encodes a protein with a Lissen-cephaly type-1-like homology (LisH) domain at the N terminus,a C-terminal to LisH (CTLH) domain, and 12 WD (tryptophan-aspartic acid)-40 repeats at the C terminus. It is closely related to Topless (TPL), which mediates auxin-dependent transcriptional repression during embryogenesis. |
AT3G16830 | TOPLESS family member which directly binds the N-terminal domain of SNC1 and interacts with TPR1. |
AT5G27030 | TOPLESS family member involved in the negative regulation of SNC1-dependent phenotypes. |
AT3G20780 | Encodes putative eukaryotic homolog of archaebacterial topoisomerase VI subunit B, TOP6B. Is essential for endoreduplication and is involved in cell expansion and cell proliferation. The hlq (harlequin) dwarf mutant has fewer root hair and leaf trichome. It has abnormal epidermal cell and accumulates callose. |
AT5G55540 | Encodes a large plant-specific protein of unknown function, with conserved domains also found in a variety of signaling proteins, In trn mutants, the leaf venation network had a severely reduced complexity: incomplete loops, no tertiary or quaternary veins, and vascular islands. The leaf laminas were asymmetric and narrow because of a severely reduced cell number. TRN1 is required for the maintenance of both the radial pattern of tissue differentiation in the root and for the subsequent circumferential pattern within the epidermis. Double mutant analysis showed that TRN1 and TRN2 act in the same pathway. |
AT5G37770 | Encodes a protein with 40% similarity to calmodulin. Binds Ca(2+) and, as a consequence, undergoes conformational changes. CML24 expression occurs in all major organs, and transcript levels are increased from 2- to 15-fold in plants subjected to touch, darkness, heat, cold, hydrogen peroxide, abscisic acid (ABA), and indole-3-acetic acid. However, CML24 protein accumulation changes were not detectable. The putative CML24 regulatory region confers reporter expression at sites of predicted mechanical stress; in regions undergoing growth; in vascular tissues and various floral organs; and in stomata, trichomes, and hydathodes. CML24-underexpressing transgenics are resistant to ABA inhibition of germination and seedling growth, are defective in long-day induction of flowering, and have enhanced tolerance to CoCl(2), molybdic acid, ZnSO(4), and MgCl(2). Also regulates nitric oxide levels. |
AT2G41100 | encodes a calmodulin-like protein, with six potential calcium binding domains. Calcium binding shown by Ca(2+)-specific shift in electrophoretic mobility. Expression induced by touch and darkness. Expression may also be developmentally controlled. Expression in growing regions of roots, vascular tissue, root/shoot junctions, trichomes, branch points of the shoot, and regions of siliques and flowers. The mRNA is cell-to-cell mobile. |
AT5G57560 | Encodes a cell wall-modifying enzyme, rapidly upregulated in response to environmental stimuli. |
AT5G55860 | WEB1/PMI2 related protein involved in mecahnotransduction.TREPH1 is phosphorylated at position S625 in response to touch, and this is required for mechanosensitive growth response. |
AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
AT4G11990 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of aurora kinase activity. |
AT4G22860 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of aurora kinase activity |
AT3G25795 | Encodes a trans-acting siRNA that is phosphate starvation-upregulated and activated by PAP1 (MYB75). Has been identified as a translated small open reading frame by ribosome profiling. |
AT3G17185 | Encodes a trans-acting siRNA (tasi-RNA) that regulates the expression of auxin response factor genes (ARF2, ARF4, ETT). One of 3 genomic loci that encode the TAS3 siRNA. Has been identified as a translated small open reading frame by ribosome profiling. |
AT2G41630 | Encodes a transcription factor, TFIIB1, that plays important roles in pollen tube growth, guidance, and reception as well as endosperm development and is partially functionally different from AtTFIIB2 and AtTFIIB3/AtpBRP2. |
AT3G10330 | Cyclin-like family protein;(source:Araport11) |
AT1G72050 | Encodes a transcriptional factor TFIIIA required for transcription of 5S rRNA gene. 5S rRNA is the smallest constituent of the ribosome. Work on one of the gene models AT1G72050.2 showed that it encodes a protein with nine Cys(2)-His(2)-type zinc fingers, a characteristic feature of TFIIIA proteins. AT1G72050.2 also contains a 23 amino acid spacer between fingers 1 and 2, a 66 amino acid spacer between fingers 4 and 5, and a 50 amino acid non-finger C-terminal tail. in vitro assay demonstrated that AT1g72050.2 binds to 5S rDNA and efficiently stimulates the transcription of 5S rRNA. AT1g72050.2 also binds to 5S rRNA in vitro. AT1g72050.2 is located at several nuclear foci including the nucleolus and is absent from the cytoplasm. |
AT4G35610 | Interacts with EIN3 to regulate transcriptional repression that leads to an inhibition of shoot growth in response to ethylene. |
AT5G24710 | WD40/YVTN repeat protein which cooperates with the AP2 complex in the clathrin-mediated endocytosis of cellulose synthase to regulate cellulose biosynthesis. |
AT3G60750 | Transketolase;(source:Araport11) |
AT2G45290 | Transketolase;(source:Araport11) |
AT3G16640 | Encodes a protein homologous to translationally controlled tumor protein (TCTP) from Drosophila. In flies, TCTP functions guanine nucleotide exchange factor in the TOR signaling pathway. TCTP is expressed throughout the plant with highest levels seen in meristematic regions of the shoot and root. Loss of function alleles are not transmitted through the male gametophyte due to defects in pollen tube growth. Hypomorphs, generated through RNAi, are dwarf and have smaller cells. These plants also have defects in lateral and primary root growth as well as root hair growth. The phenotypes are similar to TOR mutants suggesting that TCTP functions in the is pathway in Arabidopsis as well. |
AT1G20350 | mitochondrial inner membrane translocase |
AT1G72750 | translocase inner membrane subunit 23-2;(source:Araport11) |
AT3G46560 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. Together with AtTIM10, AtTIM9 is non-redundantly essential for maintaining mitochondrial function of early embryo proper cells and endosperm free-nuclei. |
AT2G47840 | Encodes a component of the TIC (translocon at the inner envelope membrane of chloroplasts) protein translocation machinery mediating the protein translocation across the inner envelope of plastids. The Arabidopsis genome encodes four Tic20 homologous proteins, AT1G04940(Tic20-I), AT2G47840(Tic20-II), AT4G03320(Tic20-IV) and AT5G55710(Tic20-V). |
AT4G03320 | Encodes a component of the TIC (translocon at the inner envelope membrane of chloroplasts) protein translocation machinery mediating the protein translocation across the inner envelope of plastids. The Arabidopsis genome encodes four Tic20 homologous proteins, AT1G04940(Tic20-I), AT2G47840(Tic20-II), AT4G03320(Tic20-IV) and AT5G55710(Tic20-V). |
AT3G23710 | Tic22-like family protein;(source:Araport11) |
AT2G24820 | translocon at the inner envelope membrane of chloroplasts 55-II;(source:Araport11) |
AT5G20300 | Encodes Toc90, part of the TOC (translocon at the outer chloroplast membrane) machinery involved in the import of nucleus-encoded proteins into the chloroplast. |
AT1G36060 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.Overexpression results in increased drought tolerance and vitrified leaves. Binds to DRE/GCC promoter elements and activates expression of aquaporin genes AtTIP1;1, AtTIP2;3, and AtPIP2;2. |
AT1G66150 | Receptor-like transmembrane kinase I (TMK1); key regulator in auxin signaling. High auxin and TMK1 play essential and positive roles in ABA signaling through regulating ABA INSENSITIVE 1 and 2 (ABI1/2). Inhibits the phosphatase activity of ABI2 by direct phosphorylation of threonine 321 (T321), a conserved phosphorylation site in ABI2 proteins, whose phosphorylation status is important for both auxin and ABA responses. |
AT1G10950 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. Functions in the deposition of rhamnogalacturonan II and I for cell growth. |
AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
AT5G07990 | Required for flavonoid 3' hydroxylase activity. Enzyme abundance relative to CHS determines Quercetin/Kaempferol metabolite ratio. The mRNA is cell-to-cell mobile. |
AT3G28430 | Encodes a peripheral membrane protein localized at the Golgi apparatus that is involved in membrane trafficking, vacuole development and in flavonoid accumulation in the seed coat. Mutant seed color is pale brown. |
AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
AT2G16950 | TRN1 is an importin beta protein that functions as a nuclear import receptor for AtGRP7 and in interacts with AGO1 to affect miRNA loading. |
AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
AT1G60140 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
AT4G27550 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G39770 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G23870 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. The mRNA is cell-to-cell mobile. |
AT3G46590 | Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers. |
AT3G53790 | Arabidopsis thaliana telomere-binding protein, putative (At3g53790) |
AT1G06910 | Arabidopsis thaliana myb family transcription factor (At1g06910) |
AT3G12560 | Encodes a telomeric DNA-binding protein. |
AT2G19450 | Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA). |
AT3G12060 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G06080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT5G64020 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G37720 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT4G25360 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G01430 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers.Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G70230 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G40150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G11030 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be observed only in double or triple mutant combinations with esk1. |
AT2G34070 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA. |
AT1G29050 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G42570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G14850 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G78710 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G30010 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G62390 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G55440 | Encodes triosephosphate isomerase. |
AT4G20850 | Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant. |
AT1G73980 | TTM1 is a triphosphate tunnel metalloenzyme that displays pyrophosphatase activity. It contains both a uridine kinase (UK) domain,CYTH domain, a coiled-coil domain and a transmembrane domain at the C-terminal Mutants show a delay in leaf senescence. Can functionally complement TTM1 and vise versa. (PMID:28733390) |
AT4G01880 | methyltransferase;(source:Araport11) |
AT3G02320 | Involved in posttranscriptional modification of tRNA. |
AT5G15810 | Involved in posttranscriptional modification of tRNA. |
AT4G17610 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
AT3G56120 | tRNA methyltransferase acting on guanine-37 and inosine-37. |
AT2G45730 | eukaryotic initiation factor 3 gamma subunit family protein;(source:Araport11) |
AT5G14600 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G17660 | tRNA (guanine-N-7) methyltransferase;(source:Araport11) |
AT4G24670 | Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. Double mutant analyses suggest that this protein is involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling.TAR2 is required for reprogramming root architecture in response to low nitrogen conditions. |
AT1G34040 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT3G06060 | Encodes one of the Arabidopsis proteins (At3g06060/TSC10A and At5g19200/TSC10B) with significant similarity to the yeast 3-ketodihydrosphinganine (3-KDS) reductase, Tsc10p. Both TSC10A and TSC10B are bona fide 3-KDS reductase as shown by complementation experiment in yeast. |
AT3G27060 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes. TSO2 transcription occurs predominantly at the S-phase of the cell cycle and its expression pattern is consistent with its role in dNDP biosynthesis during DNA replication in actively dividing cells. Critical for cell cycle progression, DNA damage repair and plant development. |
AT2G47770 | Encodes a membrane-bound protein designated AtTSPO (Arabidopsis thaliana TSPO-related). AtTSPO is related to the bacterial outer membrane tryptophan-rich sensory protein (TspO) and the mammalian mitochondrial 18 kDa Translocator Protein (18 kDa TSPO), members of the TspO/MBR domain-containing membrane proteins. Mainly detected in dry seeds, but can be induced in vegetative tissues by osmotic or salt stress or abscisic acid treatment. Located in endoplasmic reticulum and the Golgi stacks. It is degraded through the autophagy pathway. |
AT1G25280 | Member of TLP family |
AT1G53320 | Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain. |
AT3G06380 | Member of plant TLP family which differs in having an F box domain. Interacts with ASK proteins.Plasma membrane tethering is mediated by PIP2 binding domain. Mutants are insensitive to ABA. May act redundantly with its paralog TPL3. |
AT1G50010 | Encodes alpha-2,4 tubulin. TUA2 and TUA4 encode identical proteins. The mRNA is cell-to-cell mobile. |
AT1G04820 | Encodes an alpha tubulin isoform that is expressed in roots, leaves and flowers. |
AT5G19780 | Encodes an isoform of alpha tubulin. Closely related to adjacent gene TUA3 suggesting recent duplication. The mRNA is cell-to-cell mobile. |
AT5G23860 | beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. The mRNA is cell-to-cell mobile. |
AT5G62690 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
AT5G62700 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
AT5G44340 | beta tubulin gene |
AT1G20010 | beta tubulin |
AT4G20890 | tubulin 9 The mRNA is cell-to-cell mobile. |
AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
AT5G64510 | Encodes Tunicamycin Induced 1(TIN1), a plant-specic ER stress-inducible protein. TIN1 mutation affects pollen surface morphology. Transcriptionally induced by treatment with the N-linked glyclsylation inhibitor tunicamycin. |
AT4G20370 | Encodes a floral inducer that is a homolog of FT. Plants overexpressing this gene flower earlier than Col. Loss-of-function mutations flower later in short days. TSF and FT play overlapping roles in the promotion of flowering, with FT playing the dominant role and together playing an antagonistic role to TFL1 in the determination of inflorescence meristem identity. .TSF sequences show extensive variation in different accessions and may contribute to quantitative variation in flowering time in these accessions. TSF has a complex pattern of spatial expression; it is expressed mainly in phloem and expression is regulated by daylength and vernalization. |
AT5G01075 | Encodes a small ER-localized protein that is strongly expressed in seeds and regulates both embryo development and accumulation of storage compounds. At the cellular level, TWS1 is responsible for cuticle deposition on epidermal cells and organization of the endomembrane system. |
AT4G03560 | Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress. |
AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
AT2G29400 | Type 1 protein phosphatase, expressed in roots, rosettes and flowers |
AT5G59160 | Encodes the catalytic subunit of a Type 1 phosphoprotein Ser/Thr phosphatase, expressed in roots, shoots and flowers. |
AT5G36160 | Encodes a cytosolic L-tyrosine aminotransferase. AtTAT2 exhibits much broader amino donor specificity than AtTAT1 and can use not only Tyr but also Phe, Trp, His, Met, Leu, Ala, Ser, Cys, Asp, Asn, Gln, and Arg as amino donors. |
AT5G53970 | Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. AtTAT1 prefers Tyr as an amino donor but can also use Phe, Trp, His, Met, and Leu. The mRNA is cell-to-cell mobile. |
AT1G08030 | Encodes a tyrosylprotein sulfotransferase (TPST). This protein is a 500-aa type I transmembrane protein that shows no sequence similarity to animal TPSTs. Activity confirmed by protein expression in yeast. TPST is expressed throughout the plant body, and the highest levels of expression are in the root apical meristem. TPST acts in the auxin pathway to maintain postembryonic root stem cell niche by defining the expression of the PLETHORA stem cell transcription factor genes. A loss-of-function mutant TPST displayed a marked dwarf phenotype accompanied by stunted roots, pale green leaves, reduction in higher order veins, early senescence, and a reduced number of flowers and siliques. TPST suppresses ethylene production through the action of PSK (phytosulfokine). |
AT3G50670 | Encodes U1 snRNP 70K |
AT2G30260 | encodes U2B", which is a component of the U2 snRNP complex. Its precise role in pre-mRNA splicing is still unknown. It has been suggested that U2B0 may not be required for the splicing reaction itself but may have a role in U2 snRNP biogenesis. Deletion analysis of the U2B0 gene fusion has identified the N-terminal RNP-80 motif as sufficient for localization to the coiled body and the nucleus. |
AT5G09585 | U2;(source:Araport11) |
AT5G54075 | U3 small nucleolar RNA |
AT4G10970 | UAP56-interacting factor1, binds single stranded RNA and, along with UIEF2,,appears to play a role in nuclear export of RNA. |
AT4G05050 | polyubiquitin gene, belongs to a subtype group with UBQ10 and UBQ14. Various ecotypes of Arabidopsis have different numbers of ubiquitin repeats within this gene. |
AT3G62250 | ubiquitin 5;(source:Araport11) |
AT2G47110 | polyubiquitin gene The mRNA is cell-to-cell mobile. |
AT3G09790 | encodes a ubiquitin-like protein that contains tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. |
AT1G77700 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT3G46460 | May function together with UBC7 and UBC14 in the plant READ pathway, required in plant responses to multiple stress conditions. |
AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
AT5G42990 | ubiquitin-conjugating enzyme 18;(source:Araport11) |
AT5G62540 | Encodes a protein predicted to be an E2 ubiquitin conjugating enzyme. It appears homologous to the RAD6 protein in yeast implicated in histone ubiquitination, but, UBC3 has not been experimentally associated with this process. |
AT3G17000 | Group XIV ubiquitin-conjugating enzyme that functions negative regulation of drought stress. |
AT1G16890 | UBC36/UBC13B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair. It can bind to the MMZ/UEV1 proteins in vitro. |
AT1G63800 | ubiquitin-conjugating enzyme 5;(source:Araport11) |
AT2G46030 | Ubiquitin conjugating enzyme E2 |
AT3G20060 | Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in dividing cells, but also in other non-dividing cells. Protein is localized to the cytoplasm as well as to the nucleus. |
AT5G02880 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile. |
AT4G10590 | encodes a member of the ubiquitin-specific protease family, UBP10 |
AT5G06600 | Encodes a ubiquitin-specific protease which together with UBP13 deubiquitinates DA1, DAR1 and DAR2, hence reducing their peptidase activity. Works upstream of DA1, DAR1 and DAR2 to restrict their protease activity and hence fine-tune plant growth and development. |
AT3G11910 | Ubiquitin-specific protease, which together with UBP12 deubiquitinates DA1, DAR1 and DAR2, hence reducing their peptidase activity. Works upstream of DA1, DAR1 and DAR2 to restrict their protease activity and hence fine-tune plant growth and development. |
AT3G20630 | Encodes a ubiquitin-specific protease. Identical to TTN6. Loss of function mutations are embryo lethals, having development arrested at the preglobular/globular stage. Also involved in root responses to phosphate deficiency. |
AT1G17110 | Encodes a ubiquitin-specific protease, and its activity has been confirmed in an in vitro assay. ubp15 mutants have defects in cell proliferation, and the associated processes of leaf, root, stem, flower, and silique development. UBP15 can be found in the nucleus and cytoplasm in transient assays. Though UBP15 is expressed in many tissues, UBP15 transcript levels are higher in rosette leaves and inflorescences than in other parts of the plant. Together with CUC2/CUC3-DA1 part of a regulatory module controls the initiation of axillary meristems, thereby determining plant architecture. As a direct substrate of DA1 peptidase, it represses the initiation of axillary meristems. |
AT5G65450 | Encodes a ubiquitin-specific protease. The mRNA is cell-to-cell mobile. |
AT4G17895 | Encodes a ubiquitin-specific protease. |
AT4G30890 | Encodes a ubiquitin-specific protease. |
AT4G39370 | Encodes a ubiquitin-specific protease. |
AT4G39910 | Encodes a nuclear ubiquitin-specific protease. |
AT1G51710 | Ubiquitin-specific protease 6 (UBP6). Deubiquinating enzyme. Interacts with calmodulin. |
AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
AT5G03490 | Encodes a dihydroxybenzoic acid (DHBA) glycosyltransferase. The Col-0 enzyme is responsible for biosynthesis of 2,3-DHBA xyloside and 2,5-DHBA xyloside. The Col-0 enzyme is specific for UDP-xylose and the C24 enzyme uses both UDP-glucose and UDP-xylose. This difference in sugar donor specificity was shown to be largely due to a single amino acid change between the two isoforms. |
AT2G27860 | Encodes UDP-d-apiose/UDP-d-xylose synthase that requires NAD+ for enzymatic activity and is strongly inhibited by UDP-d-galacturonate. |
AT1G08200 | Encodes a putative UDP-D-apiose/UPD-D-xylose synthetase. |
AT1G12780 | Encodes a UDP-glucose epimerase that catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-galactose via a UDP-4-keto-hexose intermediate. Responsive to stress. |
AT4G23920 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in growth and cell wall carbohydrate biosynthesis. |
AT1G63180 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development. |
AT4G10960 | Encodes a protein with UDP-D-glucose 4-epimerase activity. |
AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
AT2G45310 | UDP-D-glucuronate 4-epimerase |
AT4G12250 | UDP-D-glucuronate 4-epimerase |
AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
AT3G11340 | Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid. |
AT1G14360 | UDP-galactose transporter 3;(source:Araport11) |
AT3G59360 | UDP-galactose transporter 6;(source:Araport11) |
AT4G32272 | Golgi-localized nucleotide sugar (UDP-GlcNAc) transporter that delivers an essential substrate for the maturation of N-glycans and the GIPC class of sphingolipids. |
AT1G26570 | UDP-glucose dehydrogenase 1;(source:Araport11) |
AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
AT3G21750 | Encodes a glucosyltransferase that can attach glucose to a number of hydroxylated phenolic compounds as well as quercetins in vitro |
AT3G21780 | Encodes a protein with UDP-glucosyl transferase activity that was shown to preferentially glucosylates abscisic acid (ABA), and not its catabolites. Moreover, UGT71B6 was shown to have a strict preference for the naturally-occurring ABA enantiomer, (+)-ABA, and not its 'unnatural' relative, (-)-ABA. This is in contrast to the other identified UGT genes catalyzing the glucosylation of ABA which were shown to accept both stereoisomers as substrates. |
AT2G29740 | UDP-glucosyl transferase 71C2;(source:Araport11) |
AT1G07250 | UDP-glucosyl transferase 71C4;(source:Araport11) |
AT1G07240 | Encodes a UDP-glucosyltransferase that plays a role in abscisic acid (ABA) glucosylation from ABA to ABA-glucose ester and regulates ABA homeostasis, thereby influencing the ABA signal network. |
AT2G29730 | UDP-glucosyl transferase 71D1;(source:Araport11) |
AT1G01420 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT3G50740 | UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism. |
AT4G34138 | UDP-glucosyl transferase 73B1;(source:Araport11) |
AT4G34131 | UDP-glucosyl transferase 73B3;(source:Araport11) |
AT2G36760 | UDP-glucosyl transferase 73C2;(source:Araport11) |
AT2G36790 | The At2g36790 gene encodes a UDP-glucose:flavonol-3-O-glycoside-7-O-glucosyltransferase (UGT73C6)attaching a glucosyl residue to the 7-O-position of the flavonols kaempferol, quercetin and their 3-O-glycoside derivatives. |
AT2G31750 | Encodes an auxin glycosyltransferase that is likely to be involved in regulation of auxin by glycosylation. |
AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
AT5G05860 | Encodes a cytokinin N-glucosyltransferase that is involved in cytokinin homeostasis and cytokinin response in planta through cytokinin N-glucosylation. Expression is induced by ABA, mannitol and drought stress. Analysis of overexpressors and loss of function mutants indicate a role in response to osmotic and drought stress. |
AT5G05880 | Encodes a nicotinate-N-glycosyltransferase. |
AT5G59580 | UDP-glucosyl transferase 76E1;(source:Araport11) |
AT3G46670 | UDP-glucosyl transferase 76E11;(source:Araport11) |
AT5G59590 | UDP-glucosyl transferase 76E2;(source:Araport11) |
AT1G22360 | UDP-glucosyl transferase 85A2;(source:Araport11) |
AT1G22380 | Encodes a putative UDP-glucosyl transferase. At1g22380 was initially identified as encoding the protein AAF87154, which has been classified as a bHLH protein (AtbHLH152). Subsequently it has been found that the AAF87154 protein appears to be encoded by the AT1G23970 genomic locus. |
AT1G78270 | UDP-glucosyl transferase 85A4;(source:Araport11) |
AT1G22370 | UDP-glucosyl transferase 85A5;(source:Araport11) |
AT2G30140 | Encodes a putative glycosyltransferase. Regulates flowering time via FLOWERING LOCUS C. |
AT3G16520 | UDP-glucosyl transferase 88A1;(source:Araport11) |
AT1G73880 | UDP-glucosyl transferase 89B1;(source:Araport11) |
AT4G34135 | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position. |
AT2G43820 | Encodes a nicotinate-O-glycosyltransferase. Induced by Salicylic acid, virus, fungus and bacteria. Also involved in the tryptophan synthesis pathway. Independent of NPR1 for their induction by salicylic acid. UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside (SAG) and a glucose ester (SGE)), benzoic acid, and anthranilate in vitro. UGT74F2 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. |
AT1G05560 | A UDP-glucose transferase localized in the phragmoplast. It has been co-purified with the callose synthase complex and may transfer UDP-glucose from sucrose synthase to the callose synthase and thus help form a substrate channel for the synthesis of callose at the forming cell plate. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. UGT1 encodes a protein with glucosyltransferase activity with high sequence homology to UGT2 (AT1G05530). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT1 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. UGT1/UGT75B1 catalyzes the formation of the p-aminobenzoate-glucose ester in vitro and in vivo. It appears to be the enzyme predominantly responsible for pABA-Glc formation in Arabidopsis based on assays in leaves, flowers, and siliques. |
AT3G53520 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
AT5G59290 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
AT5G49690 | UDP-glycosyltransferase that can act upon sulcotrione herbicide. Overexpression confers resistance to herbicide. |
AT5G52560 | Encodes a protein with UTP:sugar 1-phosphate uridylyltransferase activity, which has been shown to use a wide range of substrates including glucose-1-P, galactose-1-P, xylose-1-P, arabinose-1-P and glucuronate-1-P. The enzyme was shown to require Mg2+ or Mn2+ for activity. Mutations in USP can lead to a complete loss of male fertility. |
AT2G47650 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. UDP-glucuronic acid decarboxylase produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
AT2G28315 | UXT1 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and ER. UXT1 functions as a UDP-Xyl transporter. The mRNA is cell-to-cell mobile. |
AT5G11230 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT4G37180 | UIF1 is a nuclear and cytoplasmically localized myb-domain containing member of the GARP G2-like subfamily of transcription factors. Interacts with ULT1 and binds to the WUS promoter. UIF1 binding domains are also found in CUC and AG promoters suggesting they are also direct targets. This locus was also identified as a putative cytoskeletal protein in a yeast screen. |
AT2G20825 | Developmental regulator, ULTRAPETALA;(source:Araport11) |
AT4G28190 | Encodes a novel Cys-rich protein with a B-box like domain that acts as a negative regulator of meristem cell accumulation in inflorescence and floral meristems as loss-of-function ult1 mutations cause inflorescence meristem enlargement, the production of extra flowers and floral organs, and a decrease in floral meristem determinacy. Acts opposite to CLF which represses AG, but preventing deposition of CLF repressive methylation marks.ULT1 acts as an anti-repressor that counteracts EMF1 action through modulation of histone marks on target genes. Regulates developmental as well as biotic and abiotic stress response genes. |
AT1G33430 | UPEX1 is arabinogalactan b-(1,3)-galactosyltransferase involved in the formation of pollen exine. Belongs to GT31 family. Mutants have reduced levels of AGPs. GALT8 has some but not complete functional overlap with KNS4/UPEX1. |
AT1G29300 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
AT4G00080 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G13640 | Homeodomain-like superfamily protein;(source:Araport11) |
AT2G47470 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. The mRNA is cell-to-cell mobile. |
AT3G03340 | LUC7 related protein;(source:Araport11) |
AT3G03690 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT4G02030 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. |
AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT3G53990 | Encodes universal stress protein (USP). Functions as a molecular chaperone under heat shock and oxidative stress conditions. Chaperone activity and assembly into complexes is redox regulated. |
AT1G16730 | hypothetical protein;(source:Araport11) |
AT2G20100 | Together with PFA1 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT5G43580 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Functions in resistance to necrotrophic fungi and insect herbivory. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
AT1G29120 | Hydrolase-like protein family;(source:Araport11) |
AT1G26440 | Encodes a ureide permease, uptake assays in yeast mutants indicated the longer splice variant is a cellular importer for allantoin, uracil and xanthine. Encodes 2 splice variants, UPS5L and UPS5S, which under nonstress conditions may function in allantoin degradation for nutrient recycling, whereas under stress, both genes may be involved in vesicular export allowing allantoin translocation from roots to shoots. |
AT1G05680 | Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. |
AT3G27190 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
AT1G55810 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
AT3G27440 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
AT1G05620 | Encodes a cytosolic inosine nucleoside hydrolase. It forms a heterocomplex with NSH1 with almost two orders of magnitude higher catalytic efficiency for xanthosine hydrolysis than observed for NSH1 alone. Transcript levels for this gene are elevated in older leaves suggesting that it may play a role in purine catabolism during senescence. |
AT3G56620 | nodulin MtN21-like transporter family protein |
AT2G37460 | nodulin MtN21-like transporter family protein |
AT2G37450 | nodulin MtN21-like transporter family protein |
AT2G39510 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
AT4G08300 | nodulin MtN21-like transporter family protein |
AT1G25270 | nodulin MtN21-like transporter family protein |
AT1G09380 | nodulin MtN21-like transporter family protein |
AT1G01070 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
AT4G28040 | nodulin MtN21-like transporter family protein |
AT4G15540 | nodulin MtN21-like transporter family protein The mRNA is cell-to-cell mobile. |
AT5G40240 | nodulin MtN21-like transporter family protein |
AT3G28050 | nodulin MtN21-like transporter family protein |
AT3G28060 | nodulin MtN21-like transporter family protein |
AT3G28130 | nodulin MtN21-like transporter family protein |
AT3G28100 | nodulin MtN21-like transporter family protein The mRNA is cell-to-cell mobile. |
AT3G28070 | nodulin MtN21-like transporter family protein |
AT3G28080 | nodulin MtN21-like transporter family protein |
AT2G45620 | Nucleotidyltransferase family protein involved in transcript polyadenylation. TUTase which connects decapping activators and prevents the accumulation of excessively deadenylated mRNAs to avoid siRNA biogenesis. |
AT5G59920 | Isolated in a screen for UV-B insensitive mutants using a hypocotyl growth inhibition assay. Mutants are defective in a number of UV-B responses. |
AT2G42260 | Encodes a novel plant-specific protein of unknown function. The UVI4 gene is expressed mainly in actively dividing cells. The hypocotyl cells in mutant seedlings undergo one extra round of endoreduplication. The uvi4 mutation also promoted the progression of endo-reduplication during leaf development. |
AT1G20260 | One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. The mRNA is cell-to-cell mobile. |
AT4G11150 | Encodes a vacuolar H+-ATPase subunit E isoform 1 which is required for Golgi organization and vacuole function in embryogenesis. The mRNA is cell-to-cell mobile. |
AT1G64200 | vacuolar H+-ATPase subunit E isoform 3;(source:Araport11) |
AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
AT1G21140 | The gene encodes nodulin-like1 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
AT1G63010 | Encodes an SPX domain protein that transports Pi into the vacuole and is essential for phosphate homeostasis. |
AT4G29380 | The gene encodes phosphatidylinositol 3- kinase involved in the development and germination of pollen through the biosynthesis of phosphatidylinositol 3-phosphate (PI3P). The mRNA is cell-to-cell mobile. |
AT1G08190 | Might be involved in protein sorting to the vacuole. The mRNA is cell-to-cell mobile. |
AT1G17730 | Encodes an ESCRT-related protein: CHMP1A/AT1G73030; CHMP1B/AT1G17730. CHMP1A and B mediate multivesicular body sorting of auxin carriers and are required for plant development. ESCRT: Endosomal Sorting Complexes Required For Transport machinery; CHMP: Charged Multivesicular Body Protein/Chromatin Modifying Protein. |
AT1G03950 | vacuolar protein sorting-associated protein 2.3;(source:Araport11) |
AT4G21560 | vacuolar protein sorting-associated protein-like protein;(source:Araport11) |
AT4G39080 | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. The mRNA is cell-to-cell mobile. |
AT2G32760 | Homolog of yeast VPS38P. Interacts with PI3K.Mutants have defects in late endosome morphology and retromer function. |
AT2G34940 | VACUOLAR SORTING RECEPTOR 5;(source:Araport11) |
AT4G20110 | VACUOLAR SORTING RECEPTOR 7;(source:Araport11) |
AT4G38920 | vacuolar-type H[+]-ATPase C3;(source:Araport11) |
AT5G42270 | VAR1 contains a conserved motif for ATPase and a metalloprotease characteristic to FtsH proteins, and is targeted into chloroplasts. A VAR1-fusion protein synthesized in vitro exhibited ATPase activity and partial metalloprotease activity. This protein is located to the thylakoid membrane and forms a complex with VAR2. FtsH1 (VAR1) and FtsH5 are interchangeable in thylakoid membranes. Phosphorylation of this protein is dependent on calcium. The mRNA is cell-to-cell mobile. |
AT1G02120 | Encodes VAD1 (Vascular Associated Death1), a regulator of cell death and defense responses in vascular tissues. VAD1 is a putative membrane associated protein and contains a GRAM domain. vad1 is a lesion mimic mutant that exhibits light conditional appearance of propagative HR (hypersensitive response)-like lesions along the vascular system. The mRNA is cell-to-cell mobile. |
AT1G28520 | VOZ transcription factor which acts as positive regulator of several salt-responsive genes. Functionally redundant in salt stress with VOZ2. |
AT1G79620 | VRLK1 is a LRR kinase involved in switching between cell elongation and secondary cell wall thickening.VRLK1 is a member of a gene family that includes a small number of recently duplicated paralogs. |
AT3G21710 | transmembrane protein;(source:Araport11) |
AT2G45870 | Encodes a bestrophin-like protein (Best2). Minor isoform (10% transcript of AtBest1). Putative chloride ion channel. Proposed to modulate proton motive force partitioning by mediating chloride ion influx in the thylakoid lumen. |
AT4G24220 | encodes a progesterone-5beta-reductase-like protein. It has enone reductase activity against a wide range of substrates, including 3-oxo-Δ-4,5-steroids in vitro. The in vivo substrates and product of this enzyme have not yet been elucidated but it is likely to participate in steroid metabolism. The protein contains a mammalian death domain involved in programmed cell death. The gene is expressed in the vascular system and mutants carrying a dominant mutation in the gene have defective vascular patterning. VEP1 gene expression is induced specifically by wounding. |
AT5G40270 | VEN4 is homologous to human SAMHD1 and functions in chloroplast biogenesis. |
AT5G61150 | Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. Member of PAF-C complex. |
AT1G61040 | Encodes a yeast Paf1C subunit homolog required for the expression of the MADS box gene FLC and other members of the FLC/MAF MADS-box gene family. Member of PAF-C complex. |
AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
AT2G18870 | vernalization5/VIN3-like protein;(source:Araport11) |
AT3G05270 | Encodes a protein that localizes at motile vesicle-like small compartments in differentiating xylem cells that is associated with microtubule plus-ends. VETH-positive compartments are unlikely to be elements in conventional endomembrane trafficking pathways. It can associate with COG2, and together these two proteins co-localize with the EXO70A1 exocyst subunit, tethering EXO70A1 to compartments associated with cortical microtubules. |
AT1G77580 | filament-like protein (DUF869);(source:Araport11) |
AT4G32150 | AtVAMP711 is a member of Synaptobrevin-like AtVAMP7C, v-SNARE (soluble N-ethyl-maleimide sensitive factor attachment protein receptors) protein family. SNAREs have been divided into four subgroups: Qa-, Qb-, Qc- and R-SNAREs. R-SNAREs are classified into three groups, the Sec22-, YKT6- and VAMP7-like R-SNAREs. One R-SNARE and three Q-SNAREs (one of each subgroup) form the trans-SNARE complex, which governs specific membrane fusions. VAMP7 proteins consist of three distinct domain, the N-terminal longin-domain (LD), the SNARE motif (SNM) and a transmembrane domain. In spite of the high similarities among the VAMP7 proteins, they show different subcellular localizations. VAMP7C is vacuolar-localized and its LD is essential for the correct localization. Generally, it is suggested that the complete LD is the determinant of subcellular sorting in both animal and plant R-SNAREs. |
AT5G22360 | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family. |
AT1G14000 | Encodes a protein with similarity to members of the C1 subgroup of MAP kinase kinase kinases. Interacts physically with the receptor kinase BRL2/VH1 and appears to be involved in auxin and brassinosteriod signaling. The mRNA is cell-to-cell mobile. |
AT2G41740 | Encodes a protein with high homology to animal villin. |
AT3G57410 | Encodes a protein with high homology to animal villin. VLN3 is a Ca2+-regulated villin involved in actin filament bundling. |
AT4G23630 | VIRB2-interacting protein 1;(source:Araport11) |
AT4G11220 | VIRB2-interacting protein 2;(source:Araport11) |
AT5G41600 | VIRB2-interacting protein 3;(source:Araport11) |
AT5G59710 | Encodes a nuclear-localized NOT (negative on TATA-less) domain-containing protein that interacts with the Agrobacterium VirE2 protein and is required for Agrobacterium-mediated plant transformation. It likely facilitates T-DNA integration into plant chromosomes and may play a role as a transcriptional regulator. The mRNA is cell-to-cell mobile. |
AT5G28040 | Member of the GeBP/GPL family of leucine zipper transcription factors. VPF4 interacts with the F-box proteins from A.tumefaciens VirF and VBF. Over expression results in decreased tumor formation upon Agrobacterium infection. Mutants show changes in the level of expression of defense response genes. |
AT4G26850 | Encodes a novel protein involved in ascorbate biosynthesis, which was shown to catalyze the transfer of GMP from GDP-galactose to a variety of hexose-1-phosphate acceptors. Recessive mutation has a reduced amount of vitamin C, lower level of non-photochemical quenching, and reduced rate of conversion of violaxanthin to zeaxanthin in high light. |
AT5G55120 | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
AT4G32770 | Tocopherol cyclase involved in tocopherol (vitamin E)synthesis. VTE1 over-expressing plants have increased tocopherol indicating VTE1 is a major limiting factor in tocopherol synthesis. Mutants defective in this gene accumulate high amounts of zeaxanthin in conditions of high light or low temperature. Plays a role in the adaptation to low temperature stress, notably phloem loading. |
AT1G78620 | integral membrane protein (Protein of unknown function DUF92, transmembrane);(source:Araport11) |
AT5G04490 | Encodes a protein with phytol kinase activity involved in tocopherol biosynthesis. |
AT3G01280 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile. |
AT5G67500 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile. |
AT5G57490 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
AT3G49920 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
AT4G21550 | VP1/ABI3-like 3;(source:Araport11) |
AT1G78310 | VQ motif-containing protein;(source:Araport11) |
AT1G21230 | encodes a wall-associated kinase The mRNA is cell-to-cell mobile. |
AT1G16120 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16130 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16140 | Encodes a predicted WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16150 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile. |
AT1G16110 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall. |
AT1G16090 | Encodes a truncated WAK-like kinase that is predicted to be a secreted protein. |
AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
AT1G72290 | Encodes a Kunitz-protease inhibitor, a water-soluble chlorophyll protein involved in herbivore resistance activation. |
AT5G65683 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT5G28646 | Encodes a novel protein. The wvd2 gain-of-function mutant has impaired cell expansion and root waving, and changed root skewing. |
AT3G23090 | Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark, |
AT4G32330 | WDL5 is an target of EIN3 that co-localizes with cortical microtubles. It its thought to function to stabilize microtubles during ethylene induced hypocotyl elongation. |
AT2G35880 | Microtubule-stabilizing protein. |
AT5G06690 | Encodes a thioredoxin (WCRKC1) localized in chloroplast stroma. Contains a WCRKC motif. Functions in redox cascade with 2CPA and 2CPB via the ferredoxin-thioredoxin reductase (FTR)/thioredoxin (Trx) pathway to mediate the light-responsive reductive control of target proteins. Oxidizes redox-regulated proteins. |
AT5G54200 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G07760 | Ortholog of Peach WEEP gene containing a sterile alpha motif. In peach, WEEP is responsible for pendulous branching phenotype. However in Arabidopsis no morphological branching defect has been observed in mutant lines. |
AT3G20880 | WIP4 is a paralog of NTT and along with WIP5,acts redundantly in cell fate determination during primary root development. MP binds to AuxRE motifs within the WIP4 gene and likely regulates its expression. |
AT3G04910 | Serine/threonine protein kinase, whose transcription is regulated by circadian rhythm. |
AT5G58350 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
AT3G51630 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
AT2G01830 | Histidine kinase: cytokinin-binding receptor that transduces cytokinin signals across the plasma membrane |
AT4G28240 | Member of the wound-induced polypeptide (WIP) family. Positively regulates plant resistance against Pst DC3000 by enhancing PTI responses. |
AT4G05070 | Member of the wound-induced polypeptide (WIP) family. Positively regulates plant resistance against Pst DC3000 by enhancing PTI responses. |
AT4G10265 | Member of the wound-induced polypeptide (WIP) family. |
AT4G10270 | Member of the wound-induced polypeptide (WIP) family. |
AT4G33560 | Member of the wound-induced polypeptide (WIP) family. |
AT5G11390 | Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells. |
AT3G54320 | WRINKLED1 encodes transcription factor of the AP2/ERWEBP class. Protein has two plant-specific (AP2/EREB) DNA-binding domains and is involved in the control of storage compound biosynthesis in Arabidopsis. Mutants have wrinkled seed phenotype, due to a defect in the incorporation of sucrose and glucose into triacylglycerols. Transgenic sGsL plants (21-day-old) grown on 6% sucrose for 24 hours had 2-fold increase in levels of expressions (sGsL line carries a single copy of T-DNA containing the Spomin::GUS-Spomin::LUC dual reporter genes in the upper arm of chromosome 5 of ecotype Col-0. The sporamin .minimal. promoter directs sugar-inducible expression of the LUC and GUS reporters in leaves). Regulation by LEC2 promotes fatty acid accumulation during seed maturation. Splice form 3 is the major form expressed in seedlings.Mutations in the C terminal intrinsically disordered region increase the stability of WRI1 and lead to increased oil production. |
AT1G79700 | WRI4 encodes an AP2/ERF-type transcriptional activator that specifically controls cuticular wax biosynthesis in Arabidopsis stems. It also functions to activate transcription of genes involved fatty acid biosynthesis during seed and flower development as well as stem wax biosynthesis. Targets identified by ChIP-seq include: LACS1, KCR1, PAS2, ECR, and WSD1. |
AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
AT1G30650 | member of WRKY Transcription Factor; Group II-e |
AT2G23320 | Encodes WRKY DNA-binding protein 15 (WRKY15). |
AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
AT4G31800 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Constitutive expression of WRKY18 enhanced resistance to P. syringae, but its coexpression with WRKY40 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
AT2G30590 | Encodes WRKY DNA-binding protein 21 (WRKY21). |
AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
AT5G07100 | Encodes WRKY DNA-binding protein 26 (WRKY26). |
AT5G52830 | Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum. |
AT4G18170 | Member of WRKY Transcription Factor; Group II-c. Involved in the activation of salicylic acid biosynthesis genes ICS1 and PBS3. In the ovule, it is expressed in hypodermal somatic cells and appears to play a role in supression of megasporocyte cell fate. In the leaf if is upstream of FHY3 and regulates light-mediated leaf senescence. |
AT4G30935 | member of WRKY Transcription Factor; Group I |
AT2G38470 | Member of the plant WRKY transcription factor family. Regulates the antagonistic relationship between defense pathways mediating responses to P. syringae and necrotrophic fungal pathogens. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. Regulates cytochrome P450 gene CYP94B1 to control apoplastic barrier formation in roots to confer salt tolerance. |
AT3G04670 | member of WRKY Transcription Factor; Group II-d |
AT1G13960 | Encodes WRKY DNA-binding protein 4 (WRKY4). |
AT1G80840 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Coexpression with WRKY18 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
AT3G01970 | member of WRKY Transcription Factor; Group I |
AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
AT2G40750 | member of WRKY Transcription Factor; Group III. Together with WRKY70 positively regulates SARD1 and CBP60g expression in plant immunity. |
AT1G69310 | Encodes WRKY57, a member of the WRKY Transcription Factor. Activation of WRKY57 confers drought tolerance. |
AT3G58710 | member of WRKY Transcription Factor; Group II-e |
AT4G24240 | Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family. |
AT3G56400 | Member of WRKY Transcription Factor; Group III. Function as activator of SA-dependent defense genes and a repressor of JA-regulated genes. WRKY70-controlled suppression of JA-signaling is partly executed by NPR1. |
AT5G13080 | WRKY75 is one of several transcription factors induced during Pi deprivation. It is nuclear localized and regulated differentially during Pi starvation. RNAi mediated suppression of WRKY75 made the plants more susceptible to Pi stress as indicated by the higher accumulation of anthocyanin during Pi starvation. |
AT3G49210 | WSD6 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
AT5G12420 | WSD7 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
AT3G15880 | TOPLESS family protein. |
AT3G18010 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Its mRNA is expressed in the initiating vascular primordium of the cotyledons during heart and torpedo stages. |
AT5G59340 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. WOX2 has a putative Zinc finger domain downstream of the homeodomain. Transcripts are expressed in the egg cell, the zygote and the apical cell lineage and are reduced in met3-1 early embryos. This gene is necessary for cell divisions that form the apical embryo domain. |
AT3G04630 | Member of a small gene family which have a KLEEK domain which may be involved in protein- protein interactions. Over expression of WDL1 results in abnormal root development. |
AT4G34900 | xanthine dehydrogenase 2;(source:Araport11) |
AT4G34890 | Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance. |
AT2G28840 | Putative E3 Ub protein ligase; regulates thermoresponsive hypocotyl growth through mediating degradation of the thermosensor ELF3. |
AT5G07270 | hypothetical protein;(source:Araport11) |
AT1G09850 | Arabidopsis thaliana papain-like cysteine peptidase |
AT5G33290 | Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis. |
AT5G64080 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G30290 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed throughout both the main and the lateral root, with intensive expression at the dividing and elongating regions. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
AT4G30270 | encodes a protein similar to endo xyloglucan transferase in sequence. It is also very similar to BRU1 in soybean, which is involved in brassinosteroid response. |
AT4G28850 | xyloglucan endotransglucosylase/hydrolase 26;(source:Araport11) |
AT1G32170 | xyloglucan endotransglycosylase-related protein (XTR4) The mRNA is cell-to-cell mobile. |
AT3G44990 | Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1).Enzyme kinetic analysis indicates predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207). |
AT2G36870 | Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1). By sequence similarity to XTH31 (At3g44990) and in vivo analysis, likely to exhibit predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207). |
AT2G06850 | endoxyloglucan transferase (EXGT-A1) gene |
AT4G37800 | xyloglucan endotransglucosylase/hydrolase 7;(source:Araport11) |
AT1G11545 | xyloglucan endotransglucosylase/hydrolase 8;(source:Araport11) |
AT4G03210 | Encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers. |
AT4G25810 | xyloglucan endotransglycosylase-related protein (XTR6) |
AT3G62720 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. |
AT2G21370 | Although this gene has a sequence similar to xylulose kinases, several lines of experimental evidence suggest that it does not act on xylulose or deoxy-xylulose. |
AT4G05410 | Encodes a nucleolar protein with seven WD40-repeats that plays a role in embryo sac development and is critical for the correct positioning of the division plane of zygote and the apical cell lineage in Arabidopsis. YAO may act by modulating nucleolar function, such as rRNA biogenesis, during early embryogenesis and gametogenesis. |
AT5G24380 | closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1 |
AT5G53550 | YELLOW STRIPE like 3;(source:Araport11) |
AT3G17650 | Arabidopsis thaliana metal-nicotianamine transporter YSL5 |
AT3G27020 | Arabidopsis thaliana metal-nicotianamine transporter YSL6 |
AT1G65730 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
AT3G51430 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
AT5G08290 | Encodes Dim1 homolog. |
AT2G18840 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
AT4G30260 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
AT5G57360 | Encodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1. |
AT5G59440 | Encodes thymidylate kinase which exists in two isoforms in plants. The longer variant of 263 amino acids with a N-terminal extension that is required for localization to the mitochondrion. The second isoform of 224 residues is localized to the cytoplasm and nucleoplasm. Peak of expression occurs during G1/S phase transition. |
AT3G14890 | Encodes a base excision repair protein that, together with APE2, it plays overlapping roles in the maintenance of epigenome and genome stability in plants. |
AT1G69600 | Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. |
AT5G16540 | Encodes a zinc finger protein. |
AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
AT3G02830 | Encodes a zinc finger protein that binds to PORA mRNA in vivo and recruits the Pfr form of phytochrome to the 5′-UTR of PORA mRNA to regulate translation of the mRNA. |
AT1G66140 | Encodes a zinc finger protein containing only a single zinc finger. |
AT1G10480 | Encodes a zinc finger protein containing only a single zinc finger that acts downstream of ZFP6 in regulating trichome development by integrating GA and cytokinin signaling. |
AT1G67030 | Encodes a novel C2H2 zinc finger protein containing only a single zinc finger which plays a key role in regulating trichome development by integrating GA and cytokinin signaling. The mRNA is cell-to-cell mobile. |
AT2G41940 | Encodes a zinc finger protein containing only a single zinc finger. |
AT5G13740 | Encodes ZIF1 (ZINC-INDUCED FACILITATOR1), a member of the Major Facilitator Superfamily (MFS) of membrane proteins which are found in all organisms and transport a wide range of small, organic molecules. Involved in a mechanism of Zn sequestration, possibly by transport of a Zn ligand or Zn-ligand complex into vacuoles. The mRNA is cell-to-cell mobile. |
AT5G13750 | zinc induced facilitator-like 1;(source:Araport11) |
AT3G43790 | zinc induced facilitator-like 2;(source:Araport11) |
AT3G20870 | ZIP metal ion transporter family;(source:Araport11) |
AT1G10970 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root and shoot. Expression is regulated by copper, but response to copper deficiency is detected only after three weeks of deficiency. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G05300 | member of Fe(II) transporter isolog family |
AT2G46800 | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
AT2G04880 | Encodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1. The mRNA is cell-to-cell mobile. |
AT5G67450 | Encodes zinc-finger protein. mRNA levels are elevated in response to low temperature, cold temperatures and high salt. The protein is localized to the nucleus and acts as a transcriptional repressor. |
AT2G37740 | zinc-finger protein 10;(source:Araport11) |
AT5G43170 | Encodes zinc finger protein. mRNA levels are elevated in response to high salinity and low temperature. The protein is localized to the nucleus and acts as a transcriptional repressor. |
AT2G48020 | Encodes a zinc transporter ZIF2. Expression of ZIF2 is regulated by alternative splicing. |
AT5G65930 | encodes a novel member of the kinesin superfamily of motor proteins. recessive mutations have reduced number of trichome branches. |
AT2G25095 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. Pri-mRNA coordinates for MIR156a (converted to TAIR10 based on PMID19304749): Chr2: 10677064-10673957 (reverse), length: 3108 bp; exon coordinates: exon 1: 10677064 to 10676955, exon 2: 10676613 to 10676366, exon 3: 10674380 to 10674338, exon 4: 10674245 |
AT4G31877 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. Pri-mRNA coordinates for MIR156c (converted to TAIR10 based on PMID19304749): Chr4: 15415873-15413295 (reverse), length: 2580 bp; exon coordinates: exon 1: 15415873 |