AT1G55430 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G12423 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-26 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT5G52272 | pseudogene of ACYB-2/ACYB-1 (cytochrome b reductase) |
AT2G42140 | VQ motif-containing protein;(source:Araport11) |
AT5G52850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G58040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-28 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT3G28412 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-08 P-value blast match to GB:AAC34906 reverse transcriptase (LINE-element) (Forficula auricularia);(source:TAIR10) |
AT1G11850 | transmembrane protein;(source:Araport11) |
AT2G22650 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
AT1G20520 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
AT3G45965 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT5G09430 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G31850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
AT3G02500 | mental retardation GTPase activating protein;(source:Araport11) |
AT2G35380 | Peroxidase superfamily protein;(source:Araport11) |
AT1G12663 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. |
AT4G31960 | hypothetical protein;(source:Araport11) |
AT3G30280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT4G27290 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G21020 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G08740.1);(source:TAIR10) |
AT5G17380 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
AT3G61930 | hypothetical protein;(source:Araport11) |
AT3G54240 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G48230 | Nucleotide/sugar transporter family protein |
AT4G20220 | Reverse transcriptase (RNA-dependent DNA polymerase);(source:Araport11) |
AT5G66950 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT3G10015 | pre-tRNA tRNA-Leu (anticodon: TAA);(source:Araport11, TAIR10) |
AT2G41380 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G43120 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
AT3G58193 | snoRNA;(source:Araport11) |
AT1G70780 | hypothetical protein;(source:Araport11) |
AT5G38610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G24879 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT2G34320 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT1G67240 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.5e-23 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT3G07180 | GPI transamidase component PIG-S-like protein;(source:Araport11) |
AT4G21260 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT2G40230 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G57810 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT1G75050 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT1G51000 | hypothetical protein;(source:Araport11) |
AT5G17590 | Putative membrane lipoprotein;(source:Araport11) |
AT3G51075 | Natural antisense transcript overlaps with AT3G51070;(source:Araport11) |
AT3G13500 | hypothetical protein;(source:Araport11) |
AT5G57080 | transmembrane protein;(source:Araport11) |
AT2G20970 | lipid-binding protein;(source:Araport11) |
AT1G62095 | Pseudogene of AT1G11820; hydrolase, hydrolyzing O-glycosyl compounds |
AT4G36610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G04830 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
AT4G36648 | other_RNA;(source:Araport11) |
AT5G42730 | pseudogene similar to ACT domain-containing protein, similar to F-box family protein |
AT2G37020 | Translin family protein;(source:Araport11) |
AT1G17410 | Nucleoside diphosphate kinase family protein;(source:Araport11) |
AT4G19530 | Encodes a TIR-NB-LRR resistance protein. Transient expression in tobacco induces cell death. |
AT3G63240 | DNAse I-like superfamily protein;(source:Araport11) |
AT3G11500 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT4G23090 | transmembrane protein;(source:Araport11) |
AT1G34046 | Ankyrin-repeat containing protein;(source:Araport11) |
AT1G04680 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G20132 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G55893 | hypothetical protein;(source:Araport11) |
AT4G05540 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G62730 | Major facilitator superfamily protein;(source:Araport11) |
AT5G56061 | Pseudogene of AT5G56050 |
AT1G33020 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G16950 | transmembrane protein;(source:Araport11) |
AT3G54680 | proteophosphoglycan-like protein;(source:Araport11) |
AT1G80130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G56120 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
AT3G52980 | Zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein;(source:Araport11) |
AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G31540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT2G31050 | Cupredoxin superfamily protein;(source:Araport11) |
AT2G27420 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT5G11130 | Exostosin family protein;(source:Araport11) |
AT5G27140 | NOP56-like pre RNA processing ribonucleoprotein;(source:Araport11) |
AT1G13410 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G52130 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT5G28170 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35110.1);(source:TAIR10) |
AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G12270 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G66620 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
AT5G08600 | U3 ribonucleoprotein (Utp) family protein;(source:Araport11) |
AT4G15450 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
AT1G28700 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT3G09550 | Ankyrin repeat family protein;(source:Araport11) |
AT4G33160 | F-box family protein;(source:Araport11) |
AT2G37750 | hypothetical protein;(source:Araport11) |
AT5G11070 | hypothetical protein;(source:Araport11) |
AT2G29010 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G22845 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT1G70820 | phosphoglucomutase, putative / glucose phosphomutase;(source:Araport11) |
AT2G43235 | phosphoribosylformylglycinamidine synthase;(source:Araport11) |
AT3G30160 | transmembrane protein;(source:Araport11) |
AT3G10780 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT1G50020 | tubulin alpha-6 chain;(source:Araport11) |
AT3G16900 | LURP-one-like protein (DUF567);(source:Araport11) |
AT1G27710 | Glycine-rich protein family;(source:Araport11) |
AT2G26720 | Cupredoxin superfamily protein;(source:Araport11) |
AT2G30100 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT3G60180 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G44630 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G19715 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT3G47940 | DNAJ heat shock family protein;(source:Araport11) |
AT5G47229 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G43250 | coiled-coil protein (DUF572);(source:Araport11) |
AT5G06730 | Peroxidase superfamily protein;(source:Araport11) |
AT5G01542 | Natural antisense transcript overlaps with AT5G01540;(source:Araport11) |
AT2G05720 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G26782 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G34360 | MATE efflux family protein;(source:Araport11) |
AT1G80150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G42570 | B-cell receptor-associated 31-like protein;(source:Araport11) |
AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
AT1G28580 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G35860 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G38037.1);(source:TAIR10) |
AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
AT5G37650 | hypothetical protein (DUF577);(source:Araport11) |
AT3G06780 | glycine-rich protein;(source:Araport11) |
AT5G46105 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT1G65920 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT1G04780 | Ankyrin repeat family protein;(source:Araport11) |
AT3G48550 | SHOOT GRAVITROPISM-like protein;(source:Araport11) |
AT2G13460 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-35 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G42434 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.5e-111 P-value blast match to gb|AAL06419.1|AF378075_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
AT5G50130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G05320 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
AT5G10320 | ATP synthase subunit B;(source:Araport11) |
AT2G42180 | cotton fiber protein;(source:Araport11) |
AT3G56230 | BTB/POZ domain-containing protein;(source:Araport11) |
AT4G30240 | Syntaxin/t-SNARE family protein;(source:Araport11) |
AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
AT2G14843 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.5e-35 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
AT1G47495 | hypothetical protein;(source:Araport11) |
AT4G11950 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT2G23148 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G12010 | nuclease;(source:Araport11) |
AT1G43666 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT3G16880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G17650 | Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11) |
AT1G26773 | hypothetical protein;(source:Araport11) |
AT5G44005 | hypothetical protein;(source:Araport11) |
AT5G64160 | plant/protein;(source:Araport11) |
AT4G39795 | hypothetical protein (DUF581);(source:Araport11) |
AT4G16165 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT3G24490 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
AT5G37690 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT3G13940 | DNA binding / DNA-directed RNA polymerase;(source:Araport11) |
AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
AT1G66820 | glycine-rich protein;(source:Araport11) |
AT1G08610 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G15560 | hypothetical protein;(source:Araport11) |
AT5G64550 | loricrin-like protein;(source:Araport11) |
AT3G45790 | Protein kinase superfamily protein;(source:Araport11) |
AT4G16720 | Ribosomal protein L23/L15e family protein;(source:Araport11) |
AT1G23270 | hypothetical protein;(source:Araport11) |
AT1G30930 | F-box family protein;(source:Araport11) |
AT1G54600 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G38870 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G26140 | hypothetical protein;(source:Araport11) |
AT4G33905 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT3G50420 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G46500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT5G59770 | Protein-tyrosine phosphatase-like, PTPLA;(source:Araport11) |
AT1G20460 | NADH-ubiquinone oxidoreductase chain;(source:Araport11) |
AT1G21350 | Thioredoxin superfamily protein;(source:Araport11) |
AT3G24460 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
AT1G27000 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
AT1G78820 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
AT1G60630 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G57887 | transmembrane protein;(source:Araport11) |
AT4G34670 | Ribosomal protein S3Ae;(source:Araport11) |
AT3G46080 | C2H2-type zinc finger family protein;(source:Araport11) |
AT2G34110 | hypothetical protein;(source:Araport11) |
AT3G06770 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT2G24240 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
AT5G19860 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT1G22060 | sporulation-specific protein;(source:Araport11) |
AT3G62820 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G69480 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT2G36430 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT1G56400 | F-box family protein;(source:Araport11) |
AT5G39480 | F-box family protein;(source:Araport11) |
AT1G52820 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G25690 | stress response NST1-like protein;(source:Araport11) |
AT5G64395 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G55665 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT4G01670 | hypothetical protein;(source:Araport11) |
AT4G10955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G74140 | Rhomboid-related intramembrane serine protease family protein;(source:Araport11) |
AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
AT3G07150 | amino acid-ligase;(source:Araport11) |
AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT4G22530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G10750 | FBD domain family;(source:Araport11) |
AT3G47090 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G23500 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G59453 | B-block-binding subunit of TFIIIC protein;(source:Araport11) |
AT4G28920 | hypothetical protein (DUF626);(source:Araport11) |
AT2G29370 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G29320 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
AT5G05220 | hypothetical protein;(source:Araport11) |
AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
AT3G49307 | Expressed protein;(source:Araport11) |
AT1G09176 | transmembrane protein;(source:Araport11) |
AT4G13070 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
AT2G42860 | hypothetical protein;(source:Araport11) |
AT3G05545 | RING/U-box superfamily protein;(source:Araport11) |
AT2G14840 | pseudogene of phosphoenolpyruvate carboxykinase 1;(source:Araport11) |
AT1G52855 | hypothetical protein;(source:Araport11) |
AT5G52620 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G56270 | RPB1a;(source:Araport11) |
AT2G04590 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-28 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT5G01320 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
AT5G16420 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT3G61840 | auxin response factor, putative (DUF688);(source:Araport11) |
AT2G01010 | rRNA;(source:Araport11) |
AT1G46336 | transmembrane protein;(source:Araport11) |
AT4G08695 | pseudogene of ribosomal protein L2;(source:Araport11) |
AT5G59050 | G patch domain protein;(source:Araport11) |
AT1G31130 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
AT3G51870 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G22040 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G12475 | Encodes a defensin-like (DEFL) family protein. |
AT1G28310 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT1G29600 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT3G10580 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G49470 | transmembrane epididymal protein (DUF716);(source:Araport11) |
AT2G18860 | Syntaxin/t-SNARE family protein;(source:Araport11) |
AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT1G56020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT5G54530 | serine protease, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT1G29110 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT5G48540 | receptor-like protein kinase-related family protein;(source:Araport11) |
AT1G78520 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT3G56880 | VQ motif-containing protein;(source:Araport11) |
AT3G26800 | transmembrane protein;(source:Araport11) |
AT4G01023 | RING/U-box superfamily protein;(source:Araport11) |
AT1G19010 | hypothetical protein;(source:Araport11) |
AT1G57650 | ATP binding protein;(source:Araport11) |
AT2G02400 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G40420 | Encodes a putative amino acid transporter. |
AT3G62180 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G51500 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT3G60040 | F-box family protein;(source:Araport11) |
AT3G51450 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT2G34240 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632);(source:Araport11) |
AT4G20330 | Transcription initiation factor TFIIE, beta subunit;(source:Araport11) |
AT5G10780 | ER membrane protein complex subunit-like protein;(source:Araport11) |
AT5G43590 | Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein;(source:Araport11) |
AT1G48080 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT1G28260 | Telomerase activating protein Est1;(source:Araport11) |
AT3G46750 | low-temperature-induced protein;(source:Araport11) |
AT4G13110 | BSD domain-containing protein;(source:Araport11) |
AT1G25300 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
AT5G43790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G28480 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
AT1G02540 | hypothetical protein;(source:Araport11) |
AT5G66600 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT4G09647 | Encodes a defensin-like (DEFL) family protein. |
AT2G38370 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
AT3G44770 | transmembrane protein, putative (DUF626);(source:Araport11) |
AT3G59270 | FBD-like domain family protein;(source:Araport11) |
AT2G34315 | avirulence induced family protein;(source:Araport11) |
AT2G38995 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT2G34270 | hypothetical protein;(source:Araport11) |
AT1G57660 | Translation protein SH3-like family protein;(source:Araport11) |
AT2G46550 | transmembrane protein;(source:Araport11) |
AT1G62070 | hypothetical protein;(source:Araport11) |
AT1G69030 | BSD domain-containing protein;(source:Araport11) |
AT1G72500 | inter alpha-trypsin inhibitor, heavy chain-like protein;(source:Araport11) |
AT1G14550 | Peroxidase superfamily protein;(source:Araport11) |
AT5G60130 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT5G66220 | Chalcone-flavanone isomerase family protein;(source:Araport11) |
AT1G23910 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT1G34042 | hypothetical protein;(source:Araport11) |
AT1G48070 | Thioredoxin superfamily protein;(source:Araport11) |
AT2G15270 | PRKR-interacting protein;(source:Araport11) |
AT1G73390 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT2G07070 | transposable_element_gene;(source:Araport11) |
AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G06660 | transmembrane/coiled-coil protein (Protein of unknown function DUF106, transmembrane);(source:Araport11) |
AT5G17350 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT1G34100 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
AT3G10250 | histidine-tRNA ligase;(source:Araport11) |
AT2G35480 | envelope glycoprotein;(source:Araport11) |
AT3G42178 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-197 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G19200 | hypothetical protein;(source:Araport11) |
AT5G19970 | GRAS family transcription factor family protein;(source:Araport11) |
AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
AT2G01990 | XRI1-like protein;(source:Araport11) |
AT4G15590 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-50 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G59110 | Protein kinase superfamily protein;(source:Araport11) |
AT3G01202 | Natural antisense transcript overlaps with AT3G01200;(source:Araport11) |
AT1G14950 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT5G05795 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
AT3G54780 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT2G41360 | galactose oxidase/kelch repeat protein;(source:Araport11) |
AT4G16190 | Papain family cysteine protease;(source:Araport11) |
AT1G33700 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
AT1G31090 | F-box family protein;(source:Araport11) |
AT5G02960 | Ribosomal protein S12/S23 family protein;(source:Araport11) |
AT5G23100 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT1G09410 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT2G37670 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G32340 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G54575 | hypothetical protein;(source:Araport11) |
AT3G55890 | Yippee family putative zinc-binding protein;(source:Araport11) |
AT1G05280 | ERV-F (C)1 provirus ancestral Env polyprotein, putative (DUF604);(source:Araport11) |
AT2G33000 | ubiquitin-associated (UBA)/TS-N domain-containing protein-like protein;(source:Araport11) |
AT3G51130 | transmembrane protein;(source:Araport11) |
AT1G58055 | Encodes a defensin-like (DEFL) family protein. |
AT3G15909 | hypothetical protein;(source:Araport11) |
AT4G19450 | Major facilitator superfamily protein;(source:Araport11) |
AT1G72780 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT4G13500 | transmembrane protein;(source:Araport11) |
AT3G16432 | hypothetical protein;(source:Araport11) |
AT1G72800 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G77910 | transmembrane protein;(source:Araport11) |
AT3G50280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G30200 | F-box family protein;(source:Araport11) |
AT5G44730 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G30990 | ARM repeat superfamily protein;(source:Araport11) |
AT2G14460 | hypothetical protein;(source:Araport11) |
AT5G50290 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
AT5G62340 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G57980 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT2G43590 | Chitinase family protein;(source:Araport11) |
AT5G02670 | hypothetical protein;(source:Araport11) |
AT2G30560 | Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. The current predicted structure is not well supported (T8, one *). The predicted proteins can be found in doi.org/10.1007/s00425-005-0174-z |
AT5G37170 | O-methyltransferase family protein;(source:Araport11) |
AT3G15518 | hypothetical protein;(source:Araport11) |
AT3G48745 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
AT3G19900 | hypothetical protein;(source:Araport11) |
AT5G27902 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.3e-51 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT5G07490 | transmembrane protein;(source:Araport11) |
AT2G47330 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G18780 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G60090 | Protein kinase superfamily protein;(source:Araport11) |
AT1G50050 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT3G56250 | hypothetical protein;(source:Araport11) |
AT5G66658 | hypothetical protein;(source:Araport11) |
AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT5G64230 | 1,8-cineole synthase;(source:Araport11) |
AT1G49032 | hypothetical protein;(source:Araport11) |
AT4G01140 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT2G03750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G16565 | threonyl and alanyl tRNA synthetase second additional domain-containing protein;(source:Araport11) |
AT2G47150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G63530 | hypothetical protein;(source:Araport11) |
AT4G11175 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT2G16592 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT3G58877 | hypothetical protein;(source:Araport11) |
AT5G02502 | Oligosaccaryltransferase;(source:Araport11) |
AT3G56270 | WEB family protein (DUF827);(source:Araport11) |
AT4G15270 | glucosyltransferase-like protein;(source:Araport11) |
AT2G27830 | hypothetical protein;(source:Araport11) |
AT5G06278 | pseudogene of abscisic acid-responsive HVA22 family protein |
AT5G60350 | hypothetical protein;(source:Araport11) |
AT1G61440 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT3G11150 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT2G40205 | Ribosomal protein L41 family;(source:Araport11) |
AT2G22890 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
AT2G23230 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
AT3G11590 | golgin family A protein;(source:Araport11) |
AT5G51470 | Auxin-responsive GH3 family protein;(source:Araport11) |
AT3G09510 | Ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G12540 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT3G49150 | F-box/FBD/LRR protein;(source:Araport11) |
AT5G62510 | F-box family protein;(source:Araport11) |
AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT3G05165 | Major facilitator superfamily protein;(source:Araport11) |
AT2G14550 | pseudogene of RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G12461 | hypothetical protein;(source:Araport11) |
AT2G47200 | hypothetical protein;(source:Araport11) |
AT3G50690 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT2G16310 | pseudogene of endoplasmatic reticulum retrieval protein 1B;(source:Araport11) |
AT5G40155 | Encodes a defensin-like (DEFL) family protein. |
AT3G45252 | Encodes a ECA1 gametogenesis related family protein |
AT1G66450 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G03850 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT3G32340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi|2443320|dbj|BAA22288.1| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10) |
AT5G37980 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT5G10946 | hypothetical protein;(source:Araport11) |
AT1G48820 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
AT1G13605 | Encodes a defensin-like (DEFL) family protein. |
AT2G42370 | hypothetical protein;(source:Araport11) |
AT4G34560 | transmembrane protein;(source:Araport11) |
AT3G58310 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
AT1G35143 | transposable_element_gene;(source:Araport11);similar to replication protein-related [Arabidopsis thaliana] (TAIR:AT1G52950.1);(source:TAIR10) |
AT1G46554 | other_RNA;(source:Araport11) |
AT4G33860 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
AT4G39290 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G26390 | Pyruvate kinase family protein;(source:Araport11) |
AT5G18310 | ubiquitin hydrolase;(source:Araport11) |
AT2G29860 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G28695 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT5G56200 | Encodes a transcription factor expressed in the female gametophyte. |
AT1G36500 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 41%25 identity and 8.7e-93 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT4G30150 | Urb2/Npa2 family protein;(source:Araport11) |
AT3G52240 | transcriptional regulator ATRX;(source:Araport11) |
AT2G24550 | major centromere autoantigen B-like protein;(source:Araport11) |
AT5G53680 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G57610 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
AT3G28370 | spindle assembly checkpoint component;(source:Araport11) |
AT4G18930 | RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11) |
AT4G14135 | Pseudogene of AT3G29785 |
AT3G03290 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT1G45229 | transmembrane protein;(source:Araport11) |
AT1G66235 | no-apical-meristem-associated carboxy-terminal domain protein;(source:Araport11) |
AT4G09450 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT2G34290 | Protein kinase superfamily protein;(source:Araport11) |
AT5G03820 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G35820 | 2-oxoglutarate-dependent dioxygenase |
AT3G13070 | CBS domain-containing protein / transporter associated domain-containing protein;(source:Araport11) |
AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
AT5G05800 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT5G54148 | sarcosine dehydrogenase-2C protein;(source:Araport11) |
AT5G19630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G53486 | transmembrane protein;(source:Araport11) |
AT2G38180 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT1G43910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G61290 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT1G16560 | Per1-like family protein;(source:Araport11) |
AT1G34520 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
AT1G52780 | PII, uridylyltransferase (DUF2921);(source:Araport11) |
AT1G62766 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 6.1e-299 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G57010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT1G64830 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G46000 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT3G48450 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
AT5G25425 | glycine-rich protein;(source:Araport11) |
AT5G48790 | LOW PSII ACCUMULATION protein (DUF1995);(source:Araport11) |
AT5G51670 | hypothetical protein (DUF668);(source:Araport11) |
AT3G53270 | Small nuclear RNA activating complex (SNAPc), subunit SNAP43 protein;(source:Araport11) |
AT4G38540 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT5G22190 | hypothetical protein;(source:Araport11) |
AT5G45085 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-148 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
AT5G59460 | scarecrow-like transcription factor 11 (SCL11);(source:Araport11) |
AT1G67130 | F-box family protein;(source:Araport11) |
AT1G67855 | hypothetical protein;(source:Araport11) |
AT4G39860 | hematological/neurological-like protein;(source:Araport11) |
AT3G62650 | hypothetical protein;(source:Araport11) |
AT2G37435 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT4G31470 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT4G31660 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT3G12440 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G04640 | glycine-rich protein;(source:Araport11) |
AT5G49140 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G65875 | pseudogene of AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT1G71240 | chromosome-partitioning protein, putative (DUF639);(source:Araport11) |
AT4G05495 | pseudogene of temperature sensing protein-like protein;(source:Araport11) |
AT3G15480 | fiber (DUF1218);(source:Araport11) |
AT5G56790 | Protein kinase superfamily protein;(source:Araport11) |
AT1G55240 | proteinase inhibitor I4, serpin (DUF716);(source:Araport11) |
AT5G02090 | hypothetical protein;(source:Araport11) |
AT5G41810 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
AT4G28088 | Low temperature and salt responsive protein family;(source:Araport11) |
AT3G23970 | F-box family protein;(source:Araport11) |
AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G12950 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
AT5G45790 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
AT3G59240 | RNI-like superfamily protein;(source:Araport11) |
AT4G05240 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT3G29820 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 23%25 identity and 1.1e-09 P-value to GP|13786450|gb|AAK39575.1|AC025296_10|AC025296 putative reverse transcriptase {Oryza sativa};(source:TAIR10) |
AT4G14620 | hypothetical protein (DUF506);(source:Araport11) |
AT5G37450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G14890 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G48575 | mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11) |
AT3G58020 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G69420 | DHHC-type zinc finger family protein;(source:Araport11) |
AT5G13810 | Glutaredoxin family protein;(source:Araport11) |
AT3G59910 | Ankyrin repeat family protein;(source:Araport11) |
AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
AT3G57440 | hypothetical protein;(source:Araport11) |
AT1G15385 | cotton fiber protein;(source:Araport11) |
AT4G29950 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT2G22930 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G19460 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G34930 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT2G31990 | Exostosin family protein;(source:Araport11) |
AT1G71710 | DNAse I-like superfamily protein;(source:Araport11) |
AT1G55700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G45063 | copper ion binding / electron carrier protein;(source:Araport11) |
AT3G15130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G16560 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-41 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G51980 | ARM repeat superfamily protein;(source:Araport11) |
AT5G10660 | calmodulin-binding protein-like protein;(source:Araport11) |
AT4G04957 | RRM in demeter (DUF1985);(source:Araport11) |
AT2G16670 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-190 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
AT2G22720 | SPT2 chromatin protein;(source:Araport11) |
AT5G13760 | Plasma-membrane choline transporter family protein;(source:Araport11) |
AT1G47705 | pseudogene of F-box/RNI/FBD-like domain protein;(source:Araport11) |
AT3G30740 | pseudogene of Ribosomal protein S25 family protein;(source:Araport11) |
AT3G19615 | beta-1,4-xylosidase;(source:Araport11) |
AT1G62480 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
AT3G10240 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G00975 | Natural antisense transcript overlaps with AT4G00980;(source:Araport11) |
AT4G29103 | transmembrane protein;(source:Araport11) |
AT4G16680 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G48090 | calcium-dependent lipid-binding family protein;(source:Araport11) |
AT5G47310 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
AT5G55960 | transmembrane protein C9orf5 protein;(source:Araport11) |
AT4G34380 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G30970 | hypothetical protein;(source:Araport11) |
AT3G03930 | kinase-like protein;(source:Araport11) |
AT5G37320 | hypothetical protein (DUF674);(source:Araport11) |
AT2G01580 | transmembrane protein;(source:Araport11) |
AT5G26617 | reverse transcriptase-like protein;(source:Araport11) |
AT2G15910 | CSL zinc finger domain-containing protein;(source:Araport11) |
AT4G00090 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G04180 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT4G15955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G01311 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
AT2G19890 | hypothetical protein;(source:Araport11) |
AT5G37340 | ZPR1 zinc-finger domain protein;(source:Araport11) |
AT1G75800 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT3G27090 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
AT1G54890 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
AT1G61430 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT3G43825 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.3e-106 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G46050 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G54290 | Translation initiation factor SUI1 family protein;(source:Araport11) |
AT5G22460 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G17320 | pantothenate kinase;(source:Araport11) |
AT5G01215 | Natural antisense transcript overlaps with AT5G01210;(source:Araport11) |
AT3G44765 | other_RNA;(source:Araport11) |
AT5G51055 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT1G68330 | membrane-associated kinase regulator;(source:Araport11) |
AT3G06270 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G44710 | 37S ribosomal protein S27;(source:Araport11) |
AT1G74290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G41850 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G60450 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT1G07850 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
AT1G16025 | hypothetical protein;(source:Araport11) |
AT2G24592 | hypothetical protein;(source:Araport11) |
AT5G14940 | Major facilitator superfamily protein;(source:Araport11) |
AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G20190 | hypothetical protein;(source:Araport11) |
AT1G16790 | ribosomal protein-like protein;(source:Araport11) |
AT3G59260 | pirin;(source:Araport11) |
AT3G21050 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-18 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT2G25605 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
AT5G54585 | hypothetical protein;(source:Araport11) |
AT2G16520 | RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11) |
AT1G73490 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G48800 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT5G04680 | Ankyrin repeat family protein;(source:Araport11) |
AT5G09560 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT2G14070 | wound-responsive protein-like protein;(source:Araport11) |
AT4G19580 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT1G29090 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT4G37510 | Ribonuclease III family protein;(source:Araport11) |
AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
AT3G04330 | Kunitz family trypsin and protease inhibitor protein;(source:Araport11) |
AT1G62890 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G17200.1);(source:TAIR10) |
AT5G06520 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
AT2G34350 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
AT1G61667 | serine protease, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT5G16920 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
AT3G15770 | hypothetical protein;(source:Araport11) |
AT1G21010 | PADRE proteinup-regulated after infection by S. sclerotiorun. |
AT5G38386 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT2G40350 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
AT4G09965 | hypothetical protein;(source:Araport11) |
AT4G35670 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G43230 | RING/FYVE/PHD-type zinc finger family protein;(source:Araport11) |
AT3G29577 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.0e-133 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G58410 | TRAF-like family protein;(source:Araport11) |
AT3G58210 | TRAF-like family protein;(source:Araport11) |
AT5G41280 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT2G47550 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT2G32050 | cell cycle control-like protein (DUF572);(source:Araport11) |
AT3G46260 | kinase-like protein;(source:Araport11) |
AT5G28463 | transmembrane protein;(source:Araport11) |
AT5G14790 | ARM repeat superfamily protein;(source:Araport11) |
AT4G21580 | oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
AT1G25530 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT1G48060 | F-box/associated interaction domain protein;(source:Araport11) |
AT1G22600 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G01740 | Unknown gene, induced by abiotic stress treatments. |
AT4G10507 | other_RNA;(source:Araport11) |
AT5G22860 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
AT5G13720 | Uncharacterized protein family (UPF0114);(source:Araport11) |
AT5G62900 | PADRE protein down-regulated after infection by S. sclerotiorum. |
AT4G33945 | ARM repeat superfamily protein;(source:Araport11) |
AT5G05250 | hypothetical protein;(source:Araport11) |
AT2G15830 | hypothetical protein;(source:Araport11) |
AT3G44713 | hypothetical protein;(source:Araport11) |
AT1G26950 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT5G33360.1);(source:TAIR10) |
AT1G12380 | hypothetical protein;(source:Araport11) |
AT4G16146 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
AT4G11745 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G54120 | Reticulon family protein;(source:Araport11) |
AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G35030 | Protein kinase superfamily protein;(source:Araport11) |
AT2G40820 | stomatal closure actin-binding-like protein;(source:Araport11) |
AT4G00467 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G49350 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT5G24790 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
AT1G07560 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G21437 | unknown pseudogene |
AT1G14460 | AAA-type ATPase family protein;(source:Araport11) |
AT5G07640 | RING/U-box superfamily protein;(source:Araport11) |
AT3G46186 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT5G24570 | hypothetical protein;(source:Araport11) |
AT5G55420 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
AT1G19200 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
AT3G06778 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT2G20350 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT4G27595 | Encodes a microtubule-associated protein. |
AT3G29000 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT3G22070 | proline-rich family protein;(source:Araport11) |
AT5G07820 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT4G17960 | phospholipid hydroperoxide glutathione peroxidase;(source:Araport11) |
AT5G57700 | BNR/Asp-box repeat family protein;(source:Araport11) |
AT4G20100 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
AT1G44835 | YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein;(source:Araport11) |
AT4G36530 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G28400 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT1G17510 | hypothetical protein;(source:Araport11) |
AT4G09300 | LisH and RanBPM domains containing protein;(source:Araport11) |
AT1G15560 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.8e-130 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G44630 | Encodes a sesquiterpene synthase involved in generating all of the group B sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in intrafloral nectaries. |
AT5G58412 | Encodes a Plant thionin family protein |
AT4G09630 | transmembrane protein (DUF616);(source:Araport11) |
AT1G25370 | hypothetical protein (DUF1639);(source:Araport11) |
AT5G48270 | DUF868 family protein (DUF868);(source:Araport11) |
AT5G37970 | SABATH family methyltransferase. |
AT5G42505 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-23 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT3G51325 | RING/U-box superfamily protein;(source:Araport11) |
AT3G18860 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT1G11070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G47410 | hypothetical protein;(source:Araport11) |
AT2G06060 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.7e-05 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G61700 | helicase with zinc finger protein;(source:Araport11) |
AT1G22065 | hypothetical protein;(source:Araport11) |
AT1G79470 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT2G43960 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
AT5G39490 | F-box family protein;(source:Araport11) |
AT3G32975 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-133 P-value blast match to gb|AAL06422.1|AF378081_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
AT5G35805 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01700.1);(source:TAIR10) |
AT1G51790 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G09505 | pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10) |
AT5G65520 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G39320 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT2G27290 | FAM210B-like protein, putative (DUF1279);(source:Araport11) |
AT4G00895 | ATPase, F1 complex, OSCP/delta subunit protein;(source:Araport11) |
AT2G07687 | Cytochrome c oxidase, subunit III;(source:Araport11) |
AT2G43220 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G40250 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT3G55710 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G48750 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
AT5G45200 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G15860 | defective in cullin neddylation protein (DUF298);(source:Araport11) |
AT5G06940 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
AT5G07800 | Flavin-binding monooxygenase family protein;(source:Araport11) |
AT5G24450 | Transcription factor IIIC, subunit 5;(source:Araport11) |
AT5G17830 | Plasma-membrane choline transporter family protein;(source:Araport11) |
AT5G12340 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT1G71070 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G31000 | F-box/associated interaction domain protein;(source:Araport11) |
AT1G71015 | PADRE protein. |
AT3G26539 | hypothetical protein;(source:Araport11) |
AT5G38190 | myosin heavy chain-like protein;(source:Araport11) |
AT1G72060 | serine-type endopeptidase inhibitor;(source:Araport11) |
AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT1G08125 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G25910 | 3-5 exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein;(source:Araport11) |
AT2G34590 | Transketolase family protein;(source:Araport11) |
AT4G22545 | pseudogene of expressed protein;(source:Araport11) |
AT2G44820 | axoneme-associated protein MST101(2) protein;(source:Araport11) |
AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
AT5G14840 | pseudogene of hypothetical protein;(source:Araport11) |
AT4G11730 | Cation transporter/ E1-E2 ATPase family protein;(source:Araport11) |
AT4G28100 | transmembrane protein;(source:Araport11) |
AT1G68680 | SH3/FCH domain protein;(source:Araport11) |
AT1G30282 | Natural antisense transcript overlaps with AT1G30280;(source:Araport11) |
AT4G15242 | other_RNA;(source:Araport11) |
AT4G26880 | Stigma-specific Stig1 family protein;(source:Araport11) |
AT1G02570 | transmembrane protein;(source:Araport11) |
AT5G60260 | hypothetical protein;(source:Araport11) |
AT2G36835 | hypothetical protein;(source:Araport11) |
AT1G23560 | OBP32pep, putative (DUF220);(source:Araport11) |
AT3G50270 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT2G05812 | Natural antisense transcript overlaps with AT2G05810;(source:Araport11) |
AT5G47150 | YDG/SRA domain-containing protein;(source:Araport11) |
AT1G29240 | transcription initiation factor TFIID subunit, putative (DUF688);(source:Araport11) |
AT1G76580 | Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;(source:Araport11) |
AT3G16070 | LOW protein: ATP-dependent RNA helicase-like protein;(source:Araport11) |
AT2G25740 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
AT1G31430 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT3G49115 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT2G43610 | Chitinase family protein;(source:Araport11) |
AT4G22513 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT1G71480 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
AT5G14450 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G58248 | Encodes a Plant thionin family protein |
AT3G20030 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G19170 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT1G49100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G20980 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
AT3G07270 | GTP cyclohydrolase I;(source:Araport11) |
AT5G62370 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G79970 | hypothetical protein;(source:Araport11) |
AT1G26890 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT4G14345 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
AT5G58990 | 28S ribosomal S34 protein;(source:Araport11) |
AT4G23540 | ARM repeat superfamily protein;(source:Araport11) |
AT5G13225 | snoRNA;(source:Araport11) |
AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G37420 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT5G02970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G61570 | Protein kinase superfamily protein;(source:Araport11) |
AT2G05640 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, low similarity to SP|Q9UUA2 DNA repair and recombination protein pif1, mitochondrial precursor {Schizosaccharomyces pombe};(source:TAIR10) |
AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT3G04140 | Ankyrin repeat family protein;(source:Araport11) |
AT1G51020 | hypothetical protein;(source:Araport11) |
AT3G27500 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G23321 | hypothetical protein;(source:Araport11) |
AT3G24230 | Pectate lyase family protein;(source:Araport11) |
AT1G08230 | Codes for a H+-driven, high affinity gamma-aminobutyric acid (GABA) transporter. Localized at the plasma membrane. In planta, AtGAT1 expression was highest in flowers and under conditions of elevated GABA concentrations such as wounding or senescence. |
AT2G30670 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G14855 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
AT2G04047 | Encodes a defensin-like (DEFL) family protein. |
AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT5G60070 | ankyrin repeat family protein;(source:Araport11) |
AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
AT4G26095 | Natural antisense transcript overlaps with AT4G26090;(source:Araport11) |
AT5G57510 | cotton fiber protein;(source:Araport11) |
AT5G16740 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT1G51035 | hypothetical protein;(source:Araport11) |
AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT4G02320 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT1G76460 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G30030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
AT2G43340 | hypothetical protein (DUF1685);(source:Araport11) |
AT1G47790 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G47530 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G19320 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT2G27720 | 60S acidic ribosomal protein family;(source:Araport11) |
AT3G12050 | Aha1 domain-containing protein;(source:Araport11) |
AT5G23750 | Remorin family protein;(source:Araport11) |
AT5G66560 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G51700 | PIF1 helicase;(source:Araport11) |
AT1G75870 | hypothetical protein;(source:Araport11) |
AT2G44120 | Ribosomal protein L30/L7 family protein;(source:Araport11) |
AT5G56390 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT4G29640 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
AT1G75460 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
AT3G59120 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G23340 | carboxyl-terminal proteinase, putative (DUF239);(source:Araport11) |
AT5G45120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G17680 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
AT2G46420 | helicase with zinc finger protein;(source:Araport11) |
AT4G16220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G10490 | GNAT acetyltransferase (DUF699);(source:Araport11) |
AT1G46840 | F-box family protein;(source:Araport11) |
AT5G01850 | Protein kinase superfamily protein;(source:Araport11) |
AT4G21780 | hypothetical protein;(source:Araport11) |
AT1G26100 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
AT1G52860 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT3G59300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G49520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G28000 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
AT2G37820 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G02910 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT1G35420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G41170 | F-box family protein;(source:Araport11) |
AT1G29810 | Transcriptional coactivator/pterin dehydratase;(source:Araport11) |
AT2G01840 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.6e-34 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G60710 | F-box family protein. |
AT5G14690 | transmembrane protein;(source:Araport11) |
AT4G15040 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT4G28570 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
AT3G60910 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G46360 | transmembrane protein;(source:Araport11) |
AT5G43450 | encodes a protein whose sequence is similar to ACC oxidase |
AT3G04300 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT4G19820 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
AT1G67328 | Natural antisense transcript overlaps with AT1G67330;(source:Araport11) |
AT3G19920 | BTB/POZ domain protein;(source:Araport11) |
AT1G62530 | hypothetical protein (DUF863);(source:Araport11) |
AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G41310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
AT2G34340 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT5G11620 | SWIM zinc finger family protein / mitogen-activated protein kinase kinase kinase (MAPKKK)-like protein;(source:Araport11) |
AT2G04110 | pseudogene of expressed protein;(source:Araport11) |
AT1G42924 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT5G01732 | Natural antisense transcript overlaps with AT5G01730;(source:Araport11) |
AT1G62410 | MIF4G domain-containing protein;(source:Araport11) |
AT2G34655 | hypothetical protein;(source:Araport11) |
AT2G27389 | hypothetical protein;(source:Araport11) |
AT2G36240 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT4G11350 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
AT4G13968 | Encodes a defensin-like (DEFL) family protein. |
AT4G19720 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
AT3G05510 | Phospholipid/glycerol acyltransferase family protein;(source:Araport11) |
AT1G07040 | plant/protein;(source:Araport11) |
AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
AT3G47050 | Glycosyl hydrolase family protein;(source:Araport11) |
AT4G10400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G42980 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
AT4G01000 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT4G10720 | Ankyrin repeat family protein;(source:Araport11) |
AT1G53370 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G05460 | sporozoite surface protein-like protein;(source:Araport11) |
AT5G67411 | GRAS family transcription factor;(source:Araport11) |
AT1G64800 | DNA binding / transcription factor;(source:Araport11) |
AT3G09950 | hypothetical protein;(source:Araport11) |
AT5G37010 | rho GTPase-activating protein;(source:Araport11) |
AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
AT2G18340 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
AT4G31350 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT3G53840 | Protein kinase superfamily protein;(source:Araport11) |
AT5G54130 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
AT2G03240 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT5G47920 | transcription elongation factor;(source:Araport11) |
AT5G65207 | hypothetical protein;(source:Araport11) |
AT5G38310 | hypothetical protein;(source:Araport11) |
AT4G37080 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
AT1G35435 | Encodes a defensin-like (DEFL) family protein. |
AT2G23360 | filament-like protein (DUF869);(source:Araport11) |
AT2G42550 | Protein kinase superfamily protein;(source:Araport11) |
AT3G01410 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G16190 | Isochorismatase family protein;(source:Araport11) |
AT3G41979 | 5.8SrRNA |
AT3G62010 | metal ion-binding protein;(source:Araport11) |
AT1G53815 | F-box family protein;(source:Araport11) |
AT1G61890 | MATE efflux family protein;(source:Araport11) |
AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
AT2G20050 | protein phosphatase 2C and cyclic nucleotide-binding/kinase domain-containing protein;(source:Araport11) |
AT5G26622 | Beta-galactosidase related protein;(source:Araport11) |
AT1G29320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G52450 | MATE efflux family protein;(source:Araport11) |
AT1G35490 | bZIP family transcription factor;(source:Araport11) |
AT1G70880 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT1G80120 | LURP-one-like protein (DUF567);(source:Araport11) |
AT2G14860 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT4G21870 | HSP20-like chaperone |
AT3G29630 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G44020 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT4G00560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G23640 | OBP32pep protein;(source:Araport11) |
AT5G35605 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
AT1G31550 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G15350 | G14 enzyme |
AT1G30921 | pseudogene of F-box family protein;(source:Araport11) |
AT1G34250 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G38590 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G29180 | transmembrane protein;(source:Araport11) |
AT1G43610 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT2G36895 | D-tagatose-1,6-bisphosphate aldolase subunit;(source:Araport11) |
AT5G39910 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G05050 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT3G52920 | transcriptional activator (DUF662);(source:Araport11) |
AT5G63150 | hypothetical protein;(source:Araport11) |
AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G43490 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT5G28237 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
AT1G51030 | hypothetical protein;(source:Araport11) |
AT4G27020 | inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11) |
AT1G31400 | TRAF-like family protein;(source:Araport11) |
AT5G49040 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT1G26450 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT4G17580 | Bax inhibitor-1 family protein;(source:Araport11) |
AT5G43535 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT5G52020 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT3G42713 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT1G63640 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
AT3G20015 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G12900 | DNA double-strand break repair RAD50 ATPase;(source:Araport11) |
AT2G22942 | growth factor;(source:Araport11) |
AT5G60700 | glycosyltransferase family protein 2;(source:Araport11) |
AT5G64110 | Peroxidase superfamily protein;(source:Araport11) |
AT1G68238 | transmembrane protein;(source:Araport11) |
AT1G10400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G32420 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT5G15190 | hypothetical protein;(source:Araport11) |
AT4G28290 | hypothetical protein;(source:Araport11) |
AT1G62650 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G66817 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT3G04010 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G46210 | Ribosomal protein S5 domain 2-like superfamily protein;(source:Araport11) |
AT5G46080 | Protein kinase superfamily protein;(source:Araport11) |
AT3G62640 | DUF3511 domain protein (DUF3511);(source:Araport11) |
AT1G31380 | TRAF-like family protein;(source:Araport11) |
AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT4G27900 | CCT motif family protein;(source:Araport11) |
AT1G77770 | forkhead box protein, putative (DUF1644);(source:Araport11) |
AT2G45530 | RING/U-box superfamily protein;(source:Araport11) |
AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
AT5G43745 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
AT5G37445 | pseudogene of hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G22460 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G00750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G18560 | hypothetical protein;(source:Araport11) |
AT1G11572 | Encodes a Plant thionin family protein |
AT5G67200 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G02465 | hypothetical protein;(source:Araport11) |
AT3G25805 | transmembrane protein;(source:Araport11) |
AT2G04050 | MATE efflux family protein;(source:Araport11) |
AT3G51930 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G19430 | hypothetical protein;(source:Araport11) |
AT4G36245 | pre-tRNA tRNA-Pro (anticodon: CGG);(source:Araport11, TAIR10) |
AT5G35753 | DnaJ heat shock amino-terminal domain protein (DUF3444);(source:Araport11) |
AT2G28680 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G42680 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT1G10640 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G36730 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G15010 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
AT1G12510 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT1G49920 | MuDR family transposase;(source:Araport11) |
AT5G48175 | transmembrane protein;(source:Araport11) |
AT2G04480 | hypothetical protein;(source:Araport11) |
AT2G26030 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G76210 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
AT1G49310 | transmembrane protein;(source:Araport11) |
AT3G06410 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT2G44710 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G21040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.7e-20 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT3G06530 | ARM repeat superfamily protein;(source:Araport11) |
AT2G22760 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G26680 | FkbM family methyltransferase;(source:Araport11) |
AT5G66720 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G17280 | oxidoreductase-like protein, amino-terminal protein;(source:Araport11) |
AT5G19165 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-237 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G69730 | Wall-associated kinase family protein;(source:Araport11) |
AT3G23245 | hypothetical protein;(source:Araport11) |
AT4G39838 | Natural antisense transcript overlaps with AT4G39840;(source:Araport11) |
AT3G53640 | Protein kinase superfamily protein;(source:Araport11) |
AT1G44707 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G76240 | DUF241 domain protein (DUF241);(source:Araport11) |
AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G43830 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT2G27310 | F-box family protein;(source:Araport11) |
AT2G05600 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G14480 | glycine/proline-rich protein;(source:Araport11) |
AT2G28780 | P-hydroxybenzoic acid efflux pump subunit;(source:Araport11) |
AT4G03290 | EF hand calcium-binding protein family;(source:Araport11) |
AT1G70680 | Caleosin-related family protein;(source:Araport11) |
AT4G03030 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G48140 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G15450 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT4G32000 | Protein kinase superfamily protein;(source:Araport11) |
AT4G23930 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT1G51210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G13010 | hAT transposon superfamily protein;(source:Araport11) |
AT3G58820 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G65660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G35610 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT3G57310 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT2G04675 | hypothetical protein;(source:Araport11) |
AT1G51802 | Encodes a defensin-like (DEFL) family protein. |
AT5G37732 | pseudogene of hypothetical protein;(source:Araport11) |
AT3G30520 | heat shock protein;(source:Araport11) |
AT1G53110 | proton pump-interactor;(source:Araport11) |
AT2G25780 | hypothetical protein (DUF1677);(source:Araport11) |
AT3G22133 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAC33226.1 from (Arabidopsis thaliana);(source:TAIR10) |
AT5G54865 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT5G60720 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT4G14743 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT5G35110 | hypothetical protein;(source:Araport11) |
AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G80960 | F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT5G13260 | myosin;(source:Araport11) |
AT1G28660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G23150 | hypothetical protein;(source:Araport11) |
AT1G31960 | hypothetical protein;(source:Araport11) |
AT3G19970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G61420 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G02190 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G16010 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein;(source:Araport11) |
AT3G12981 | pseudogene of F-box family protein |
AT4G13180 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G03410 | Mo25 family protein;(source:Araport11) |
AT3G05130 | paramyosin-like protein;(source:Araport11) |
AT1G34530 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 7.8e-116 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G17080 | Histone H3 K4-specific methyltransferase SET7/9 family protein;(source:Araport11) |
AT2G18560 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT1G55680 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G45638 | other_RNA;(source:Araport11) |
AT1G64140 | WRKY transcription factor;(source:Araport11) |
AT5G39861 | pseudogene of receptor kinase 3;(source:Araport11) |
AT1G65130 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT2G40450 | BTB/POZ domain-containing protein;(source:Araport11) |
AT3G20200 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT2G32430 | Galactosyltransferase family protein;(source:Araport11) |
AT4G32765 | pre-tRNA tRNA-Ser (anticodon: CGA);(source:Araport11, TAIR10) |
AT2G43255 | O-acyltransferase WSD1-like protein;(source:Araport11) |
AT1G14730 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
AT4G14280 | ARM repeat superfamily protein;(source:Araport11) |
AT1G35180 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT3G46570 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT4G19390 | Uncharacterized protein family (UPF0114);(source:Araport11) |
AT5G60710 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT1G50870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G27630 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT4G36000 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT5G11990 | proline-rich family protein;(source:Araport11) |
AT4G27270 | Quinone reductase family protein;(source:Araport11) |
AT3G14452 | transmembrane protein;(source:Araport11) |
AT2G46192 | other_RNA;(source:Araport11) |
AT1G20310 | syringolide-induced protein;(source:Araport11) |
AT1G75090 | DNA glycosylase superfamily protein;(source:Araport11) |
AT2G02370 | SNARE associated Golgi protein family;(source:Araport11) |
AT1G77730 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
AT5G64735 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
AT1G10410 | CW14 protein (DUF1336);(source:Araport11) |
AT2G44670 | senescence-associated family protein (DUF581);(source:Araport11) |
AT1G05675 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G71460 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT4G23530 | ROH1, putative (DUF793);(source:Araport11) |
AT3G26460 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT4G28800 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G61035 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT2G24320 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G30300 | Major facilitator superfamily protein;(source:Araport11) |
AT1G63835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-17 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT2G26355 | Natural antisense transcript overlaps with AT2G26360. The RNA is cell-to-cell mobile. |
AT2G29670 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G29025 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G11660 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT1G11170 | lysine ketoglutarate reductase trans-splicing-like protein (DUF707);(source:Araport11) |
AT4G03965 | RING/U-box superfamily protein;(source:Araport11) |
AT1G09400 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
AT3G23460 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G35980 | hypothetical protein;(source:Araport11) |
AT3G58250 | TRAF-like family protein;(source:Araport11) |
AT3G50123 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G01960 | transmembrane protein;(source:Araport11) |
AT3G28923 | Pseudogene of AT5G01080; beta-galactosidase |
AT2G27090 | bZIP transcription factor (DUF630 and DUF632);(source:Araport11) |
AT1G74010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT5G24210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G48870 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G43883 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.1e-193 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
AT3G56360 | hypothetical protein;(source:Araport11) |
AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G22795 | hypothetical protein;(source:Araport11) |
AT3G10300 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G48510 | BTB/POZ domain-containing protein;(source:Araport11) |
AT5G44470 | ribonuclease H superfamily polynucleotidyl transferase;(source:Araport11) |
AT1G06240 | diiron containing four-helix bundle family ferritin protein, putative (Protein of unknown function DUF455);(source:Araport11) |
AT5G18130 | transmembrane protein;(source:Araport11) |
AT1G17744 | hypothetical protein;(source:Araport11) |
AT1G28020 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G32140 | transmembrane receptor;(source:Araport11) |
AT1G58010 | pseudogene of R-protein L3 B;(source:Araport11) |
AT2G29930 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G38700 | cotton fiber protein;(source:Araport11) |
AT1G49000 | transmembrane protein;(source:Araport11) |
AT1G60783 | cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11) |
AT1G28390 | Protein kinase superfamily protein;(source:Araport11) |
AT2G35470 | ribosome maturation factor;(source:Araport11) |
AT1G63810 | nucleolar protein;(source:Araport11) |
AT4G31890 | ARM repeat superfamily protein;(source:Araport11) |
AT2G03955 | Encodes a defensin-like (DEFL) family protein. |
AT4G12160 | pseudogene of Ribosomal protein S4;(source:Araport11) |
AT1G61400 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G39420 | spatacsin carboxy-terminus protein;(source:Araport11) |
AT1G61200 | homeobox-leucine zipper protein-like protein;(source:Araport11) |
AT5G07630 | lipid transporter;(source:Araport11) |
AT5G66670 | pectinesterase, putative (DUF677);(source:Araport11) |
AT2G12408 | pseudogene of zinc knuckle (CCHC-type) family protein |
AT1G52700 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G65860 | ankyrin repeat family protein;(source:Araport11) |
AT5G13940 | aminopeptidase;(source:Araport11) |
AT1G10740 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G26080 | proline-rich family protein;(source:Araport11) |
AT5G37000 | glycosyltransferase family exostosin protein;(source:Araport11) |
AT5G47970 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT1G57860 | Translation protein SH3-like family protein;(source:Araport11) |
AT4G05380 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
AT3G42150 | transmembrane protein;(source:Araport11) |
AT1G67910 | hypothetical protein;(source:Araport11) |
AT2G13975 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10) |
AT2G14980 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-247 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT4G21192 | Cytochrome c oxidase biogenesis protein Cmc1-like protein;(source:Araport11) |
AT3G15280 | hypothetical protein;(source:Araport11) |
AT3G45730 | hypothetical protein;(source:Araport11) |
AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
AT2G24350 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
AT5G09300 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
AT5G60520 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
AT3G10585 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G77750 | Ribosomal protein S13/S18 family;(source:Araport11) |
AT3G28510 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G65560 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT5G01380 | Homeodomain-like superfamily protein;(source:Araport11) |
AT3G57780 | nucleolar-like protein;(source:Araport11) |
AT3G03000 | Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner |
AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
AT3G62570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G41761 | other_RNA;(source:Araport11) |
AT1G15900 | transmembrane protein;(source:Araport11) |
AT3G45120 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G17900.1);(source:TAIR10) |
AT5G16235 | Natural antisense transcript overlaps with AT5G16230;(source:Araport11) |
AT2G29430 | coiled-coil protein (DUF572);(source:Araport11) |
AT5G44375 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
AT3G58130 | N-acetylglucosaminylphosphatidylinositol de-N-acetylase family protein;(source:Araport11) |
AT1G21220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-26 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT2G31981 | hypothetical protein;(source:Araport11) |
AT2G19460 | DUF3511 domain protein (DUF3511);(source:Araport11) |
AT5G54860 | Major facilitator superfamily protein;(source:Araport11) |
AT2G44065 | Ribosomal protein L2 family;(source:Araport11) |
AT1G07470 | Transcription factor IIA, alpha/beta subunit;(source:Araport11) |
AT1G66900 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G23145 | ATP binding / aminoacyl-tRNA ligase/ nucleotide binding protein;(source:Araport11) |
AT1G78140 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G43065 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.5e-20 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G50370 | Adenylate kinase family protein;(source:Araport11) |
AT2G25210 | Ribosomal protein L39 family protein;(source:Araport11) |
AT3G49980 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G16460 | zinc finger CCCH domain protein;(source:Araport11) |
AT2G25737 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT1G11440 | hypothetical protein;(source:Araport11) |
AT5G47980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G15040 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT1G29020 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT2G35743 | Pseudogene of AT2G35750; unknown protein |
AT1G28610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G06925 | endonuclease/glycosyl hydrolase;(source:Araport11) |
AT5G46780 | VQ motif-containing protein;(source:Araport11) |
AT1G24200 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT1G50590 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT2G37830 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167. |
AT1G27285 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G37360 | LOW protein: ammonium transporter 1-like protein;(source:Araport11) |
AT3G05060 | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein |
AT1G29640 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT1G15630 | transmembrane protein;(source:Araport11) |
AT1G55220 | hypothetical protein;(source:Araport11) |
AT1G03960 | Calcium-binding EF hand family protein;(source:Araport11) |
AT5G11242 | pseudogene of ribosomal protein |
AT3G03880 | sterol O-acyltransferase, putative (DUF1639);(source:Araport11) |
AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
AT1G26921 | hypothetical protein;(source:Araport11) |
AT3G02160 | Bromodomain transcription factor;(source:Araport11) |
AT5G39230 | TFIIB zinc-binding protein;(source:Araport11) |
AT4G36390 | Methylthiotransferase;(source:Araport11) |
AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT5G19250 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
AT4G07332 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT1G68240 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G28610 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G28580 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G14250 | RING/U-box superfamily protein;(source:Araport11) |
AT5G27495 | Encodes a defensin-like (DEFL) family protein. |
AT3G46420 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G27921 | Natural antisense transcript overlaps with AT1G27920;(source:Araport11) |
AT4G14368 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT1G28410 | myosin heavy chain-like protein;(source:Araport11) |
AT3G22970 | hypothetical protein (DUF506);(source:Araport11) |
AT1G79120 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT5G27510 | Protein kinase superfamily protein;(source:Araport11) |
AT2G27670 | hypothetical protein (Domain of unknown function DUF220);(source:Araport11) |
AT1G77145 | transmembrane protein, putative (DUF506);(source:Araport11) |
AT2G21570 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT2G18590 | Major facilitator superfamily protein;(source:Araport11) |
AT4G08740 | hypothetical protein;(source:Araport11) |
AT5G43180 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
AT4G24530 | O-fucosyltransferase family protein;(source:Araport11) |
AT4G17908 | pseudogene of ubiquitin-specific protease |
AT1G06990 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT2G37370 | centrosomal protein of 135 kDa-like protein;(source:Araport11) |
AT4G35680 | selection/upkeep of intraepithelial T-cells protein;(source:Araport11) |
AT3G28590 | transmembrane protein;(source:Araport11) |
AT1G49580 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
AT3G05932 | Potential natural antisense gene, locus overlaps with AT3G05930 |
AT3G53940 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G04425 | other_RNA;(source:Araport11) |
AT4G17100 | poly(U)-specific endoribonuclease-B protein;(source:Araport11) |
AT2G24750 | pseudogene of glutamate receptor 2.2;(source:Araport11) |
AT3G05155 | Major facilitator superfamily protein;(source:Araport11) |
AT2G46735 | death domain associated protein;(source:Araport11) |
AT1G18090 | 5-3 exonuclease family protein;(source:Araport11) |
AT2G43110 | U3 containing 90S pre-ribosomal complex subunit;(source:Araport11) |
AT2G30450 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT3G28330 | F-box family protein-like protein;(source:Araport11) |
AT5G17720 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
AT2G37160 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G65050 | TRAF-like superfamily protein;(source:Araport11) |
AT1G36925 | hypothetical protein;(source:Araport11) |
AT1G57810 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 29%25 identity and 1.1e-12 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
AT3G09162 | hypothetical protein;(source:Araport11) |
AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G24212 | pseudogene of paired amphipathic helix repeat-containing protein |
AT1G71150 | cyclin-D1-binding protein;(source:Araport11) |
AT1G27050 | Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
AT1G50330 | pseudogene of methylesterase PCR A;(source:Araport11) |
AT4G33625 | vacuole protein;(source:Araport11) |
AT4G11800 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT3G22540 | hypothetical protein (DUF1677);(source:Araport11) |
AT1G55210 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT3G24680 | transposable_element_gene;(source:Araport11);similar to zinc finger protein, putative [Arabidopsis thaliana] (TAIR:AT2G15520.1);(source:TAIR10) |
AT3G47400 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT1G26610 | C2H2-like zinc finger protein;(source:Araport11) |
AT2G19060 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT5G59130 | Subtilase family protein;(source:Araport11) |
AT3G11385 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G23880 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.4e-41 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G29800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G22150 | pseudogene of TRAF-like family protein;(source:Araport11) |
AT1G71370 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT1G66130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G24430 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G12835 | hypothetical protein;(source:Araport11) |
AT2G01023 | hypothetical protein;(source:Araport11) |
AT1G65830 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
AT1G19540 | NmrA-like negative transcriptional regulator family protein;(source:Araport11) |
AT2G43745 | jacalin lectin-like protein;(source:Araport11) |
AT3G09540 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G18920 | Cox19-like CHCH family protein;(source:Araport11) |
AT5G03795 | Exostosin family protein;(source:Araport11) |
AT1G07728 | Natural antisense transcript overlaps with AT1G07725;(source:Araport11) |
AT5G06125 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT1G02770 | hypothetical protein;(source:Araport11) |
AT4G20480 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT1G25400 | transmembrane protein;(source:Araport11) |
AT2G21560 | nucleolar-like protein;(source:Araport11) |
AT3G01870 | hypothetical protein (DUF946);(source:Araport11) |
AT3G14060 | hypothetical protein;(source:Araport11) |
AT2G38570 | hypothetical protein;(source:Araport11) |
AT2G34700 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT1G47770 | Beta-galactosidase related protein;(source:Araport11) |
AT4G17790 | SNARE associated Golgi protein family;(source:Araport11) |
AT3G18720 | F-box family protein;(source:Araport11) |
AT1G69860 | Major facilitator superfamily protein;(source:Araport11) |
AT1G36210 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-71 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G49055 | ATP-binding protein;(source:Araport11) |
AT1G29960 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
AT4G31030 | Putative membrane lipoprotein;(source:Araport11) |
AT5G62150 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
AT3G15534 | hypothetical protein;(source:Araport11) |
AT1G47610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G44210 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
AT1G30090 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G13130 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
AT3G05400 | Major facilitator superfamily protein;(source:Araport11) |
AT3G46720 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G21520 | hypothetical protein;(source:Araport11) |
AT4G28330 | pyrroline-5-carboxylate reductase;(source:Araport11) |
AT5G32072 | pseudogene of Glucose-6-phosphate isomerase |
AT5G54820 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G04580 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
AT2G39590 | 40S ribosomal protein S15a;(source:Araport11) |
AT2G15325 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT1G75760 | ER lumen protein retaining receptor family protein;(source:Araport11) |
AT2G18370 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT3G05620 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT2G16710 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
AT5G36200 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G37380 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G07600 | Oleosin family protein;(source:Araport11) |
AT1G57730 | RING/U-box superfamily protein;(source:Araport11) |
AT5G59390 | XH/XS domain-containing protein;(source:Araport11) |
AT3G44950 | glycine-rich protein;(source:Araport11) |
AT5G05180 | myosin heavy chain, striated protein;(source:Araport11) |
AT4G38760 | nucleoporin (DUF3414);(source:Araport11) |
AT4G19730 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT5G38790 | hypothetical protein;(source:Araport11) |
AT5G03870 | Glutaredoxin family protein;(source:Araport11) |
AT4G14650 | hypothetical protein;(source:Araport11) |
AT1G25230 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT2G34820 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G38910 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G44960 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G54870 | inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11) |
AT3G63290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G57950 | cotton fiber protein;(source:Araport11) |
AT2G28671 | hypothetical protein;(source:Araport11) |
AT1G20970 | calponin-like domain protein;(source:Araport11) |
AT4G32480 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
AT1G32250 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT3G56030 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G02025 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT4G21970 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT1G32740 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT2G05060 | Protein kinase superfamily protein;(source:Araport11) |
AT2G07170 | ARM repeat superfamily protein;(source:Araport11) |
AT2G26750 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G22961 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT1G31772 | Encodes a defensin-like (DEFL) family protein. |
AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
AT1G70380 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G70970 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G56690 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G80580 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT1G53163 | membrane-associated kinase regulator;(source:Araport11) |
AT3G21945 | cysteine-rich repeat secretory protein;(source:Araport11) |
AT2G33370 | Ribosomal protein L14p/L23e family protein;(source:Araport11) |
AT1G55690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G73750 | alpha/beta hydrolase family protein;(source:Araport11) |
AT2G17760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G20120 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G70030 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT1G62870 | hypothetical protein;(source:Araport11) |
AT1G43886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-165 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT1G43030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-109 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT2G11983 | Pseudogene of AT3G17910; SURF1 (SURFEIT 1) |
AT2G24160 | pseudogene of receptor like protein 37;(source:Araport11) |
AT5G42635 | glycine-rich protein;(source:Araport11) |
AT1G55280 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
AT2G36200 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G10460 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G07450.1);(source:TAIR10) |
AT1G63060 | ribosome biogenesis NEP1-like protein;(source:Araport11) |
AT1G52540 | Protein kinase superfamily protein;(source:Araport11) |
AT1G03670 | Ankyrin repeat containing protein |
AT5G54000 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT5G47430 | DWNN domain, a CCHC-type zinc finger;(source:Araport11) |
AT2G42900 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
AT2G19910 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
AT1G65170 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT5G05025 | Encodes a Pollen Ole e I allergen and extensin family protein [pseudogene] |
AT5G22180 | hypothetical protein;(source:Araport11) |
AT3G50900 | hypothetical protein;(source:Araport11) |
AT4G33960 | hypothetical protein;(source:Araport11) |
AT4G37440 | hypothetical protein;(source:Araport11) |
AT2G28490 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT4G26470 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT1G29195 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT1G08890 | Major facilitator superfamily protein;(source:Araport11) |
AT2G41780 | hypothetical protein;(source:Araport11) |
AT5G61970 | signal recognition particle-related / SRP-like protein;(source:Araport11) |
AT3G50230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G17940 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT4G27190 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT2G36540 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G52890 | AT hook motif-containing protein;(source:Araport11) |
AT5G50890 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G24350 | Phosphorylase superfamily protein;(source:Araport11) |
AT1G74530 | transmembrane protein;(source:Araport11) |
AT1G01830 | ARM repeat superfamily protein;(source:Araport11) |
AT5G52355 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
AT3G44940 | enabled-like protein (DUF1635);(source:Araport11) |
AT5G51795 | DNA/RNA-binding protein Kin17, conserved region;(source:Araport11) |
AT3G01190 | Peroxidase superfamily protein;(source:Araport11) |
AT1G72100 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
AT1G79990 | coatomer subunit beta-2;(source:Araport11) |
AT3G50560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G16560 | Protein phosphatase 2C family protein;(source:Araport11) |
AT4G18540 | transmembrane protein;(source:Araport11) |
AT5G52390 | PAR1 protein;(source:Araport11) |
AT1G22660 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
AT1G67865 | hypothetical protein;(source:Araport11) |
AT5G42070 | hypothetical protein;(source:Araport11) |
AT1G29650 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-28 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G10580 | plant/protein (Protein of unknown function, DUF599);(source:Araport11) |
AT3G12340 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT2G31490 | neuronal acetylcholine receptor subunit alpha-5;(source:Araport11) |
AT1G26976 | hypothetical protein;(source:Araport11) |
AT5G47590 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
AT1G76250 | transmembrane protein;(source:Araport11) |
AT1G62030 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G62420 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT1G05660 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G69760 | suppressor SRP40-like protein;(source:Araport11) |
AT4G11860 | FAM63A-like protein (DUF544);(source:Araport11) |
AT3G27540 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G61688 | Encodes a defensin-like (DEFL) family protein. |
AT1G65550 | Xanthine/uracil permease family protein;(source:Araport11) |
AT1G47570 | RING/U-box superfamily protein;(source:Araport11) |
AT3G51090 | coiled-coil 90B-like protein (DUF1640);(source:Araport11) |
AT5G22791 | F-box family protein;(source:Araport11) |
AT3G42148 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G33800 | hypothetical protein;(source:Araport11) |
AT5G16200 | 50S ribosomal protein-like protein;(source:Araport11) |
AT5G60190 | Encodes a protein that can cleave residues from the C-terminus of RUB1 to prepare it for conjugation to target proteins. |
AT3G22415 | hypothetical protein;(source:Araport11) |
AT4G17975 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
AT4G30250 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G45220 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT2G03270 | DNA-binding protein;(source:Araport11) |
AT4G15755 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT4G01930 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G58950 | Protein kinase superfamily protein;(source:Araport11) |
AT2G30925 | transmembrane protein;(source:Araport11) |
AT1G66190 | hypothetical protein;(source:Araport11) |
AT2G22807 | Encodes a defensin-like (DEFL) family protein. |
AT3G46070 | C2H2-type zinc finger family protein;(source:Araport11) |
AT5G14495 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT1G61610 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT3G47342 | snoRNA;(source:Araport11) |
AT2G13128 | pseudogene of F-box family protein |
AT2G39850 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT4G39140 | RING/U-box superfamily protein;(source:Araport11) |
AT3G47341 | transmembrane protein;(source:Araport11) |
AT3G18282 | hypothetical protein;(source:Araport11) |
AT5G46680 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT2G29340 | NAD-dependent epimerase/dehydratase family protein;(source:Araport11) |
AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11) |
AT1G03390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G30925 | F-box/associated interaction domain protein;(source:Araport11) |
AT2G08986 | hypothetical protein;(source:Araport11) |
AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
AT1G78060 | Glycosyl hydrolase family protein;(source:Araport11) |
AT4G01110 | late embryogenesis abundant hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G39880 | transmembrane protein;(source:Araport11) |
AT3G09990 | Nucleoside transporter family protein;(source:Araport11) |
AT1G14480 | Ankyrin repeat family protein;(source:Araport11) |
AT3G49270 | extensin-like protein;(source:Araport11) |
AT3G51990 | Protein kinase superfamily protein;(source:Araport11) |
AT4G12580 | hypothetical protein;(source:Araport11) |
AT1G29560 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT3G20990 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-07 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G23790 | calcium uniporter (DUF607);(source:Araport11) |
AT2G16990 | Major facilitator superfamily protein;(source:Araport11) |
AT3G63006 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G09850 | D111/G-patch domain-containing protein;(source:Araport11) |
AT3G48180 | CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase;(source:Araport11) |
AT4G22580 | Exostosin family protein;(source:Araport11) |
AT4G27840 | SNARE-like superfamily protein;(source:Araport11) |
AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G26558 | other_RNA;(source:Araport11) |
AT1G49975 | photosystem I reaction center subunit N;(source:Araport11) |
AT3G55240 | Overexpression leads to PEL (Pseudo-Etiolation in Light) phenotype. |
AT3G52440 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT5G49525 | transmembrane protein;(source:Araport11) |
AT1G01305 | hypothetical protein;(source:Araport11) |
AT5G63490 | CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein;(source:Araport11) |
AT5G38940 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT1G20430 | hypothetical protein;(source:Araport11) |
AT5G49990 | Xanthine/uracil permease family protein;(source:Araport11) |
AT1G47730 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G21680 | hypothetical protein;(source:Araport11) |
AT3G22290 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
AT3G45530 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G00920 | COP1-interacting protein-like protein;(source:Araport11) |
AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G47790 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT2G39650 | cruciferin (DUF506);(source:Araport11) |
AT2G15240 | UNC-50 family protein;(source:Araport11) |
AT1G71970 | hypothetical protein;(source:Araport11) |
AT3G26540 | RGFR3 is a leucine--rich repeat receptor kinase that, together with RGFR1 and RGFR2, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
AT3G02315 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT2G39390 | Ribosomal L29 family protein;(source:Araport11) |
AT1G10340 | Ankyrin repeat family protein;(source:Araport11) |
AT4G22217 | Encodes a defensin-like (DEFL) family protein. |
AT4G25719 | Natural antisense transcript overlaps with AT4G25720;(source:Araport11) |
AT3G25290 | Auxin-responsive family protein;(source:Araport11) |
AT5G48480 | Lactoylglutathione lyase / glyoxalase I family protein;(source:Araport11) |
AT2G36030 | hypothetical protein;(source:Araport11) |
AT1G68350 | cotton fiber protein;(source:Araport11) |
AT3G42180 | Exostosin family protein;(source:Araport11) |
AT5G27900 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-26 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT3G58430 | MATH domain/coiled-coil protein;(source:Araport11) |
AT5G03610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G08310 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G01610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT2G30830 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
AT1G59722 | hypothetical protein;(source:Araport11) |
AT3G07280 | None;(source:Araport11) |
AT1G79010 | Alpha-helical ferredoxin;(source:Araport11) |
AT3G46600 | GRAS family transcription factor;(source:Araport11) |
AT2G23860 | pseudogene of PapD-like superfamily protein;(source:Araport11) |
AT5G56369 | Encodes a defensin-like (DEFL) family protein. |
AT1G49740 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT3G60700 | hypothetical protein (DUF1163);(source:Araport11) |
AT5G20500 | Glutaredoxin family protein;(source:Araport11) |
AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT2G33890 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT3G59000 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G52882 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G46877 | Encodes a defensin-like (DEFL) family protein. |
AT1G65720 | transmembrane protein;(source:Araport11) |
AT4G39955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G06210 | ARM repeat superfamily protein;(source:Araport11) |
AT4G12735 | Encodes a peroxisomal protein. |
AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G26920 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT1G55840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT5G07790 | hypothetical protein;(source:Araport11) |
AT2G11320 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 41%25 identity and 1.7e-199 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT1G62520 | sulfated surface-like glycoprotein;(source:Araport11) |
AT5G24355 | hypothetical protein;(source:Araport11) |
AT3G04150 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT1G62550 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to non-LTR retroelement reverse transcriptase-like protein GI:9758853 from (Arabidopsis thaliana);(source:TAIR10) |
AT1G61840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G45095 | hypothetical protein;(source:Araport11) |
AT2G35612 | copper amine oxidase family protein;(source:Araport11) |
AT1G78810 | hypothetical protein;(source:Araport11) |
AT5G01780 | 2-oxoglutarate-dependent dioxygenase family protein;(source:Araport11) |
AT1G50750 | aminotransferase-like, mobile domain protein;(source:Araport11) |
AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
AT1G26590 | C2H2-like zinc finger protein;(source:Araport11) |
AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
AT3G15357 | phosphopantothenoylcysteine decarboxylase subunit;(source:Araport11) |
AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
AT3G46710 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT5G44530 | Subtilase family protein;(source:Araport11) |
AT1G18550 | ATP binding microtubule motor family protein;(source:Araport11) |
AT5G24010 | Protein kinase superfamily protein;(source:Araport11) |
AT4G38225 | glycerol kinase;(source:Araport11) |
AT3G61185 | Encodes a defensin-like (DEFL) family protein. |
AT3G26140 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
AT5G46490 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G13130 | transmembrane protein;(source:Araport11) |
AT2G41231 | transmembrane protein;(source:Araport11) |
AT3G52320 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G26490 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G19530 | hypothetical protein;(source:Araport11) |
AT5G37220 | RING/U-box superfamily protein;(source:Araport11) |
AT4G36515 | trichohyalin-like protein;(source:Araport11) |
AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
AT4G11540 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G30750 | TPRXL;(source:Araport11) |
AT5G54700 | Ankyrin repeat family protein;(source:Araport11) |
AT3G06920 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G23690 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
AT4G31520 | SDA1 family protein;(source:Araport11) |
AT1G52210 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-186 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G55100 | transposable_element_gene;(source:Araport11);pseudogene, putative ATP synthase beta subunit;(source:TAIR10) |
AT2G28770 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
AT4G30872 | other_RNA;(source:Araport11) |
AT3G48630 | hypothetical protein;(source:Araport11) |
AT2G37100 | protamine P1 family protein;(source:Araport11) |
AT2G24165 | pseudogene of receptor like protein 30;(source:Araport11) |
AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
AT1G74680 | Exostosin family protein;(source:Araport11) |
AT5G53500 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G33350 | CCT motif family protein;(source:Araport11) |
AT2G03550 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G12320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32169.1);(source:TAIR10) |
AT3G24250 | glycine-rich protein;(source:Araport11) |
AT2G25950 | PITH domain protein (DUF1000);(source:Araport11) |
AT1G66710 | pseudogene of S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G42760 | DUF1685 family protein;(source:Araport11) |
AT2G36180 | EF hand calcium-binding protein family;(source:Araport11) |
AT2G33255 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT3G27420 | bromodomain testis-specific protein;(source:Araport11) |
AT3G50150 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
AT5G55800 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G04230 | rRNA-processing EFG1-like protein (DUF2361);(source:Araport11) |
AT1G29080 | Papain family cysteine protease;(source:Araport11) |
AT4G01985 | hypothetical protein;(source:Araport11) |
AT2G37870 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G36052 | Natural antisense transcript overlaps with AT4G36050;(source:Araport11) |
AT3G07940 | Calcium-dependent ARF-type GTPase activating protein family;(source:Araport11) |
AT5G25430 | HCO3- transporter family;(source:Araport11) |
AT1G34545 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-112 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G73950 | Transmembrane Fragile-X-F-associated protein;(source:Araport11) |
AT4G02880 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
AT4G16745 | Exostosin family protein;(source:Araport11) |
AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G77160 | hypothetical protein (DUF506);(source:Araport11) |
AT3G51410 | hypothetical protein (DUF241);(source:Araport11) |
AT1G30250 | hypothetical protein;(source:Araport11) |
AT1G12960 | Ribosomal protein L18e/L15 superfamily protein;(source:Araport11) |
AT5G47225 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
AT5G02940 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
AT4G26375 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT2G33180 | hypothetical protein;(source:Araport11) |
AT4G29310 | DUF1005 family protein (DUF1005);(source:Araport11) |
AT2G07811 | pseudogene of mitochondrial protein |
AT2G26240 | Transmembrane proteins 14C;(source:Araport11) |
AT3G13350 | HMG (high mobility group) box protein with ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11) |
AT5G41550 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
AT5G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G08391 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
AT3G29330 | zinc finger RNA-binding-like protein;(source:Araport11) |
AT1G56490 | pseudogene of Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G23201 | GCK domain protein;(source:Araport11) |
AT4G29560 | fanconi anemia group E protein FANCE protein;(source:Araport11) |
AT4G15740 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G30780 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G03330 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT2G14846 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G23810 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT1G30910 | Molybdenum cofactor sulfurase family protein;(source:Araport11) |
AT1G55800 | hypothetical protein;(source:Araport11) |
AT4G01130 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G54390 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT5G28285 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 9.8e-101 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT5G56975 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
AT5G25920 | hypothetical protein;(source:Araport11) |
AT2G03990 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
AT5G24260 | prolyl oligopeptidase family protein;(source:Araport11) |
AT3G44005 | pseudogene of Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT4G18180 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G52370 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
AT3G58930 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G10460 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G20110 | Dynein light chain type 1 family protein;(source:Araport11) |
AT4G31680 | Transcriptional factor B3 family protein;(source:Araport11) |
AT3G46382 | transposable_element_gene;(source:Araport11);pseudogene, similar to P0416D03.16, similar to non-LTR reverse transcriptase, putative;(source:TAIR10) |
AT2G30220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G20030 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
AT5G49280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G24010 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
AT1G55030 | RNI-like superfamily protein;(source:Araport11) |
AT5G63070 | Ribosomal protein S19 family protein;(source:Araport11) |
AT4G14780 | Protein kinase superfamily protein;(source:Araport11) |
AT2G40770 | RING-finger, DEAD-like helicase, PHD and SNF2 domain-containing protein;(source:Araport11) |
AT4G32440 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
AT5G44690 | RING finger PFF0165c-like protein;(source:Araport11) |
AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G06148 | hypothetical protein;(source:Araport11) |
AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT4G26830 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G58640 | Mitogen activated protein kinase kinase kinase-like protein;(source:Araport11) |
AT1G49500 | transcription initiation factor TFIID subunit 1b-like protein;(source:Araport11) |
AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
AT5G04690 | Ankyrin repeat family protein;(source:Araport11) |
AT2G29995 | PSY3-like protein;(source:Araport11) |
AT5G45530 | transmembrane protein, putative (DUF594);(source:Araport11) |
AT5G37840 | PADRE protein, up-regulated after infection by S. sclerotiorum. |
AT1G51870 | protein kinase family protein;(source:Araport11) |
AT5G65440 | transmembrane protein;(source:Araport11) |
AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G19150 | Ankyrin repeat family protein;(source:Araport11) |
AT3G19370 | filament-like protein (DUF869);(source:Araport11) |
AT4G23915 | Encodes an alanine tRNA with the anticodon CGC that recognizes the alanine codon GCG. |
AT5G16360 | NC domain-containing protein-like protein;(source:Araport11) |
AT1G69460 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT3G15830 | phosphatidic acid phosphatase-related / PAP2-like protein;(source:Araport11) |
AT1G76230 | hypothetical protein;(source:Araport11) |
AT5G37530 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G01710 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
AT3G42835 | transposable_element_gene;(source:Araport11);non-LTR retroelement reverse transcriptase -related, temporary automated functional assignment;(source:TAIR10) |
AT2G37910 | cation/hydrogen exchanger, putative (CHX21);(source:Araport11) |
AT4G06654 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.2e-88 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
AT5G38810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G42905 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT1G68410 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G31390 | TRAF-like family protein;(source:Araport11) |
AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G54460 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
AT2G32235 | hypothetical protein;(source:Araport11) |
AT5G10340 | F-box family protein;(source:Araport11) |
AT3G42717 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.8e-229 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G52760 | Copper transport protein family;(source:Araport11) |
AT3G48209 | Encodes a Plant thionin family protein |
AT2G43730 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT2G33360 | cadherin EGF LAG seven-pass G-type receptor, putative (DUF3527);(source:Araport11) |
AT1G30340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G53220 | hypothetical protein;(source:Araport11) |
AT5G04250 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT1G22460 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G78030 | hypothetical protein;(source:Araport11) |
AT1G28140 | integral membrane family protein;(source:Araport11) |
AT4G30490 | AFG1-like ATPase family protein;(source:Araport11) |
AT3G45577 | tRNA-intron endonuclease;(source:Araport11) |
AT4G08871 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.2e-15 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT2G04290 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.1e-36 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G48740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G22430 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT2G43880 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G16650 | O-fucosyltransferase family protein;(source:Araport11) |
AT5G22850 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G33830 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
AT3G56350 | Iron/manganese superoxide dismutase family protein;(source:Araport11) |
AT4G16810 | VEFS-Box of polycomb protein;(source:Araport11) |
AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
AT1G45904 | pseudogene of photosystem II reaction center protein G;(source:Araport11) |
AT1G56630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G62981 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT5G38350 | Disease resistance protein (NBS-LRR class) family;(source:Araport11) |
AT4G38870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G66480 | Involved in chloroplast avoidance movement under intermediate and high light intensities; PADRE protein up-regulated after infection by S. sclerotiorun. |
AT2G27950 | Ring/U-Box superfamily protein;(source:Araport11) |
AT3G27200 | Cupredoxin superfamily protein;(source:Araport11) |
AT1G64260 | MuDR family transposase;(source:Araport11) |
AT5G23970 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G65925 | hypothetical protein;(source:Araport11) |
AT1G22120 | hypothetical protein;(source:Araport11) |
AT2G27770 | DUF868 family protein (DUF868);(source:Araport11) |
AT1G51890 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G12280 | copper amine oxidase family protein;(source:Araport11) |
AT4G09745 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT2G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G26790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G17050 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT3G19274 | hypothetical protein;(source:Araport11) |
AT4G04690 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G60520 | pseudogene of Dynamin related protein 4A;(source:Araport11) |
AT3G12180 | Cornichon family protein |
AT4G10980 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-44 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT4G28070 | AFG1-like ATPase family protein;(source:Araport11) |
AT4G27790 | Calcium-binding EF hand family protein;(source:Araport11) |
AT5G58810 | pseudogene of Subtilase family protein;(source:Araport11) |
AT3G08980 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
AT5G41420 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G56275 | pseudogene of expressed protein;(source:Araport11) |
AT4G28740 | LOW PSII ACCUMULATION-like protein;(source:Araport11) |
AT2G18420 | Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein |
AT2G33320 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT4G30680 | Initiation factor eIF-4 gamma, MA3;(source:Araport11) |
AT5G64250 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT5G01090 | Concanavalin A-like lectin family protein;(source:Araport11) |
AT2G29070 | Ubiquitin fusion degradation UFD1 family protein;(source:Araport11) |
AT4G24805 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G19740 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT5G53010 | calcium-transporting ATPase;(source:Araport11) |
AT5G57840 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091) |
AT3G09570 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT5G24810 | ABC1 family protein;(source:Araport11) |
AT1G65950 | Protein kinase superfamily protein;(source:Araport11) |
AT4G33890 | Component of SAGA complex, SPT module subunit, interacts with HAG1. |
AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
AT5G40790 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
AT1G76010 | Alba DNA/RNA-binding protein;(source:Araport11) |
AT5G02530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G32660 | Encodes protein kinase AME3. |
AT5G53540 | Encodes a P-loop NTPase APP1. The disruption of APP1 is accompanied by a reduction in ROS level, a rise in the rate of cell division in the quiescent center (QC) and the promotion of root distal stem cell (DSC) differentiation. |
AT4G18020 | Encodes pseudo-response regulator 2 (APRR2) that interacts with a calcium sensor (CML9). |
AT5G43780 | sulfate adenylyltransferase, ATP sulfurylase |
AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
AT4G19640 | Encodes Ara7. |
AT4G13980 | member of Heat Stress Transcription Factor (Hsf) family |
AT4G16640 | Matrix metalloprotease. |
AT4G38250 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT3G29590 | At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis. |
AT5G65990 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT4G20800 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G11770 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
AT5G44360 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G26390 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G26400 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G26410 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G30700 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G30710 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile. |
AT3G13790 | Encodes a protein with invertase activity. |
AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT1G66810 | Encodes a tandem CCCH zinc finger (TZF) protein that can bind DNA and RNA, function as a transcriptional activator, and is involved in secondary wall biosynthesis. |
AT5G26130 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT1G16380 | member of Putative Na+/H+ antiporter family |
AT2G30240 | Encodes a plasma membrane localized potassium transporter. |
AT2G25900 | Encodes a protein with two tandem-arrayed CCCH-type zinc fingers that binds RNA and is involved in RNA turnover. The mRNA is cell-to-cell mobile. |
AT4G37810 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT3G08030 | The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein. |
AT1G17780 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
AT1G23465 | Mitochondrial ATP-independent protease |
AT1G32361 | Putative RING-H2 finger protein ATL1F precursor. |
AT5G57160 | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
AT3G63260 | protein kinase, similar to mammal mixed-lineage kinase and Raf protein kinase |
AT4G00480 | MYC-related protein with a basic helix-loop-helix motif at the C-terminus and a region similar to the maize B/R family at the N-terminus |
AT4G00860 | putative pathogenesis-related protein whose transcript level is induced in response to ozone and pathogenic Pseudomonas strains. |
AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
AT3G47380 | Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease. |
AT3G14300 | pectinesterase family protein;(source:Araport11) |
AT4G11570 | Encodes plastid localized protein involved in riboflavin biosynthesis. It dephosphorylates 5-amino-6-ribitylamino- 2,4(1H,3H) pyrimidinedione 5′-phosphate (ARPP) . |
AT1G19230 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
AT4G16830 | Encodes a perinuclear and cytoplasmically localized mRNA binding protein. AtRGGA is likely involved in stress responsivness. It is induced by salt and osmotic stress and loss of function mutations are more sensitive to stress. The mRNA is cell-to-cell mobile. |
AT1G29060 | Encodes a golgi localized QcSNARE involved in response to salt and osmotic stress. Overexpression confers increased resistance to NaCl, mannitol and LiCl. SFT12 may act by mediating vacuolar sequestration of NaCl and other ions. |
AT4G00250 | STKL2 is a DUF domain containing DNA binding protein that may be involved in mediating certain glucose responses. Binds to promoter of PGR, a putative plasma membrane glucose response regulator. |
AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
AT1G68020 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain and a trehalose phosphatase (TPP)-like domain. It can complement a yeast mutant lacking both of these activities suggesting that this is a bifunctional enzyme. |
AT2G03300 | TX12 is a Toll/Interleukin-1 receptor domain containing protein. Misexpression results in ectopic activation of defense response genes. |
AT1G19910 | vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p2) |
AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G21430 | protein B160;(source:Araport11) |
AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
AT4G00870 | bHLH14 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH17 to negatively regulate jasmonate responses. |
AT2G42300 | Together with bHLH60 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
AT1G71870 | Metabolite transporter involved in the anthocyanin response to anthocyanin induction conditions. Affects ABA signaling and localization. |
AT3G57090 | Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division. |
AT5G28540 | Encodes the luminal binding protein BiP, an ER-localized member of the HSP70 family. BiP is composed of an N-terminal ATP binding domain and a C-terminal domain that binds to hydrophobic patches on improperly/incompletely folded proteins in an ATP-dependent manner. Involved in polar nuclei fusion during proliferation of endosperm nuclei. |
AT5G42020 | Luminal binding protein (BiP2) involved in polar nuclei fusion during proliferation of endosperm nuclei. |
AT5G40880 | Involved in seed germination, seedling/seed development, interacting with PPPDE family protein Desi1. |
AT5G57580 | Calmodulin-binding protein;(source:Araport11) |
AT3G49720 | Encodes CGR2 (cotton Golgi-related 2). CGR2 and a close homologue CGR3 have overlapping roles in plant growth and pectin methylesterification in the Golgi apparatus. |
AT4G25370 | Double Clp-N motif protein;(source:Araport11) |
AT1G62820 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT2G45770 | chloroplast SRP receptor homolog, alpha subunit CPFTSY. Required for LHCP integration into isolated thylakoids. |
AT2G29720 | Encodes CTF2B. |
AT5G42940 | RING/U-box superfamily protein;(source:Araport11) |
AT2G37150 | RING/U-box superfamily protein;(source:Araport11) |
AT1G73760 | RING/U-box superfamily protein;(source:Araport11) |
AT1G17130 | DUF572 domain protein involved in alternative splicing. |
AT5G48640 | Cyclin family protein;(source:Araport11) |
AT5G48630 | Cyclin family protein;(source:Araport11) |
AT2G34170 | hypothetical protein (DUF688);(source:Araport11) |
AT4G04930 | Encodes a sphingolipid delta4-desaturase, involved in sphingolipid biosynthesis. Specifically expressed in floral tissues. Knockout mutants were devoid of sphinga-4,8-dienine in floral tissues. |
AT1G76880 | DF1 is a putative transcription factor required for the synthesis of seed mucilage polysaccharides. The df1 seeds produce almost 50% less mucilage than wild-type, but show less severe defects than the myb5 and ttg2 mutants. |
AT3G54600 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
AT1G56300 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
AT2G41750 | Involved in posttranscriptional modification of tRNA. Can form acp3U20b on a tRNA expressed in yeast cells. The aspartate and tryptophan residues in the DXTW motif of this protein are required for modification activity. Required for the acp3U20a modification of cytosolic tRNA. |
AT1G47530 | MATE efflux family protein;(source:Araport11) |
AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
AT1G31450 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G60390 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
AT1G05070 | transmembrane protein, putative (DUF1068);(source:Araport11) |
AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT2G37640 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT3G13610 | Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
AT3G06580 | Encodes a protein with galactose kinase activity. The gene was shown to complement the yeast Agal1 mutant defective in the galactokinase gene GAL1. |
AT3G06440 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. Mutants display multiple phenotypes including reduced root hair growth and reduced seed coat mucilage. |
AT5G62620 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. Mutants display multiple phenotypes including reduced seed coat mucilage and accelerated leaf senescence. |
AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
AT3G11600 | One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations. |
AT1G11860 | T-protein is the aminomethyltransferase of the glycine cleavage multienzyme system GCS. |
AT3G62950 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
AT4G15680 | Encodes a member of the CC-type glutaredoxin (ROXY) family. Operates downstream of cytokinins in a signal transduction pathway that negatively regulates plant primary root growth in response to nitrate. |
AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
AT3G14130 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
AT2G40490 | Uroporphyrinogen decarboxylase;(source:Araport11) |
AT3G03890 | Dimeric β-barrel protein that is structurally related to the putative non-canonical heme oxygenase (HO) and is located in chloroplasts. May function additionally in the tetrapyrrole biosynthetic pathway. |
AT1G52560 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT3G09480 | Histone superfamily protein;(source:Araport11) |
AT1G75600 | Histone superfamily protein;(source:Araport11) |
AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
AT3G12130 | KHZ1 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ2. khz1 mutants are late flowering and double mutants with khz2 are even more late flowering. Overexpression leads to increased rates of leaf senescence. |
AT3G50240 | Encodes a kinesin-related protein. |
AT3G16630 | Kinesin-13A localized to entire Golgi stacks. Involved in trichome development. |
AT2G34480 | Encodes a nuclear localized member of the ribosomal L18ae/LX protein family. Loss of function mutations show reduced transmission through the gametophytes and embryo lethality. |
AT1G04970 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. Putative BPI/LBP family protein. |
AT3G20270 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. |
AT2G42450 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
AT1G09970 | RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. The mRNA is cell-to-cell mobile. |
AT2G41260 | Late-embryogenesis-abundant gene. Involved in the acquisition of desiccation tolerance during late phase of embryogenesis. |
AT3G55180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G14980 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G16120 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G20680 | Encodes a mannanase belonging to clade 1 of the GH5 7 phylogenetic tree that exhibits high substrate affinity and catalytic efficiency on mannan substrates with main chains containing both glucose and mannose units such as konjac glucomannan and spruce galactoglucomannan. It is likely a glycoprotein. |
AT4G39690 | Encodes a homolog of the yeast mic60 protein that is localized in the inner membrane of the mitochondrion, interacts with Tom40 as part of a large lipid-enriched complex called the mitochondrial transmembrane lipoprotein complex (MTL) and is involved in mitochondrial lipid trafficking. |
AT1G21150 | mTERF protein involved in mitochondrial development; required for salt tolerance. |
AT1G61960 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G62120 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT5G23930 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT5G43560 | Encodes MUSE14, a TRAF domain protein. Regulates the turnover of nucleotide-binding domain and leucine-rich repeat-containing (NLR) immune receptors SNC1 and RPS2. Loss of both MUSE13 and MUSE14 leads to enhanced pathogen resistance, NLR accumulation, and autoimmunity. In addition, MUSE13/14 physically interact with ATG6 and appear to regulate ATG6 ubiquitination and thus formation of autophagosomes. |
AT2G39020 | Although this locus shares considerable sequence similarity with the adjacent NATA1 gene (At2g39030), they appear to encode genes with different functions. NATA1 is involved in the production of N-delta-acetylornithine, but, overexpression of At2g39020 in tobacco does not lead to the formation of this defense compound. The mRNA is cell-to-cell mobile. |
AT5G19640 | Influences leaf N export via sink-to-source feedback, perhaps via a role in sensing plant internal N-status. Necessary for normal leaf N export under low N. |
AT3G54200 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT1G73600 | Encodes a S-adenosyl-L-methionine-dependent phosphoethanolamine N-methyltransferase whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. It catalyzes the three sequential P-base methylation of phosphoethanolamine to phosphocholine. Homologous biochemical function to NMT1 (At3g18000). Double mutants of NMT1 and NMT3 are defective in leaf, root, flower, seed, and pollen development. |
AT5G41190 | Encodes a cytoplasmic protein with RNA endonuclease activity. Mutants display aberrant RNA processing and male and female gametophyte development. |
AT5G55850 | NOI protein |
AT1G02080 | Acts as scaffold protein in the CCR4-NOT complex, by interacting with various NOT proteins and CAF1. Essential protein for proper pollen development and germination capacity. |
AT3G45680 | Major facilitator superfamily protein;(source:Araport11) |
AT1G49670 | molecular function has not been defined. Was shown involved in oxidative stress tolerance. |
AT2G04630 | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940. |
AT3G59600 | One of two highly similar proteins that can serve as non-catalytic subunits of Nuclear RNA polymerases II, IV and V; homologous to budding yeast RPB8. Probably redundant with At1g54250. |
AT2G15400 | Non-catalytic subunit of Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB3 and the E. coli RNA polymerase alpha subunit. A closely related paralog, At2g15430 can substitute for At2g15400 in the context of Pol V and encodes the equivalent subunit of Pol II and Pol IV. |
AT1G76940 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G14590 | Ca2+-dependent lipid-binding protein |
AT3G45760 | Nucleotidyltransferase family protein;(source:Araport11) |
AT3G14120 | nuclear pore complex protein;(source:Araport11) |
AT1G07615 | GTP-binding protein Obg/CgtA;(source:Araport11) |
AT5G22240 | Ovate family protein;(source:Araport11) |
AT5G51740 | Mitochondrial ATP-independent protease .Important for maintenance of proper function of the oxphos system. |
AT1G11960 | Calcium channel that is phosphorylated by BIK1 in the presence of PAMPS and required for stomatal immunity. |
AT3G48760 | DHHC-type zinc finger family protein;(source:Araport11) |
AT4G31300 | Encodes 20S proteasome subunit PBA1 (PBA1). PBA1 acts as a plant caspase-3-like enzyme. |
AT2G02120 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. Mediates ammonium metabolism by regulatingglutamine synthetase activity. |
AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
AT3G49770 | hypothetical protein;(source:Araport11) |
AT2G39550 | encodes the beta subunit of geranylgeranyl transferase (GGT-IB), involved in both ABA-mediated and auxin signaling pathways. |
AT3G27110 | PGM48 is a member of a plant specific clade of metallo-endopeptidase proteins. It is found in plastoglobules. Analysis of over-expression and loss of function phenotypes suggests PGM48 may have a role in positively regulating senescence. |
AT5G61120 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT1G68740 | Encodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
AT5G10410 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT1G14686 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT1G60890 | Phosphatidylinositol-4-phosphate 5-kinase family protein;(source:Araport11) |
AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
AT3G60670 | PLATZ transcription factor family protein;(source:Araport11) |
AT4G17900 | PLATZ transcription factor family protein;(source:Araport11) |
AT1G76590 | PLATZ transcription factor family protein;(source:Araport11) |
AT4G24780 | Encodes a pectate lyase involved in response to nematodes. |
AT1G33612 | Encodes a receptor for the Plant Natriuretic Peptide (At2g18660, AtPNP-A). The receptor contains a functional guanylyl cyclase catalytic center embedded in the cytosolic kinase domain. This catalytic center can convert GTP into cGMP (and PPi) which enables ligand-specific downstream signalling. It is therefore consistent with the reported cGMP dependence of AtPNP-A effects (see DOI:10.1007/s11103-016-0465-8). |
AT1G78650 | Similar to DNA polymerase delta (POLD3), which in other organism was shown to be involved in the elongation of DNA replication. |
AT3G13720 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
AT1G72460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G18980 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
AT2G22420 | Encodes a cell wall-localized class III peroxidase that is directly regulated by the MADS-box transcription factor AGL15 and is involved in lignified tissue formation. |
AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G65920 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT2G19410 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT4G36550 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G65500 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT2G40640 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT1G67530 | ARM repeat superfamily protein;(source:Araport11) |
AT3G46060 | small GTP-binding protein (ara-3) The mRNA is cell-to-cell mobile. |
AT5G20850 | Encodes a homolog of yeast RAD51. Its mRNA is most abundant in early flower buds and is expressed at high levels in exponentially growing cells in suspension cultures and is induced in response to gamma radiation. Also involved in defense gene transcription during plant immune responses. |
AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
AT3G24240 | RGFR1 is a leucine--rich repeat receptor kinase that, together with RGFR2 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
AT1G35630 | Protease-associated (PA) RING/U-box zinc finger family protein;(source:Araport11) |
AT5G18600 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
AT1G32415 | Encodes a PPR protein involved in mitochondrial functioning. Mutants suppress cell wall defects caused by C17 chemical inhibitor. Mutants are defective in cytochrome c maturation and activation of mitochondrial retrograde signalling. |
AT2G28620 | Mutants have radially swollen roots but do not exhibit defects in abundance or orientation of cortical microtubules, nor are microfibrils reduced. Cellulose synthesis is also unchanged with respect to wild type. There is a disruption in the normal pattern of cell wall placement. |
AT5G62460 | RZFP is a zinc finger protein involved in mediating abiotic stress tolerance. |
AT5G09460 | transcription factor bHLH143;(source:Araport11) |
AT5G64000 | 3'(2'),5'-bisphosphate nucleotidase |
AT1G22870 | One of two paralogs in Arabidopsis.Loss of both SCYL2B and SCYL2A results in severe growth defects. |
AT4G12120 | member of KEULE Gene Family |
AT1G18830 | Together with SEC31B a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
AT1G64350 | seh1-like protein |
AT5G27350 | Encodes a sugar-porter family protein that is induced during leaf senescence. The increase in its gene expression during leaf senescence is paralleled by an accumulation of monosaccharides. The mRNA is cell-to-cell mobile. |
AT4G24950 | Encodes the plant KASH protein SINE4; SINE4 interacts with SUN1 and SUN2 and is localized at the nuclear envelope. |
AT5G59360 | hypothetical protein;(source:Araport11) |
AT2G37610 | hypothetical protein;(source:Araport11) |
AT5G02420 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
AT5G40460 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
AT1G51355 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
AT3G22760 | CXC domain containing TSO1-like protein 1. The gene is expressed in stamens, pollen mother cells, and immature ovules. Regulates fate transition and cell Divisions in the stomatal lineage. |
AT5G65300 | Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering. |
AT5G49600 | ABA responsive SVB family gene. |
AT5G50790 | Encodes a member of the SWEET sucrose efflux transporter family proteins. Transcriptionally activated by long photoperiods; activation depends on FT and SOC1. The ectopic expression of SWEET10 causes early flowering and leads to higher levels of transcription of flowering-time related genes in the shoot apex. |
AT3G48740 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
AT5G23660 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
AT3G14770 | Nodulin MtN3 family protein;(source:Araport11) |
AT5G53190 | Nodulin MtN3 family protein;(source:Araport11) |
AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
AT5G40840 | Cohesion family protein SYN2 (SYN2). Plays a role in somatic DNA double strand break damage repair. |
AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G15570 | Bromodomain transcription factor;(source:Araport11) |
AT5G16790 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. |
AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
AT5G55220 | Contains with HP22 a protein that is related to the bacterial trigger factor chaperone. Plants depleted of either HP22 or HP65b or even both were increasingly delayed in leaf senescence and retained much longer stromal chloroplast constituents than wild-type plants. |
AT5G07170 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of Aurora kinase activity. |
AT5G02280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
AT5G16280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
AT5G40395 | U6acat;(source:Araport11) |
AT2G41160 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with a role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
AT1G16780 | Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves. |
AT5G22950 | SNF7 family protein;(source:Araport11) |
AT3G45000 | SNF7 family protein;(source:Araport11) |
AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
AT1G29170 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
AT4G26640 | member of WRKY Transcription Factor; Group I |
AT4G01720 | member of WRKY Transcription Factor; Group II-b |
AT5G37300 | Encodes a bifunctional enzyme, wax ester synthase (WS) and diacylglycerol acyltransferase (DGAT). In vitro assay indicated a ratio of 10.9 between its WS and DGAT activities. Both mutant and in vivo expression/analysis in yeast studies indicated a role in wax biosynthesis. |
AT4G33200 | member of Myosin-like proteins |
AT4G28710 | member of Myosin-like proteins The mRNA is cell-to-cell mobile. |
AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter;(source:Araport11) |
AT1G58380 | Ribosomal protein S5 family protein;(source:Araport11) |
AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
AT1G59600 | ZCW7;(source:Araport11) |
AT3G57700 | Protein kinase superfamily protein;(source:Araport11) |
AT1G65190 | Protein kinase superfamily protein;(source:Araport11) |
AT3G57720 | Protein kinase superfamily protein;(source:Araport11) |
AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
AT1G22275 | One of two nearly identical proteins (ZYP1a) identified by similarity to transverse filament (TF) proteins. These proteins are involved in chromosome synapsis during meiosis I and localize to the synaptonemal complex (SC). Single mutants have reduced fertility and double mutants (induced by RNAi) have severely reduced fertility. |
AT1G44318 | Aldolase superfamily protein;(source:Araport11) |
AT4G26200 | Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA. |
AT4G37770 | Encodes an auxin inducible ACC synthase. |
AT1G12010 | Encodes a protein that appears to have 1-amino-cyclopropane-1-carboxylic acid oxidase activity based on mutant analyses. The mRNA is cell-to-cell mobile. |
AT4G11280 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family The mRNA is cell-to-cell mobile. |
AT1G76690 | Encodes one of the closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Shows activity towards 2,4,6-trinitrotoluene. Expressed predominately in root. Predicted to be a cytosolic protein. |
AT5G23020 | methylthioalkymalate synthase-like. Also known as 2-isopropylmalate synthase (IMS2). encodes a methylthioalkylmalate synthase involved in the biosynthesis of aliphatic glucosinolates which accepts all the omega-methylthio-2-oxoalkanoic acids needed to form the known C3 to C8 glucosinolates in Arabidopsis. The mRNA is cell-to-cell mobile. |
AT3G14290 | Encodes 20S proteasome subunit PAE2 (PAE2) that has RNase activity. |
AT2G26800 | Mutant has increased seed ile, leu and val as well as his and arg. |
AT2G17370 | Encodes a 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) that is involved in the synthesis of sterol and triterpenoid compounds. |
AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
AT2G26250 | epidermis-specific, encodes KCS10, a putative 3-ketoacyl-CoA synthase. probably involved in the synthesis of long-chain lipids found in the cuticle. |
AT2G28630 | Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G04220 | Encodes KCS2, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G71160 | Encodes KCS7, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G47290 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
AT2G26930 | Encodes a 4-(cytidine 5'-phospho)-2-C-methyl-D-erithritol kinase. |
AT3G21240 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, 5-OH-ferulic acid and cinnamic acid. At4CL2 was unable to use sinapic acid as substrate. |
AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
AT2G18250 | At2g18250 encodes pantetheine-phosphate adenylyltransferase catalyzing the formation of dephospho-CoA from pantetheine 4'-phosphate. The enzyme is involved in coenzyme A biosynthesis. |
AT5G24410 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
AT5G67030 | Encodes a single copy zeaxanthin epoxidase gene that functions in first step of the biosynthesis of the abiotic stress hormone abscisic acid (ABA). Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
AT1G52340 | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
AT1G16540 | Encodes molybdenum cofactor sulfurase. Involved in Moco biosynthesis. Involved in the conversion of ABA-aldehyde to ABA, the last step of abscisic acid (ABA) biosynthesis. sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.N terminal domain is similar to bacterial NifS suggesting a common mechanism for sulphur mobilization and transfer. Also involved in protein import into chloroplasts. |
AT2G40220 | Encodes a member of the DREB subfamily A-3 of ERF/AP2 transcription factor family (ABI4). The protein contains one AP2 domain. There is only one member in this family. Involved in abscisic acid (ABA) signal transduction, ABA-mediated glucose response, and hexokinase-dependent sugar responses. Acts downstream of GUN1 in retrograde signaling. Expressed most abundantly in developing siliques and to a lesser degree in seedlings. |
AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
AT1G66600 | A member of WRKY Transcription Factor; Group III. Involved in the regulation of plant responses to ABA and drought stress. |
AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile. |
AT3G54770 | Encodes a putative RNA binding protein that is localized in the nucleus and affects ABA-regulated seed germination of Arabidopsis. |
AT5G66070 | E3 ubiquitin ligase that functions in negative regulation of ABA signaling. |
AT1G60600 | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport. |
AT4G33680 | Encodes an L,L-diaminopimelate aminotransferase. Involved in disease resistance against Pseudomonas syringae. mutants have elevated SA levels, a low level of spontaneous cell death, callose deposition, and enlarged cells in leaves. genetically maps on chr 4 between L23H3 and nga1139. |
AT5G42630 | Encodes a member of the KANADI family of putative transcription factors. Involved in integument formation during ovule development and expressed at the boundary between the inner and outer integuments. It is essential for directing laminar growth of the inner integument.Along with KAN1 and KAN2, KAN4 is involved in proper localization of PIN1 in early embryogenesis. |
AT5G14850 | Encodes a putative mannosyltransferase homolog to human PIG-B and yeast GPI10, both of which are involved in the biosynthesis of glycosylphosphatidylinositol (GPI) anchors. Disruption of the gene affects COBRA-LIKE10 localization, a GPI-anchored protein (GPI-AP) important for pollen tube growth and guidance. |
AT2G36080 | Encodes a plant-specific B3 DNA-binding domain transcription factor. Has transcription repressor activity. |
AT2G27150 | Encodes the aldehyde oxidase delta isoform catalyzing the final step in abscisic acid biosynthesis. |
AT4G14400 | encodes a novel protein with putative ankyrin and transmembrane regions. It is a member of one of the largest uncharacterized gene families in higher plants. The gene is involved in resistance to Pseudomonas syringae. |
AT1G64810 | Encodes a chloroplast localized RNA binding protein that is involved in group II intron splicing. Splicing defects can account for the loss of photosynthetic complexes in apo1 mutants. |
AT3G03480 | acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase;(source:Araport11) |
AT1G36180 | acetyl-CoA carboxylase 2 (ACC2) The mRNA is cell-to-cell mobile. |
AT2G42090 | actin related gene or pseudogene, based on sequence divergence and lack of expression |
AT3G46520 | Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development. |
AT2G33385 | actin-related protein C2B;(source:Araport11) |
AT4G29140 | Encodes Activated Disease Susceptibility 1 (ADS1), a putative MATE (multidrug and toxic compound extrusion) transport protein that negatively regulates plant disease resistance. |
AT3G12890 | Encodes a protein belonging to a class of CCT (CONSTANS, CONSTANS-like, TOC1) domain proteins. The protein contains a 43 amino acid-long sequence with high homology to the CCT domain but does not have any B-box or GATA-type zinc finger domains. Functions as a transcriptional activator and regulates the expression of at least a subset of sugar-inducible genes. |
AT1G20560 | acyl activating enzyme 1;(source:Araport11) |
AT1G65890 | acyl activating enzyme 12;(source:Araport11) |
AT5G16370 | acyl activating enzyme 5;(source:Araport11) |
AT5G23050 | acyl-activating enzyme 17;(source:Araport11) |
AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
AT5G16240 | Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
AT4G27780 | Encodes acyl-CoA-binding protein with ankyrin repeats The mRNA is cell-to-cell mobile. |
AT4G16760 | Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate. |
AT1G06120 | Membrane bound acyl-lipid desaturases which can perform Δ9 desaturation. |
AT1G10730 | Clathrin adaptor complexes medium subunit family protein;(source:Araport11) |
AT4G22570 | Encodes an adenine phosphoribosyltransferase (APT; EC 2.4.2.7), which is a constitutively expressed enzyme involved in the one-step salvage of adenine to AMP. APT3 has higher affinity for zeatin, isopentenyladenine and benzyladenine than APT1 but lower Vmax than APT1. |
AT4G12440 | adenine phosphoribosyl transferase 4;(source:Araport11) |
AT2G47420 | Encodes a putative rRNA dimethyltransferase. |
AT5G48300 | Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS1 is the major small subunit isoform present in all plant tissues tested. The mRNA is cell-to-cell mobile. |
AT1G05610 | Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS2 is a minor small subunit isoform present in all plant tissues tested. |
AT5G04720 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. The mRNA is cell-to-cell mobile. |
AT1G22130 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL104 is expressed in pollen.It forms heterodimers with other MICK family members (AGL65 and AGL30). Involved in late stages of pollen development and pollen tube growth. |
AT1G65360 | Encodes AGL23, a Type I MADS-box gene that controls female gametophyte development and the biogenesis of organelles during embryo development. |
AT2G03060 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL30 is expressed in pollen.It forms heterodimers with other MICK family members. |
AT5G65050 | Originally published as Agamous like MADS-box protein AGL31. One of a group of MADS box genes involved in control of flowering time. Four variant sequences have been identified for this locus but have not been characterized for differences in expression pattern and/or function. |
AT5G27130 | AGAMOUS-like 39;(source:Araport11) |
AT2G26880 | AGAMOUS-like 41;(source:Araport11) |
AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
AT5G51860 | Encodes a MADS-box transcription factor involved in floral transition. |
AT5G58890 | AGAMOUS-like 82;(source:Araport11) |
AT5G49490 | AGAMOUS-like 83;(source:Araport11) |
AT1G31630 | AGAMOUS-like 86;(source:Araport11) |
AT3G66656 | AGAMOUS-like 91;(source:Araport11) |
AT5G04640 | AGAMOUS-like 99;(source:Araport11) |
AT1G60880 | Root Specific |
AT2G36350 | Member of AGC VIIIa Kinase gene family. |
AT2G13810 | ALD1 is a L-lysine alpha-aminotransferase. It is part of the pipecolic acid biosynthetic pathway, where it catalyzes the biochemical conversion of lysine to epsilon-amino-alpha-ketocaproic acid (KAC) which is subject to subsequent transamination, cyclization and isomerization to form 2,3-dehydropipecolic acid. |
AT5G65510 | Encodes one of three PLETHORA transcription factors required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. |
AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
AT4G01800 | Encodes the ATPase subunit of the chloroplast Sec translocation machinery which plays an essential role in chloroplast biogenesis and the regulation of photosynthesis, the absence of which triggers a retrograde signal, eventually leading to a reprogramming of chloroplast and mitochondrial gene expression. |
AT3G48170 | ALDH10A9 encodes a protein that can function as a betaine aldehyde dehydrogenase in vitro. The C-terminal amino acids of this protein direct GFP to the peroxisome suggesting that ALDH10A9 accumulates in this organelle. ALDH10A9 transcript levels rise in response to ABA, NaCl, chilling, methyl viologen, and dehydration stress. The enzyme can catalyze the formation of glycine betaine in vitro, but there are still questions about whether Arabidopsis makes this protective compound under natural conditions. This enzyme may be involved in oxidizing aminoaldehydes formed through polyamine metabolism. |
AT2G24270 | Encodes a protein with non-phosphorylating NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity. The activity of the enzyme was determined from leaf extracts; the enzyme has not been purified to confirm activity. |
AT1G23800 | Encodes a mitochondrial aldehyde dehydrogenase; nuclear gene for mitochondrial product. |
AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
AT1G04580 | Encodes aldehyde oxidase AAO4 preferentially expressed in developing seeds. |
AT2G37760 | Encodes an NADPH-dependent aldo-keto reductase that can act on a wide variety of substrates in vitro including aliphatic and aromatic aldehydes and steroids. Transcript levels for this gene are up-regulated in response to cold, salt, and drought stress. |
AT4G34860 | Plant neutral invertase family protein;(source:Araport11) |
AT4G04955 | Encodes an allantoinase which is involved in allantoin degradation and assimilation. Gene expression was induced when allantoin was added to the medium. The insertion mutant, ataln m2-1, did not grow well on the MS medium where allantoin, instead of ammonium nitrate, was supplied. |
AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
AT1G76130 | alpha-amylase, putative / 1,4-alpha-D-glucan glucanohydrolase, putative, strong similarity to alpha-amylase GI:7532799 from (Malus x domestica);contains Pfam profile PF00128: Alpha amylase, catalytic domain. Predicted to be secreted based on SignalP analysis. |
AT5G08370 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
AT5G26120 | alpha-L-arabinofuranosidase 2;(source:Araport11) |
AT2G44980 | SNF2 domain-containing protein / helicase domain-containing protein;(source:Araport11) |
AT2G29990 | alternative NAD(P)H dehydrogenase 2;(source:Araport11) |
AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile. |
AT1G32350 | alternative oxidase 1D;(source:Araport11) |
AT1G77380 | Amino acid permease which transports basic amino acids. |
AT1G44100 | amino acid permease 5 |
AT5G49630 | Is a high affinity amino acid transporter capable of transporting aspartate and tryptophan. May be involved in the amino acid uptake from xylem. |
AT4G21120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. The mRNA is cell-to-cell mobile. |
AT3G25585 | aminoalcoholphosphotransferase (AAPT2) |
AT4G36760 | Arabidopsis aminopeptidase P1 The mRNA is cell-to-cell mobile. |
AT1G72700 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT4G13510 | Encodes a plasma membrane localized ammonium transporter. Contains a cytosolic trans-activation domain essential for ammonium uptake. The mRNA is cell-to-cell mobile. |
AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
AT3G05870 | Subunit of the anaphase promoting complex, a ubiquitin ligase complex that regulates progression through the cell cycle. |
AT1G35720 | Encodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, β-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion. It is a Ca 2+-permeable transporter providing a molecular link between reactive oxygen species and cytosolic Ca 2+ in plants. The mRNA is cell-to-cell mobile. |
AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT4G28395 | related to lipid transfer proteins |
AT5G61160 | anthocyanin 5-aromatic acyltransferase 1;(source:Araport11) |
AT5G05730 | ASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis. ASA1 is induced by ethylene, and forms a link between ethylene signalling and auxin synthesis in roots. |
AT4G13040 | Encodes a member of the AP2/EREBP transcription factor family that has only one AP2 domain. It is a positive regulator of disease defense that functions upstream of SA accumulation. |
AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
AT3G04080 | Encodes an Golgi-localized integral membrane enzyme with nucleoside diphosphate activity that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.With respect to substrate specificity, APY1 shows the following preferences UTP>IDP>GDP. |
AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
AT3G57510 | Encodes ADPG1, a polygalacturonase protein involved in silique and anther dihiscence. Loss of function mutations have reduced seed set, indehiscent fruit and reduced pollen shedding. Required for release of cell wall-derived PR elicitors. |
AT2G37990 | ribosome biogenesis regulatory protein (RRS1) family protein;(source:Araport11) |
AT3G15460 | Encodes one of two Arabidopsis orthologs of yeast BRX1, a protein involved in maturation of the large ribosomal subunit. The proteins are mainly localized in nucleolus. Mutant plants are affected in pre-rRNA processing. |
AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
AT4G33920 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G66080 | Type 2C protein phosphatase located in the plasma membrane. Functions in heat shock response memory mantainance. |
AT2G28130 | NSE5 subunit of the SMC5/6 complex. |
AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
AT4G17245 | RING/U-box superfamily protein;(source:Araport11) |
AT1G28040 | RING/U-box superfamily protein;(source:Araport11) |
AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
AT4G09100 | RING/U-box superfamily protein;(source:Araport11) |
AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
AT1G53820 | RING/U-box superfamily protein;(source:Araport11) |
AT3G60966 | RING/U-box superfamily protein;(source:Araport11) |
AT5G05910 | RING/U-box superfamily protein;(source:Araport11) |
AT2G34000 | RING/U-box superfamily protein;(source:Araport11) |
AT1G21630 | TPLATE Adaptor complex subunit. |
AT5G61670 | Encodes a close homolog of the Cauliflower OR (Orange) protein that is located in the chloroplast of light grown organs but in the nucleus of etiolated cotyledons. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich zinc finger domain that is highly specific to DnaJ-like molecular chaperons. The AtOR protein interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis. |
AT5G06130 | Encodes an OR(orange)-like protein that interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis. |
AT5G55240 | Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
AT2G40360 | Encodes BOP1, an ortholog of Block of cell proliferation (BOP) protein. A T-DNA null allele of the BOP1 gene is lethal, and a 50% decrease in transcript accumulation is sufficient to cause severe developmental defects linked to defective cell division. |
AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
AT3G61640 | arabinogalactan protein 20;(source:Araport11) |
AT3G57690 | Encodes a putative arabinogalactan-protein (AGP23). |
AT5G40730 | Encodes an arabinogalactan-protein (AGP24). |
AT3G06360 | Encodes an arabinogalactan-protein (AGP27). |
AT4G40090 | arabinogalactan protein 3;(source:Araport11) |
AT5G24105 | Encodes a putative arabinogalactan-protein (AGP41). |
AT5G61980 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD1 belongs to the class 1, together with AGD2, AGD3 and AGD4. Not expressed in hypocotyls and cotyledons. |
AT1G10870 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD4 belongs to the Class 1, together with AGD1, AGD2, and AGD3. |
AT1G59980 | ARG1-like 2;(source:Araport11) |
AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
AT1G31290 | ARGONAUTE 3;(source:Araport11) |
AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
AT1G16060 | Encodes ADAP, an AP2-domain protein that interacts with ARIA. ADAP is a positive regulator of the ABA response and is also involved in regulating seedling growth. |
AT2G31760 | RING/U-box superfamily protein;(source:Araport11) |
AT1G05880 | Encodes ARI12 (ARIADNE 12). ARI12 belongs to a family of `RING between RING fingers' (RBR) domain proteins with E3 ligase activity. Expression of ARI12 is induced by UV-B exposure. |
AT1G05890 | RING/U-box superfamily protein;(source:Araport11) |
AT2G31770 | RING/U-box superfamily protein;(source:Araport11) |
AT5G19330 | Encodes an armadillo repeat protein involved in the abscisic acid response. The protein interacts with a transcription factor, ABF2, which controls ABA-dependent gene expression via the G-box-type ABA-responsive elements. |
AT3G26600 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
AT3G11900 | encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. |
AT4G35000 | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
AT3G16150 | Encodes an asparaginase that catalyzes the degradation of L-asparagine to L-aspartic acid and ammonia. The mRNA is cell-to-cell mobile. |
AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
AT5G11520 | Encodes the chloroplastic isozyme of aspartate aminotransferase. Involved in aspartate biosynthesis and nitrogen metabolism. mRNA is expressed in senescing leaves. |
AT3G02020 | encodes a monofunctional aspartate kinase |
AT1G11910 | Encodes an aspartic proteinase that forms a heterodimer and is stable over a broad pH range (ph 3-8). |
AT1G65620 | required for formation of a symmetric flat leaf lamina, encodes a member of a family of proteins characterized by cysteine repeats and a leucine zipper; involved in KNOX gene regulation. Acts together with ASL1 in proximal-distal symmetry determination. Forms a complex with AS1 that binds to the BP promoter and leads to silencing of BP. |
AT1G16530 | ASYMMETRIC LEAVES 2-like 9;(source:Araport11) |
AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
AT3G04590 | AHL proteins contain two conserved structural units, the AT-hook motif and DUF296 domain. |
AT4G22770 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT4G35390 | AT-hook protein of GA feedback 1;(source:Araport11) |
AT1G14490 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT5G46640 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT3G55560 | AT-hook protein of GA feedback 2;(source:Araport11) |
AT1G20900 | Encodes an AT hook domain containing protein that acts redundantly with SOB3 to modulate hypocotyl growth inhibition in response to light. |
AT3G28270 | AFL1 was first identified by immunoscreening an Arabidopsis expression library with antisera recognizing mammalian β1-integrin. It is a peripheral membrane protein associated with endomembranes and plasmamembrane. Based on overexpression and knockdown phenotypes, AFL1 is postulated to function in regulation of growth and proline accumulation in response to drought. AFL1 protein co-localizes with clatharin coated vesicles and has been shown to interact with itself and several endomembrane associated proteins. |
AT4G09550 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
AT3G22890 | encodes ATP sulfurylase, the first enzyme in the sulfate assimilation pathway of Arabidopsis. It may also participate in selenium metabolism. The mRNA is cell-to-cell mobile. |
AT3G47770 | ABC2 homolog 5;(source:Araport11) |
AT3G47790 | ABC2 homolog 7;(source:Araport11) |
AT2G36910 | Belongs to the family of ATP-binding cassette (ABC) transporters. Also known as AtMDR1.Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AT3G28860. PGP1 mediates cellular efflux of IAA and interacts with PIN genes that may confer an accelerated vectoral component to PGP-mediated transport. The non-polar localization of PGP1 at root and shoot apices, where IAA gradient-driven transport is impaired, may be required to confer directionality to auxin transport in those tissues. The mRNA is cell-to-cell mobile. |
AT1G28010 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
AT3G28380 | P-glycoprotein 17;(source:Araport11) |
AT4G25960 | P-glycoprotein 2;(source:Araport11) |
AT2G39480 | P-glycoprotein 6;(source:Araport11) |
AT5G46540 | P-glycoprotein 7;(source:Araport11) |
AT3G62700 | member of MRP subfamily |
AT2G34660 | encodes a multidrug resistance-associated protein that is MgATP-energized glutathione S-conjugate pump. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. The mRNA is cell-to-cell mobile. |
AT1G04120 | encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C. |
AT3G13090 | member of MRP subfamily |
AT3G21250 | member of MRP subfamily |
AT4G19210 | member of RLI subfamily The mRNA is cell-to-cell mobile. |
AT4G30300 | member of NAP subfamily |
AT5G60790 | Member of GCN subfamily; essential for translation inhibition under cold stress through interacting with GCN2 to phosphorylate eukaryotic translation initiation factor 2. GCN1 regulated gens are involved in flower development, seed dormancy and seed development, response to osmotic stress, amino acid biosynthesis, photosynthesis, cell wall organization, protein transport and localization, lipid biosynthesis, transcription, macroautophagy, proteolysis and cell death. |
AT1G51460 | ABCG13 encodes a member of the ATP-binding cassette (ABC) transporter family protein. Mutants show defects in petal elongation resulting in a folded petal phenotype. |
AT3G55130 | Encodes a vacuole localized protein of the ABC transporter White-Brown Complex (WBC) family. When overexpressed in planta, confers resistance to kanamycin. |
AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
AT5G19410 | ABC-2 type transporter family protein;(source:Araport11) |
AT1G15210 | pleiotropic drug resistance 7;(source:Araport11) |
AT3G30842 | pleiotropic drug resistance 10;(source:Araport11) |
AT4G25750 | ABC-2 type transporter family protein;(source:Araport11) |
AT1G15520 | ABC transporter family involved in ABA transport and resistance to lead. Localizes to plasma membrane. Upregulated by lead. Expressed in leaves, flowers, stomata and roots. |
AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
AT5G52860 | ABC-2 type transporter family protein;(source:Araport11) |
AT1G19800 | Encodes a permease-like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
AT2G37300 | transmembrane protein;(source:Araport11) |
AT5G61810 | Encodes the predominant of three APC isoforms in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
AT3G22150 | Involved in RNA editing of plastid atpF and mitochondrial nad5. |
AT4G18980 | Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression. |
AT4G29670 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
AT3G22910 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT3G13970 | Autophagy protein. |
AT3G19190 | Encodes autophagy-related 2 (ATG2). The mRNA is cell-to-cell mobile. |
AT3G61710 | Encodes autophagy protein 6 (ATG6), required for pollen germination and plant development. |
AT4G04620 | Autophagy protein. |
AT3G06420 | Autophagy protein. |
AT4G30790 | Encodes autophagy-related 2 (ATG11) |
AT1G77850 | Encodes a transcriptional regulator that directly binds to the promoter of MYB108 and plays a crucial role in anther dehiscence, pollen wall pattern formation, tapetum development, and auxin signal transduction in anthers. It is post-transcriptionally regulated by miR160 and regulates early auxin response genes. |
AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
AT3G26810 | Auxin F box protein, the dominant auxin receptor in roots. |
AT1G22220 | F-box family protein;(source:Araport11) |
AT2G33310 | Auxin induced gene, IAA13 (IAA13). |
AT5G39720 | avirulence induced protein 2 like protein;(source:Araport11) |
AT1G33960 | Identified as a gene that is induced by avirulence gene avrRpt2 and RPS2 after infection with Pseudomonas syringae pv maculicola strain ES4326 carrying avrRpt2 |
AT3G10960 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
AT5G50300 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
AT4G12470 | Encodes AZI1 (AZELAIC ACID INDUCED 1). Involved in the priming of salicylic acid induction and systemic immunity triggered by pathogen or azelaic acid. Targeting if AZI1 to chloroplasts is increased during SAR induction and that localization requires the PRR domain.It is involved in the uptake and movement of the azelaic acid signal. AZI1 uses a previously undescribed variant of the signal anchor proteins mechanism to target plastids. AZI1 uses a bipartite N-terminal signature: a non-cleavable TMD that anchors the protein to membranes, followed by a proline rich region with features that are shared with bona fide chloroplastic transit peptides. flg22 MAMP treatment strongly induces AZI1/EARLI1 protein levels and increases their relative enrichment in the plastid fraction. |
AT2G33500 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT1G25440 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT1G75540 | Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. The mRNA is cell-to-cell mobile. |
AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
AT4G15250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT2G47890 | Acts as a positive regulator of red light signaling; overexpression causes markedly shortened hypocotyls under various light states. Binds to the HY5 promoter to activate its transcription, while both BBX21 and HY5 associate with its promoter to positively regulate its expression. T |
AT4G34700 | Encodes the B22 subunit of eukaryotic mitochondrial Complex I. Mutation in the gene display pleiotropic phenotypes including shorter roots, smaller plants and delayed flowering. The mRNA is cell-to-cell mobile. |
AT1G69990 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G35260 | CAAX protease self-immunity protein;(source:Araport11) |
AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
AT4G20270 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. The mRNA is cell-to-cell mobile. |
AT2G31210 | Encodes a bHLH transcription factor that together with bHLH089 and bHLH010 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. |
AT3G19860 | A basic helix?loop?helix (bHLH) transcription factor which acts as an essential part of the iron deficiency signaling pathway. The phosphorylated form of URI accumulates under Fe deficiency, forms heterodimers with subgroup IVc proteins, and induces transcription of bHLH38/39/100/101. These transcription factors in turn heterodimerize with FIT and drive the transcription of IRT1 and FRO2 to increase Fe uptake. |
AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT3G54620 | bZIP transcription factor-like protein mRNA |
AT5G49450 | Encodes a transcription activator is a positive regulator of plant tolerance to salt, osmotic and drought stresses. |
AT2G40620 | Basic leucine zipper transcription factor. Localizes from cytoplasm to the nucleus under heat stress. |
AT2G21230 | bZIP30 is a transcriptional activator that is involved in regulation of growth and development of reproductive organs. It interacts with a number of developmental regulators including WUS, HEC1, KNAT1/BP, KNAT2, JAB, BEL1, and NGA1. |
AT5G38800 | basic leucine-zipper 43;(source:Araport11) |
AT3G49760 | basic leucine-zipper 5;(source:Araport11) |
AT1G68880 | basic leucine-zipper 8;(source:Araport11) |
AT2G35550 | basic pentacysteine 7;(source:Araport11) |
AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT1G32150 | Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members. |
AT1G17880 | basic transcription factor 3;(source:Araport11) |
AT3G10815 | RING/U-box superfamily protein;(source:Araport11) |
AT3G13430 | RING/U-box superfamily protein;(source:Araport11) |
AT1G12060 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
AT2G35940 | Encodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm. |
AT4G36870 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw1/saw2 may act redundantly to repress BP in leaves. Regulates together with BLH4 demethylesterification of homogalacturonan in seed mucilage. |
AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
AT5G41410 | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
AT1G65880 | Encodes a benzoate-CoA ligase. Involved in the biosynthesis of benzoyloxyglucosinolate in Arabidopsis seeds. |
AT1G69010 | Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
AT4G18890 | BES1/BZR1 homolog 3;(source:Araport11) |
AT1G58180 | beta carbonic anhydrase 6;(source:Araport11) |
AT3G13750 | beta-galactosidase, glycosyl hydrolase family 35 The mRNA is cell-to-cell mobile. |
AT4G27830 | Encodes a beta-glucosidase that may be responsible for acyl-glucose-dependent anthocyanin glucosyltransferase activity in Arabidopsis. In vitro efforts to demonstrate AAGT activity for BGLU10 have been unsuccessful but experiments with mutants in this gene suggest at least an indirect involvement in anthocyanin formation. |
AT1G02850 | beta glucosidase 11;(source:Araport11) |
AT3G21370 | beta glucosidase 19;(source:Araport11) |
AT5G16580 | beta glucosidase 2;(source:Araport11) |
AT2G44460 | Beta-glucosidase, major myrosinase which initiates sulfur reallocation by hydrolyzing particular GL species, conferring sulfur deficiency tolerance, especially during early development. |
AT5G24550 | beta glucosidase 32;(source:Araport11) |
AT1G47600 | Encodes a myrosinase. Over-expression led to a glucosinolate profile change. |
AT1G51470 | Encodes a myrosinase. |
AT5G54570 | beta glucosidase 41;(source:Araport11) |
AT1G61820 | beta glucosidase 46;(source:Araport11) |
AT5G65640 | bHLH093/NFL encodes a bHLH transcription factor involved in GA mediated control of flowering time. Mutants are non-flowering in short days and phenotype can be reversed with GA application. Based on the expression of GA biosynthetic genes in the mutant, it likely acts through regulation of GA metabolism. Its expression shows developmental stage and tissue specificity. In short days it is expressed mainly in root tips and SAM, with weak expression in cotyledons throughout development. In LD GUS activity was observed in the hypocotyl and in root tips and SAM throughout the developmental stages. |
AT1G62710 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins. |
AT3G57240 | encodes a member of glycosyl hydrolase family 17 |
AT5G20330 | beta-1,3-glucanase 4;(source:Araport11) |
AT3G23920 | Encodes a chloroplast beta-amylase. Is necessary for leaf starch breakdown in the absence of BAM3.Activity of BAM1 increases 4 days after osmotic stress. BAM1 has a higher temperature optimum than BAM3 (PMID:25293962). |
AT2G32290 | beta-amylase 6;(source:Araport11) |
AT5G64570 | Encodes a beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
AT1G55120 | Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. |
AT4G26140 | putative beta-galactosidase |
AT2G16730 | putative beta-galactosidase (BGAL13 gene) |
AT1G77410 | beta-galactosidase 16;(source:Araport11) |
AT4G36360 | putative beta-galactosidase (BGAL3 gene) |
AT5G56870 | beta-galactosidase 4;(source:Araport11) |
AT5G39990 | Encodes GlcAT14A, a beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan. The protein was localized to the Golgi apparatus when transiently expressed in Nicotiana benthamiana. Plays a role in cell elongation during seedling growth. |
AT1G65590 | Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane. |
AT5G49360 | Encodes a bifunctional {beta}-D-xylosidase/{alpha}-L-arabinofuranosidase required for pectic arabinan modification. Located in the extracellular matrix. Gene is expressed specifically in tissues undergoing secondary wall thickening. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
AT1G19660 | Wound-responsive family protein;(source:Araport11) |
AT3G02260 | Calossin-like protein required for polar auxin transport. Involved in regulating sugar response and C/N balance. |
AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
AT4G12030 | Required for the biosynthesis of methionine-derived glucosinolates. Involved in the transport of 2-keto acids between chloroplasts and the cytosol. |
AT5G15530 | biotin carboxyl carrier protein isoform 2 (BCCP2) mRNA, |
AT2G30330 | Putative homolog of mammalian BLOC-1 Subunit 1. Protein - protein interaction with BLOS2 and also with SNX1.Located in endomembrane system and hypothesized to be involved in endomembrane transport. |
AT4G14480 | Encodes a putative Ser/Thr protein kinase, BLUS1 (BLUE LIGHT SIGNALING1). BLUS1 functions as a phototropin substrate and primary regulator of stomatal control to enhance photosynthetic CO2 assimilation under natural light conditions. |
AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
AT5G53400 | Encodes BOBBER1 (BOB1), a non-canonical small heat shock protein required for both development and thermotolerance. BOB1 is cytoplasmic at basal temperatures but forms heat shock granules containing canonical small heat shock proteins at high temperatures. The mRNA is cell-to-cell mobile. |
AT5G45100 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
AT1G08860 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Overexpression of this gene suppresses bon1-1 phenotypes. Double mutant analyses with bon1-1 suggest that BON1 and BON3 have overlapping functions in maintaining cellular homeostasis and inhibiting cell death. |
AT3G19540 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
AT1G49840 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
AT3G18550 | Encodes a TCP transcription factor, closely related to teosinte branched1, arrests axillary bud development and prevents axillary bud outgrowth. Role in flowering control. |
AT1G10070 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. Involved in cell wall development. |
AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
AT4G35230 | Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
AT1G01740 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
AT3G54030 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
AT1G80210 | Mov34/MPN/PAD-1 family protein;(source:Araport11) |
AT2G35600 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
AT5G20540 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
AT4G30610 | Encodes a secreted glycosylated serine carboxypeptidase with broad substrate preference that is involved in brassinosteroid signalling via BRI1. It is proteolytically processed in vivo by a separate as yet unidentified protease. |
AT4G03080 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
AT1G08420 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
AT1G19350 | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes. Works with BRAVO to regulate QC division in the root. AT1G19350.3(BES1-L) is the long isoform of BES1. It contains an additive N-terminal NLS compared with the canonical BES1-S. This recently evolved isoform is expressed specifically in the Arabidopsis lineage |
AT2G01950 | Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein. |
AT3G13380 | Similar to BRI, brassinosteroid receptor protein. |
AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
AT3G18290 | Encodes BRUTUS (BTS), a putative E3 ligase protein with metal ion binding and DNA binding domains, which negatively regulates the response to iron deficiency. The mRNA is cell-to-cell mobile. |
AT5G67480 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
AT5G19000 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
AT1G49910 | Encodes a homolog of the yeast and human BUB3 (BUDDING UNINHIBITED BY BENZYMIDAZOL 3) protein. Yeast and human BUB3s function in spindle assembly checkpoint control. |
AT5G18930 | S-adenosylmethionine decarboxylase family member. |
AT3G48250 | Encodes a pentatricopeptide repeat protein implicated in splicing of intron 1 of mitochondrial nad7 transcripts. |
AT2G46080 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
AT5G51990 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF4). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to drought stress and abscisic acid treatment, but not to low temperature. |
AT4G25490 | Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
AT4G17470 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G34050 | Methyltransferase in the lignin biosynthetic pathway. |
AT4G33000 | Encodes a member of the calcineurin B-like calcium sensor gene family. Mediates salt tolerance by regulating ion homeostasis in Arabidopsis. |
AT1G80910 | vacuolar fusion CCZ1-like protein (DUF1712);(source:Araport11) |
AT5G17860 | Cation/Ca2+ exchanger family member. Double mutants with CCX4 show delayed greening and defects in ROS response. |
AT4G22120 | Calcium-permeable stretch activated cation channel. |
AT5G23060 | Encodes a chloroplast-localized protein that modulates cytoplasmic Ca2+ concentration and is crucial for proper stomatal regulation in response to elevations of external Ca2+. Phosphorylation of this protein is dependent on calcium. |
AT4G21940 | member of Calcium Dependent Protein Kinase |
AT4G04710 | member of Calcium Dependent Protein Kinase |
AT4G04700 | member of Calcium Dependent Protein Kinase |
AT2G41010 | Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress. |
AT5G37780 | encodes a calmodulin that is involved in thigmomorphogenesis. Gene expression is rapidly induced upon a variety of abiotic stimuli, including water spray, subirrigation, wind, touch, wounding, or darkness. |
AT3G10190 | Encodes a protein with sequence similarity to calmodulins. Loss of function mutations have decreased response to chitin elicitors suggesting a role in plant response to fungal pathogens. |
AT5G18520 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. The mRNA is cell-to-cell mobile. |
AT4G32810 | Encodes a protein with similarity to carotenoid cleaving deoxygenases, the enzymes that cleave beta-carotene. Involved in the production of a graft transmissable signal to suppress axillary branching. Protein is localized to chloroplast stroma and expressed primarily in root tip. Mutants in the gene exhibit increased shoot branching, and light-dependent defects in hook opening and hypocotyl/root elongation. Only upregulated by auxin in the root and hypocotyl, and this is not required for the inhibition of shoot branching. |
AT1G72710 | Encodes a member of the casein kinase 1 protein family that is localized to the cytoplasm and nucleus. The mRNA is cell-to-cell mobile. |
AT5G67380 | Casein kinase II (CK2) catalytic subunit (alpha 1). One known substrate of CK2 is Phytochrome Interacting Factor 1 (PIF1). CK2-mediated phosphorylation enhances the light-induced degradation of PIF1 to promote photomorphogenesis. |
AT4G14340 | Phosphorylates serine or threonine residues that are near and C-terminal to acidic side chains on a variety of target proteins. Member of CKL gene family (CKL-C group). |
AT1G04440 | Member of CKL gene family (CKL-C group). |
AT4G14670 | This locus was originally annotated as encoding ClpB2 (also referred to as Hsp92.7), which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. However, according to Lee et al. (2007, Plant Journal, 49:115-127), there is no evidence for expression of an appropriate-sized mRNA from this locus. Re-annotation of the genome indicates that this locus potentially encodes a 68.8-kDa protein, containing only the N-terminal two thirds of the originally predicted open reading frame. This locus contains a 626-bp deletion in WS ecotype compared with the Col ecotype, which eliminates residues 1-86 of the predicted protein. |
AT1G03700 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G15610 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G14380 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G39518 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G34600 | CAF2 is a peptide hormone expressed in the root stele that specifically binds the endodermis-expressed leucine-rich repeat receptor kinase GASSHO1 (GSO1)/SCHENGEN3 and its homolog, GSO2. Together with CAF1 it is required for formation of the casparian band. |
AT3G11550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G35600 | Encodes a receptor-like cytoplasmic kinase that acts as a spatial inhibitor of cell separation. Analysis of the cDNA previously described in Meiners et al., 1991 revealed mistakes in the predicted open reading frame. The mRNA is cell-to-cell mobile. |
AT1G73875 | Deadenylase. |
AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile. |
AT3G51860 | cation exchanger 3;(source:Araport11) |
AT5G01490 | Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress. |
AT3G14070 | Involved in cation (K, Na and Mn) homeostasis and transport |
AT4G23700 | member of Putative Na+/H+ antiporter family |
AT1G79400 | member of Putative Na+/H+ antiporter family |
AT1G05580 | member of Putative Na+/H+ antiporter family |
AT5G58460 | member of Putative Na+/H+ antiporter family |
AT5G01690 | member of Putative Na+/H+ antiporter family |
AT1G08140 | member of Putative Na+/H+ antiporter family |
AT1G08135 | cation/H+ exchanger 6B;(source:Araport11) |
AT1G06970 | member of Putative Na+/H+ antiporter family |
AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
AT5G45810 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.5), which has also been reported as a member of the CBL-interacting protein kinases (CIPK19). |
AT3G23000 | Encodes a serine/threonine protein kinase with similarities to CBL-interacting protein kinases, SNF1 and SOS2. The mRNA is cell-to-cell mobile. |
AT4G24400 | Encodes a CBL (calcineurin B-like calcium sensor proteins) -interacting serine/threonine protein kinase. Regulates the low-affinity phase of the primary nitrate response. The mRNA is cell-to-cell mobile. |
AT5G10860 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
AT3G26740 | transcripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
AT5G39420 | CDC2C;(source:Araport11) |
AT5G02800 | Encodes CDL1, a homolog of CDG1. CDL1 positively regulates brassinosteroid signaling and plant growth. |
AT3G50530 | CDPK-related kinase |
AT3G13784 | cell wall invertase 5;(source:Araport11) |
AT1G22880 | cellulase 5;(source:Araport11) |
AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
AT5G64740 | Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The mRNA is cell-to-cell mobile. |
AT1G44120 | CELLULOSE SYNTHASE INTERACTIVE 2;(source:Araport11) |
AT4G24000 | encodes a protein similar to cellulose synthase |
AT2G32530 | encodes a gene similar to cellulose synthase |
AT5G16910 | encodes a gene similar to cellulose synthase. Located in Golgi membranes. The mRNA is cell-to-cell mobile. |
AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
AT3G50360 | CAM like protein with four EF-hand domains. Binds calcium. Loss of function mutants affect ABA regulation of guard cell channels and accumulation of stress responsive transcripts(PMID:28603528). |
AT2G43570 | chitinase;(source:Araport11) |
AT1G09340 | Encodes CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein. CRB is important for the proper functioning of the chloroplast. Mutations in CRB also affects the circadian system, altering the expression of both oscillator and output genes. The mRNA is cell-to-cell mobile. |
AT5G39520 | Plastid localized transmembrane protein involved in ABA mediated leaf senescence and stomatal movement. |
AT1G59720 | Pentatricopeptide Repeat Protein containing the DYW motif. Required for editing of multiple plastid transcripts. Endonuclease activity. |
AT1G05490 | Involved in gene silencing. Locus-specific regulator of 24nt-siRNA expression, works together with CLSY1-4 as the master regulators of essentially all Pol-IV-dependent 24nt-siRNAs. |
AT3G42670 | Encodes a nuclear localized SNF domain containing protein involved in RNA silencing. Mutants were identified in a screen for defects in the spread of RNA silencing. CLSY1 may affect production of dsRNA from the locus to be silenced. Locus-specific regulator of 24nt-siRNA expression, works together with CLSY2-4 as the master regulators of essentially all Pol-IV-dependent 24nt-siRNAs. |
AT5G44800 | Interacts with transcription factors involved in floral meristem identity and affects the expression of key floral regulators. Affects H3K27me3 and H3K4me3 levels at a subset of loci in the genome. |
AT4G25990 | chloroplast import apparatus CIA2-like. CIA2 is a transcription factor which upregulates chloroplast translocon genes |
AT1G68920 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G30490 | Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development. |
AT1G15950 | Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. The mRNA is cell-to-cell mobile. |
AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
AT2G23410 | Encodes cis-prenyltransferase involved in dolichol biosynthesis. |
AT3G58740 | Encodes a peroxisomal citrate synthase that is expressed in siliques and developing seeds. |
AT4G19810 | ChiC encodes a Class V chitinase that is a part of glycoside hydrolase family 18 based on CAZy groupings. It appears to primarily act as an exochitinase in vitro where it predominantly cleaves a chitobiose (GlcNAc)2 residue from the non-reducing end of a chitin oligosaccharide. However, it shows some minor endochitinase activity in vitro, as well. A putative 24 amino-acid signal peptide may direct this protein to the secretory system and it has been detected in cell wall apoplastic fluid. RT-PCR experiments demonstrate that ChiC transcript levels are increased in response to abscisisc acid, jasmonic acid, and NaCl stress. Microarray results also suggest that transcript levels rise in response to osmotic stress, two fungal pathogens, a bacterial pathogen, and the elicitor flagellin. The mRNA is cell-to-cell mobile. |
AT2G27250 | One of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. Belongs to a large gene family called CLE for CLAVATA3/ESR-related. Encodes a stem cell-specific protein CLV3 presumed to be a precursor of a secreted peptide hormone. The deduced ORF encodes a 96-amino acid protein with an 18-amino acid N-terminal signal peptide. The functional form of CLV3 (MCLV3) was first reported to be a posttranscriptionally modified 12-amino acid peptide, in which two of the three prolines were modified to hydroxyproline (Ito et al., Science 2006, 313:842; Kondo et al., Science 2006, 313:845). Ohyama et al. (2009) later reported that the active mature CLV3 is a 13-amino-acid arabinosylated glycopeptide (Nature Chemical Biology, 5:578). CLV3 binds the ectodomain of the CLAVATA1 (CLV1) receptor-kinase. Regulates shoot and floral meristem development. Required for CLAVATA1 receptor-like kinase assembly into a signaling complex that includes KAPP and a Rho-related protein. It restricts its own domain of expression, the central zone (CZ) of the shoot apical meristem (SAM), by preventing differentiation of peripheral zone cells, which surround the CZ, into CZ cells and restricts overall SAM size by a separate, long-range effect on cell division rate. CLE domain of CLV3 is sufficient for function. Results obtained from whole seedlings challenge the concept that the immune receptor FLS2 perceives the meristematic regulatory peptide CLV3p in mesophyll, seedlings, and SAM cells and that CLV3p contributes to SAM immunity against bacterial infection (PMID:22923673). |
AT1G70895 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT2G31081 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT2G34925 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The protein is expressed in leaf axils and the shoot apical meristem and is involved in axillary bud formation. |
AT4G13195 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770). The protein is expressed in the vascular system and is involved in axillary bud formation. |
AT1G26600 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
AT3G44340 | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. |
AT1G49970 | Encodes a ClpP-related sequence. Though similar to ClpP proteins, this does not contains the highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
AT4G17040 | HON5 (At4g17040) encodes the ClpR4 subunit of the chloroplast-localized Clp protease complex. hon mutations disturb plastid protein homeostasis, thereby activating plastid signaling and inducing stress acclimatization. |
AT5G53350 | CLP protease regulatory subunit CLPX mRNA, nuclear gene |
AT5G39930 | Encodes a protein with similarity to the CLP1 polyadenylation factor. |
AT5G50920 | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC (Translocon at the Inner envelope membrane of Chloroplasts) translocation machinery. Association of Hsp93 with the inner envelope membrane through its N domain is important for the functions of Hsp93 in vivo. |
AT4G10100 | molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
AT3G29810 | During the course of seed coat epidermal cell differentiation, COBRA-LIKE 2 plays a role in cellulose deposition into mucilage secretory cells of Arabidopsis seeds. COBRA-LIKE 2 affects mucilage solubility and cellulosic ray formation. |
AT2G31955 | COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 2. Encodes a protein involved in molybdenum cofactor biosynthesis. Homologous to E.coli moaA. Expression is abundant in all tissues examined, particularly in roots. Appears to have targeting signals for chloroplast or mitochondria. |
AT5G42900 | Acts with COR28 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
AT4G33980 | Acts with COR27 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
AT4G38240 | Encodes N-acetyl glucosaminyl transferase I, the first enzyme in the pathway of complex glycan biosynthesis. |
AT5G67370 | DUF1230 family protein (DUF1230);(source:Araport11) |
AT1G31780 | Encodes a component of the oligomeric Golgi (COG) complex. Found in pollen golgi apparatus. Loss of function results in defects in pollen tube growth resulting in lack of transmission through the pollen. |
AT5G53420 | Member of ASML2 family of CCT domain proteins.There is a preferential accumulation of RNA isoforms CCT101.1 and CCT101.2 in response to N-treatment, each isoform has different targets. |
AT5G15850 | Homologous to the flowering-time gene CONSTANS. |
AT5G57660 | CONSTANS-like 5;(source:Araport11) |
AT3G26940 | Receptor-like cytoplasmic kinase, RLCKVII subfamily. Overexpression causes abnormal differential and elongation growth after organ differentiation. |
AT5G05170 | Encodes a cellulose synthase isomer. CESA3 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA3, along with CESA1 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The xylem cells in primary root have reduced cell expansion and higher than normal lignification. |
AT2G32950 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light. The mRNA is cell-to-cell mobile. |
AT5G64920 | Encodes a RING-H2 protein that interacts with the RING finger domain of COP1. CIP8 exhibits a strong interaction with the E2 ubiquitin conjugating enzyme AtUBC8 through its N-terminal domain and promotes ubiquitination in an E2-dependent fashion in vitro. It is possible that the AtUBC8-CIP8 module might interact with COP1 in vivo, thereby participating in proteasome-mediated degradation of HY5. |
AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile. |
AT2G42490 | Peroxisome-localized copper amine oxidase involved in lateral root formation. |
AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
AT5G59040 | encodes a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast |
AT4G23600 | Encodes cystine lyase which is expected to be involved in amino acid metabolism, providing the plant with cysteine and the generation of precursors of ethylene biosynthesis. mRNA levels are elevated in response to wounding. |
AT1G69180 | Putative transcription factor with zinc finger and helix-loop-helix domains, the later similar to HMG boxes. Involved in specifying abaxial cell fate in the carpel. Four putative LFY binding sites (CCANTG) and two potential binding sites for MADS box proteins known as CArG boxes (CC(A/T)6GG) were found in the region spanning 3.8 Kb upstream of the CRC coding region. CRC targets YABBY genes such as YUC4 in gynoecium development. |
AT4G01710 | belongs to the DIS(distorted) gene family. Encodes a actin polymerization factor. Involved in cell expansion of trichome. |
AT3G14450 | RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain. |
AT1G30820 | Cytidine triphosphate synthase. |
AT4G02120 | Cytidine triphosphate synthase. |
AT2G34890 | Cytidine triphosphate synthase. |
AT2G23380 | Similar to the product of the Polycomb-group gene Enhancer of zeste. Catalytic component of the PRC2 complex.Required for stable repression of AG and AP3. Putative role in cell fate determination. Involved in the control of leaf morphogenesis. mutants exhibit curled, involute leaves. AGAMOUS and APETALA3 are ectopically expressed in the mutant. |
AT4G01150 | Integral thylakoid membrane protein required for proper grana stack curvature. |
AT4G30140 | Member of the GDSL lipase/esterase family of proteins that functions as cutinase. Expressed in pollen and at the zone of lateral root emergence. |
AT2G32010 | Encodes an inositol polyphosphate 5?-phosphatase (5PTase). Mediating phosphoinositide signaling. Involved in establishment of foliar vein patterns. |
AT2G28260 | member of Cyclic nucleotide gated channel family |
AT3G48010 | member of Cyclic nucleotide gated channel family |
AT5G14870 | Encodes a member of the cyclic nucleotide gated channel family that is asymmetrically localized to the plasma membrane at the growing tip of the pollen tube and is involved in pollen tube growth and pollen tube guidance to ovules. It likely directly transduces a cNMP signal into an ion flux that can produce a localized signal capable of regulating the pollen tip-growth machinery. Also functions as a Ca2+ permeable channel. |
AT1G16330 | core cell cycle genes |
AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
AT3G21870 | cyclin p2;(source:Araport11) |
AT1G76540 | Encodes a cyclin-dependent protein kinase involved in regulation of the G2/M transition of the mitotic cell cycle. Specifically binds to the cyclin CYCD4;1, expressed in shoot meristem, young leaves and vascular tissue during the G2/M phase. Required for proper organization of the shoot apical meristem and for hormone signaling. |
AT5G10270 | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. |
AT1G26790 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT4G34960 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT5G50260 | Encodes a papain-like cysteine protease involved in tapetal programmed cell death and pollen development.CEP1 is expressed specifically in the tapetum from stages 5 to 11 of anther development. The CEP1 protein first appears as a proenzyme in precursor protease vesicles, and is then transported to the vacuole and transformed into the mature enzyme before rupture of the vacuole. CEP1 was also released to the tapetal cell wall during late stage 6 and stage 7. After the tapetal cell wall degenerated, the CEP1 enzyme entered the callose wall from the degenerated tapetal cell wall and was probably involved in degeneration of the callose wall. |
AT3G48340 | KDEL-tailed cysteine endopeptidase. Mutants generated via RNAi show decreased lateral root growth. |
AT4G36880 | cysteine proteinase1;(source:Araport11) |
AT4G23210 | Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. |
AT4G23320 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G04490 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G04510 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G00970 | Encodes a cysteine-rich receptor-like protein kinase. |
AT1G05340 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT2G19570 | Encodes a cytidine deaminase that deaminates cytidine and deoxycytidine and is competitively inhibited by cytosine-containing compounds. |
AT2G45150 | cytidinediphosphate diacylglycerol synthase 4;(source:Araport11) |
AT3G60620 | cytidinediphosphate diacylglycerol synthase 5;(source:Araport11) |
AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
AT1G22840 | Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers. Double mutants with CYTC-2 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
AT1G16410 | member of CYP79F The mRNA is cell-to-cell mobile. |
AT4G15310 | a member of the cytochrome P450 gene family. molecular function unknown. |
AT4G12300 | member of CYP706A |
AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
AT2G30770 | Putative cytochrome P450; together with CYP71A12 produces dihydrocamalexic acid (DHCA), the precursor to the defense-related compound camalexin, which accumulates in the intercellular space and contributes to the resistance of mature Arabidopsis to P. syringae without directly inhibiting bacterial growth. |
AT5G24950 | putative cytochrome P450 |
AT3G48270 | putative cytochrome P450 |
AT5G57260 | putative cytochrome P450 |
AT5G25130 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT1G13080 | cytochrome P450 monooxygenase |
AT3G26210 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT1G13070 | putative cytochrome P450 |
AT3G26220 | cytochrome P450 monooxygenase |
AT3G26295 | putative cytochrome P450. |
AT2G02580 | member of CYP71B |
AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
AT2G26170 | Encodes a protein with similarity to thromboxane-A synthase, member of the CYP711A cytochrome P450 family. MAX1 is a specific repressor of vegetative axillary buds generated by the axillary meristem. Expressed in vascular traces in the rosette stem and axillary buds throughout plant development. Mutants have increased axillary branches. Along with MAX3,4 thought to mediate control of shoot branching via synthesis of a signal molecule which is transported over long distance mediated by MAX2. cDNA supports the existence of the longer transcript predicted for this locus, no cDNA isolated for shorter transcript. MAX1 downregulates 11 genes involved in flavonoid pathway (CHS, CHI, F3H, F3'H, FLS, DFR, ANS, UFGT, RT, AAC and GST). |
AT5G24910 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
AT5G36110 | Encodes a member of the CYP716A subfamily of cytochrome P450 monooxygenases with triterpene oxidizing activity catalyzing C-28 hydroxylation of alpha-amyrin, beta-amyrin, and lupeol, producing uvaol, erythrodiol, and betulin, respectively. Additionally, it shows carboxylation activity for the C-28 position of alpha- and beta-amyrin. |
AT5G36140 | Encodes a member of the CYP716A subfamily of cytochrome P450 monooxygenases with triterpene oxidizing activity catalyzing C-28 hydroxylation of alpha-amyrin, beta-amyrin, and lupeol, producing uvaol, erythrodiol, and betulin, respectively.In particular, 22alpha-hydroxylation activity has been observed against alpha-amyrin. Should be merged with At5g36130. |
AT3G14610 | putative cytochrome P450 |
AT2G45570 | member of CYP76C |
AT1G33720 | cytochrome P450, family 76, subfamily C, polypeptide 6;(source:Araport11) |
AT3G52970 | member of CYP76G |
AT3G10570 | member of CYP77A |
AT1G11600 | member of CYP77B |
AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
AT4G37330 | member of CYP81D |
AT4G31950 | member of CYP82C |
AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
AT1G01600 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly at highest level in mature stems and flowers. |
AT3G26125 | encodes a protein with cytochrome P450 domain |
AT1G13140 | member of CYP86C |
AT1G64940 | member of CYP89A |
AT1G64900 | Encodes cytochrome P450 (CYP89A2). The mRNA is cell-to-cell mobile. |
AT1G64950 | member of CYP89A The mRNA is cell-to-cell mobile. |
AT3G13730 | Encodes a cytochrome P-450 gene that is involved in brassinosteroid biosynthesis, most likely in the conversion step of teasterone (TE) to 3-dehydroteasterone (3DT), and/or 6-deoxoteasterone (6-deoxoTE) to 6-deoxo-3-dehydroteasterone (6-deoxo3DT); or the conversion of cathasterone (CT) to TE, and/or 6-deoxocathasterone (6-deoxoCT) to 6-deoxoTE. Recently, CYP90D1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). Member of the CYP90C CYP450 family. Similar to Cytochrome P450 90C1 (ROT3). |
AT2G27690 | Encodes a CYP94C1. Has highest omega-hydroxylase activity with 9,10-epoxystearic acid, while also metabolized lauric acid (C12:0) and C18 unsaturated fatty acids. Gene expression is induced in response to wounding and jasmonic acid treatment. |
AT2G23180 | member of CYP96A |
AT1G57750 | Encodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis. |
AT1G65340 | member of CYP96A |
AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11) |
AT1G31800 | Encodes a protein with β-ring carotenoid hydroxylase activity. The mRNA is cell-to-cell mobile. |
AT4G15110 | member of CYP97B |
AT2G40890 | encodes coumarate 3-hydroxylase (C3H), a P450-dependent monooxygenase. Involved in lignin biosynthesis and flavonoid biosynthesis. Also affects the biosynthesis of coumarins such as scopoletin and scopolin as a branching-out-pathway from the phenylpropanoid acid level. |
AT2G39770 | Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. This enzyme provides GDP-mannose, which is used for cell wall carbohydrate biosynthesis and protein glycosylation as well as for ascorbate (vitamin C) biosynthesis. Mutations in this gene confer hypersensitivity to NH4+. |
AT2G19500 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
AT5G56970 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on N6-(2-isopentenyl)adenine 9-riboside. |
AT4G11140 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT1G22985 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT1G49120 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT5G50915 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G36400 | Encodes a (D)-2-hydroxyglutarate dehydrogenase. |
AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
AT5G55910 | Member of AGC VIIIa Kinase family. D6PK is a protein kinase involved that plays a role in polar auxin transport. Most likely acts redundantly with the related proteins: D6PKL1,D6PKL2,and D6PKL3. PIN1 is a target of D6PK phosphorylation. D6PK is associated with sterol enriched membrane rafts and may be involved in regulation of the switch from basal to planar polarity during root hair initiation. Involved in pulse-induced phototropism but also for time-dependent second positive phototropism. Works with PIN3 in the same genetic pathway of hypocotyl phototropism under all light conditions. Involved in the generation of auxin asymmetrical distribution induced by phototropic stimulation. |
AT5G17890 | Encodes a protein that appears to be involved in defense responses. Contains TIR, NB-LRR and LIM domains. A gain of function allele exhibits cold dependent phenotypes including apparent activation of defense responses and an increased freezing tolerance. The mRNA is cell-to-cell mobile. |
AT5G01880 | RING/U-box superfamily protein;(source:Araport11) |
AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
AT3G20550 | Encodes a nuclear localized FHA (forhkead) domain containing protein.Mutant plants have shortened roots, delayed flowering time, altered floral organ number, defective floral organs and reduced fertility.Ddl mutants also show reduced levels of pri-miRNAs as well as mature miRNAs suggesting involvement in biogenesis of miRNAs. DDL does not affect transcription of miRNAs directly but may act through other proteins such as DCL. |
AT3G42170 | transposase-like gene with conserved domains from the family of hAT transposases that includes hobo from Drosophila melanogaster, Activator (Ac) from maize, and Tam3 from snapdragon but lacks several amino acids known to be essential for Ac transposition5. The DAYSLEEPER gene lacks 8 bp duplications and TIRs (a common feature of transcriptionally silent hAT transposases), however, DAYSLEEPER expression was detected, and several expressed sequence tags are available. The expression seems to be under the control of factors determining the circadian rhythm. DAYSLEEPER was isolated as a factor binding to a motif (Kubox1) present in the upstream region of the Arabidopsis DNA repair gene Ku70. Mutant plants lacking DAYSLEEPER or strongly overexpressing this gene do not develop in a normal manner. |
AT5G22760 | PHD finger family protein;(source:Araport11) |
AT1G67780 | Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
AT4G31770 | Encodes a RNA lariat debranching enzyme required for embryogenesis. |
AT4G18750 | Encodes a pentatricopeptide (PPR) protein involved in leaf and root development. dot4 mutants have an aberrant midgap venation pattern in juvenile leaves and cotyledons. |
AT1G28320 | Mutants in this gene are defective in the processing of pre-glyoxysomal malate dehydrogenase (pre-gMDH) to gMDH. |
AT1G65630 | Encodes a putative DegP protease. |
AT2G38340 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
AT1G21910 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT3G50980 | dehydrin xero 1;(source:Araport11) |
AT3G55610 | encodes delta 1-pyrroline-5-carboxylate synthetase B. Gene expression is induced by dehydration, high salt and ABA. Knock-out mutations in P5CS2 are embryo-lethal. P5CS2 appears to be present in different cells and/or different subcellular locations from P5CS1 in a tissue-dependent manner. Mutants are defective in pollen development. |
AT1G06080 | Encodes a protein homologous to delta 9 acyl-lipid desaturases of cyanobacteria and acyl-CoA desaturases of yeast and mammals. expression down-regulated by cold temperature. It is involved in the desaturation of VLCFAs to make monounsaturated VLCFAs. |
AT3G20210 | Encodes a vacuolar processing enzyme with caspase-1-like activity that is specifically expressed in inner integument of developing seeds. Mutants display abnormal seed coat development. It is speculated to be involved in cell death of limited cell layers, the purpose of which is to form a seed coat. |
AT2G36490 | A repressor of transcriptional gene silencing. Functions by demethylating the target promoter DNA. Interacts physically with RPA2/ROR1. In the ros1 mutants, an increase in methylation is observed in a number of gene promoters. Among the loci affected by ros1, a few (RD29A and At1g76930) are affected in cytosine methylation in all sequence contexts (CpG, CpNpG or CpNpN), although many others are affected primarily in non-CpG contexts. The ros1 mutant is more susceptible to biotrophic pathogens and is repressed in its responsiveness of salyclic acid-dependent defence genes. |
AT1G11500 | DUF1218 family member. |
AT4G25640 | Encodes a multidrug and toxin efflux family transporter. Involved in flavonoid metabolism, affecting Root growth, seed development and germination, and pollen development, release and viability. |
AT5G06250 | Transcription repressor involved in regulation of inflorescence architecture. |
AT5G57690 | Involved in nitric oxide-dependent pollen tube guidance and fertilization. |
AT3G03300 | Encodes a Dicer-like protein that functions in the antiviral silencing response in turnip-crinkle virus-infected plants but not in TMV or CMV-strain-Y-infected plants. Involved in the production of ta-siRNAs. Partially antagonizes the production of miRNAs by DCL1. Substitutes for DCL4 to produce viral siRNA when DCL4 is missing or inhibited. Able to produce siRNAs but not miRNAs. |
AT1G51360 | Involved in defense against fungal pathogens and located in cytosol. |
AT1G14130 | DAO1 is an IAA oxidase expressed in many different plant parts. it is a member of a family of dioxygenase and 2OG Fe(II) oxygenase domain and DAO domain containing proteins. It appears to be the major IAA oxidase in planta and major contributor to IAA degradation. |
AT4G23690 | Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
AT5G64860 | Encodes a maltotriose-metabolizing enzyme with chloroplastic α-1,4-glucanotransferase activity. Mutant has altered starch degradation. |
AT1G30825 | Involved in trichome maturation. mutant displays enlarged trichomes |
AT5G04760 | R-R-type MYB protein which plays negative roles in salt stress and is required for ABA signaling in Arabidopsis. |
AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G00940 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT4G36040 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT4G18650 | A maternally expressed imprinted gene in the endosperm. It's expression is positively regulated by ROS1. |
AT1G03300 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
AT5G23800 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
AT2G46840 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype. Overexpression increases plant organ size, possibly by influencing the expression of the cell wall formation and auxin transporter genes that regulate cell size. |
AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
AT4G12010 | Leucine-rich repeat domain (NLR) receptor. Dominant negative alleles suppress catma3 autoimmunity. Co-regulates with WRKY19 basal levels of immunity to root-knot nematodes. |
AT2G36800 | Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype. |
AT1G24590 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. This gene functions in the regeneration of shoots in tissue culture, probably through transcriptional regulation of CUC1. May also be involved in activation of the cell cycle via CycD1;1. |
AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
AT5G05410 | Encodes a transcription factor that specifically binds to DRE/CRT cis elements (responsive to drought and low-temperature stress). Belongs to the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2A). There are eight members in this subfamily including DREB2B. The protein contains one AP2 domain. Overexpression of transcriptional activation domain of DREB2A resulted in significant drought stress tolerance but only slight freezing tolerance in transgenic Arabidopsis plants. Microarray and RNA gel blot analyses revealed that DREB2A regulates expression of many water stress?inducible genes. The mRNA is cell-to-cell mobile. |
AT1G27461 | Nuclear localized protein involved in osmotic stress tolerance. |
AT1G80710 | Encodes a WD-40 repeat family protein containing a DWD (DDB1 binding WD-40) motif. Mutant analysis demonstrates that DRS1 promotes tolerance to drought stress, possibly mediated by ABA, and suggests involvement of DDB1- Cul4?mediated protein degradation in drought response. |
AT5G55970 | Drought-induced gene encoding an ER-localized RING-type E3 Ub ligase. |
AT4G14260 | hypothetical protein (DUF295);(source:Araport11) |
AT1G80240 | DUF642 gene |
AT4G18425 | transmembrane protein, putative (DUF679);(source:Araport11) |
AT1G64110 | Target promoter of the male germline-specific transcription factor DUO1. |
AT4G35280 | Target promoter of the male germline-specific transcription factor DUO1. |
AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
AT1G63030 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in the reduction of gibberellic acid biosynthesis. This gene is expressed in all tissues examined, but most abundantly expressed in rosette leaves and stems. Overexpression of DDF1, a putative paralog of this gene, also reduces gibberellic acid biosynthesis and makes the plants more tolerant to high-salinity levels. |
AT5G27930 | EGR2 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress. EGR2 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
AT5G53870 | early nodulin-like protein 1;(source:Araport11) |
AT1G08930 | encodes a putative sucrose transporter whose gene expression is induced by dehydration and cold. The mRNA is cell-to-cell mobile. |
AT5G51070 | ATP-dependent Clp protease regulatory subunit The mRNA is cell-to-cell mobile. |
AT4G19120 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
AT1G02205 | Expression of the CER1 gene associated with production of stem epicuticular wax and pollen fertility. Biochemical studies showed that cer1 mutants are blocked in the conversion of stem wax C30 aldehydes to C29 alkanes, and they also lack the secondary alcohols and ketones. These suggested the CER1 protein is an aldehyde decarbonylase, but the exact molecular function of this protein remains to be determined. |
AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
AT3G18980 | EIN2 targeting protein1;(source:Araport11) |
AT5G09990 | elicitor peptide 5 precursor;(source:Araport11) |
AT4G37980 | NADPH-dependent cinnamaldehyde and hexenal reductase involved in the production of green leaf volitile compounds. |
AT5G22800 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
AT3G48930 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT1G48850 | Flavoenzyme-encoding gene essential for embryo development. |
AT5G21140 | Encodes a nuclear localized, structural subunit of the SMC 5/6 complex and a non- SMC element. Loss of function results in abnormal cell division and embryo lethality. Analysis of partially rescued lines indicates a role in double strand break DNA repair. Similar phenotype to NSE3 which it also interacts with. Maintains cell viability together with NSE3 during early embryogenesis. |
AT5G37510 | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. The mRNA is cell-to-cell mobile. |
AT1G20960 | Similar to DEAD/DExH box ATP-dependent RNA helicase . Required for proper splicing of FLC. Mutants have reduced FLC levels and are early flowering. |
AT5G62990 | Nucleus-encoded RNA-binding protein which exists only in embryophytes, catalyzes nuclear pre-mRNA and chloroplast group II intron splicing. |
AT1G76060 | CIAF1 mitochondrial protein required for assembly of the 1000-kD complex I holoenzyme. |
AT4G21130 | similar to man and yeast U3-55K genes, involved in processing of pre-ribosomal RNA. |
AT1G30610 | Pentatricopeptide repeat protein .Mutations in this locus result in embryo lethality due to defects in chloroplast development. Embryo shape at seed maturity is globular. |
AT5G37630 | ARM repeat superfamily protein;(source:Araport11) |
AT5G02250 | Encodes a exoribonuclease involved in rRNA processing in mitochondria and chloroplasts.Loss of function mutations are pale green and require supplementation with sucrose for germination and early development. Plants are pale green due to defects in chloroplast biogenesis. |
AT5G06240 | embryo defective 2735;(source:Araport11) |
AT3G12670 | Cytidine triphosphate synthase; essential for CTP supply in developing embryos. |
AT5G39680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G13010 | Encodes a nuclear localized DEAH-box containing protein that is involved in miRNA biogenesis. Loss of function mutants are embryo lethal. Gene silencing experiments demonstrated its role in the localization of DCL-1 and HYL1 to the nuclear D-body. In silenced lines, miRNA production is suppressed and plants have developmental abnormalities and are hypersensitive to fungal pathogens. |
AT5G58250 | Involved in tetrapyrrole biosynthesis. May function as a scaffold protein to stabilize CHL27. |
AT5G40160 | Encodes ankyrin repeat protein EMB506. Mutations in this locus result in embryo lethality. |
AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
AT2G18080 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
AT1G70540 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G03650 | Exostosin family protein;(source:Araport11) |
AT3G23440 | embryo sac development arrest 6;(source:Araport11) |
AT5G11530 | Involved in regulating reproductive development |
AT5G51230 | Polycomb group protein with zinc finger domain involved in negative regulation of reproductive development. Forms a complex with FIE, CLF, and MSI1. This complex modulates the expression of target genes including AG, PI and AP3. |
AT1G02310 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT5G01930 | Encodes a endo-beta-mannanase involved in seed germination. |
AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
AT5G01400 | Encodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64. |
AT1G63650 | Mutant has reduced trichomes, anthocyanin, and seed coat mucilage and abnormally patterned stomates. Mutants are defective in jasmonate-induced anthocyanin accumulation. Encodes a bHLH Transcription Factor 1. The protein is functionally redundant with GL3 and TT8 and interacts with TTG1, the myb proteins GL1, PAP1 and 2, CPC and TRY, and it will form heterodimers with GL3. Expression in N (non-hair cell forming) cell layers is negatively regulated by WER. Expression in H cells (hair cell forming) is promoted by CPC/TRY. |
AT4G16210 | enoyl-CoA hydratase/isomerase A;(source:Araport11) |
AT1G54040 | Epithiospecifier protein, interacts with WRKY53. Involved in pathogen resistance and leaf senescence. |
AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
AT2G35700 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Thought to be involved in secondary cell wall metabolism. |
AT1G44830 | Encodes a nuclear-localized member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression in cultured cells results in an increase in pectin deposition.ERF014 differentially regulates responses to bacterial and fungal pathogens. |
AT1G49880 | Encodes Erv1, a component of the mitochondrial intermembrane space assembly machinery involved in the import pathway of the small intermembrane space proteins. It contains a Cys-X-Cys shuttle disulfide and oxidizes thioredoxin in vitro. Flavoenzyme-encoding gene. |
AT4G29960 | EBS7 encodes a plant specific, endoplasmic reticulum localized protein that is involved in endoplasmic reticulum-associated degradation (ERAD). It interacts with the ERAD component AtHRD1a and may regulate HRD1a stability. Identified in a screen for supressors of a mutation in bri1 that causes bri1 to be retained in the ER. Loss of EBS7 function restores BR sensitivity in the bri1-9 mutant allele. |
AT5G25190 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile. |
AT3G23150 | Involved in ethylene perception in Arabidopsis The mRNA is cell-to-cell mobile. |
AT3G25730 | ethylene response DNA binding factor 3;(source:Araport11) |
AT3G23240 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ERF1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. EREBP like protein that binds GCC box of ethylene regulated promoters such as basic chitinases. Constitutive expression of ERF1 phenocopies ethylene over production. Involved in ethylene signaling cascade,downstream of EIN2 and EIN3. |
AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
AT5G47220 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box?dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. |
AT4G17490 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress. Involved in regulating root architecture and the response to cold stress. |
AT5G05740 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. |
AT2G31230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT1G13950 | Encodes eukaryotic translation initiation factor 5A (EIF-5A).In mammalian cells it functions as a shuttle protein that translocates mRNA from the nucleus to cytoplasmic ribosomes. Overexpression results in an increase in both primary and secondary xylem formation. In RNAi suppressed lines, xylem formation is reduced. |
AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
AT2G39990 | translation initiation factor eIF2 p47 subunit homolog |
AT3G56150 | member of eIF3c - eukaryotic initiation factor 3c |
AT3G60240 | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
AT3G54150 | Encodes a DNA methyltransferase required for pollen exine formation and male fertility via the regulation of callose wall and primexine formation. |
AT1G10180 | LOW protein: exocyst complex component-like protein;(source:Araport11) |
AT3G56640 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
AT5G52340 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT3G55150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT3G09530 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G64260 | EXORDIUM like 2;(source:Araport11) |
AT5G09440 | EXORDIUM like 4;(source:Araport11) |
AT3G02970 | EXORDIUM like 6;(source:Araport11) |
AT1G54490 | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. The mRNA is cell-to-cell mobile. |
AT2G03090 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT3G55500 | expansin-like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT5G39280 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT2G20750 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT4G17030 | Encodes EXLB1 (expansin-like B1), a member of the expansin family. |
AT1G26250 | Proline-rich extensin-like family protein;(source:Araport11) |
AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
AT1G21310 | Encodes extensin 3. |
AT4G34390 | extra-large GTP-binding protein 2;(source:Araport11) |
AT4G05010 | F-box family protein;(source:Araport11) |
AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
AT5G60060 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT1G65760 | ascorbic acid mannose pathway regulator (DUF295);(source:Araport11) |
AT2G14290 | LL-diaminopimelate protein (DUF295);(source:Araport11) |
AT2G14500 | F-box family protein;(source:Araport11) |
AT3G22345 | F-box/kelch-repeat protein;(source:Araport11) |
AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
AT3G07500 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. |
AT2G36305 | Encodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast. |
AT3G52370 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT5G06390 | FASCICLIN-like arabinogalactan protein 17 precursor;(source:Araport11) |
AT5G06920 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT5G60490 | Encodes a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. Possibly involved in embryogenesis and seed development. |
AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
AT4G30950 | Chloroplastic enzyme responsible for the synthesis of 16:2 and 18:2 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene mutation resulted in reduced level of unsaturated fatty acids leading to susceptibility to photoinhibition. |
AT3G57280 | Encodes a chloroplast inner envelope localized member of the Tmemb_14 gene family. FAX1 is involved in fatty acid and lipid homeostasis and likely functions as a fatty acid transporter that exports fatty acids from the plastid. The mRNA is cell-to-cell mobile. |
AT5G22500 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. |
AT3G56700 | Encodes a fatty-acyl-CoA reductase that is expressed in response to wounding. |
AT1G08510 | Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer. |
AT3G23410 | Encodes a fatty alcohol oxidase. |
AT2G26310 | Encodes a plastid stroma localized fatty acid binding protein. |
AT4G13985 | FBD-associated F-box protein;(source:Araport11) |
AT1G57790 | F-box family protein;(source:Araport11) |
AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
AT5G66190 | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. |
AT5G23440 | ferredoxin/thioredoxin reductase subunit A (variable subunit) 1;(source:Araport11) |
AT3G08040 | Encodes a member of the MATE (multidrug and toxin efflux family), expressed in roots but not shoots. Mutants accumulate excess iron, manganese and zinc, and express root Fe(III) chelatase activity even under iron sufficiency conditions. FRD3 is likely to function in root xylem loading of an iron chelator or other factor necessary for efficient iron uptake out of the xylem or apoplastic space and into leaf cells. |
AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
AT5G26030 | encodes ferrochelatase I located in plastids. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins The mRNA is cell-to-cell mobile. |
AT4G36220 | encodes ferulate 5-hydroxylase (F5H). Involved in lignin biosynthesis. |
AT4G22240 | Involved in photoprotection of photosystem II. The RVSI and twin-positive motifs in the transit peptide are necessary for efficient leucoplast import of prFB. |
AT3G23400 | Encodes FIBRILLIN 4 (FIB4). The fibrillins are a large family of chloroplast proteins that have been linked with stress tolerance and disease resistance. FIBRILLIN 4 is required for plastoglobule development and stress resistance.Iinvolved in plastoquinone transport. |
AT5G19940 | Enables plants to cope with moderate light stress and affects cadmium tolerance. |
AT4G25340 | Encodes a member of the FKBP-type immunophilin family that functions as a histone chaparone. Binds to 18S rDNA and represses its expression. The N-terminal nucleoplasmin domain interacts with H2A/H2B and H3/H4 histone oligomers, individually, as well as simultaneously, suggesting two different binding sites for H2A/H2B and H3/H4. |
AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
AT5G54500 | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
AT5G28470 | Encodes a member of the nitrate/peptide NTR/PTR family of transporters is required for accumulation and transport of pollen-specific flavonol 3-O-sophorosides, characterized by a glycosidic β-1,2-linkage, to the pollen surface of Arabidopsis. |
AT5G63590 | flavonol synthase 3;(source:Araport11) |
AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
AT2G19190 | Encodes a receptor-like protein kinase that is involved in early defense signaling. Expression of this gene is strongly induced during leaf senescence. It is a target of the transcription factor AtWRKY6. |
AT2G42280 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G65480 | FT, together with LFY, promotes flowering and is antagonistic with its homologous gene, TERMINAL FLOWER1 (TFL1). Together with TSF, it plays an antagonistic role to TFL1 in the determination of inflorescence meristem identity. FT is expressed in leaves and is induced by long day treatment. Either the FT mRNA or protein is translocated to the shoot apex where it induces its own expression. Recent data suggests that FT protein acts as a long-range signal. FT is a target of CO and acts upstream of SOC1. |
AT5G24860 | encodes a small protein of 12.6 kDa that regulates flowering and is involved in gibberellin signalling pathway. It is expressed in apical meristems immediately after the photoperiodic induction of flowering. Genetic interactions with flowering time and floral organ identity genes suggest that this gene may be involved in modulating the competence to flower. There are two other genes similar to FPF1, FLP1 (At4g31380) and FLP2 (no locus name yet, on BAC F8F16 on chr 4). This is so far a plant-specific gene and is only found in long-day mustard, arabidopsis, and rice. |
AT3G14750 | structural maintenance of chromosomes domain protein;(source:Araport11) |
AT5G43870 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT5G47440 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT4G15200 | Actin nucleation factor that directs the formation of actin cables in pollen tubes. Involved in cytoplasmic streaming and polarized growth in pollen tubes. |
AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
AT1G65580 | Endonuclease/exonuclease/phosphatase family protein;(source:Araport11) |
AT5G01100 | O-fucosyltransferase family protein;(source:Araport11) |
AT2G31390 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
AT5G06850 | Encodes an endoplasmic reticulum protein that is involved in the transport of the florigen FT from companion cells to sieve elements, thus affecting FT transport through the phloem to the SAM. |
AT3G02450 | Proteolytically inactive member of the FtsH (filamentation-temperature-sensitive protein H) protease family due to mutations in the protease domain. |
AT2G29080 | encodes an FtsH protease that is localized to the mitochondrion |
AT1G06430 | encodes a FtsH protease that is localized to the chloroplast |
AT4G05120 | Encodes an equilibrative nucleoside transporter AtENT3. Mutations of this locus allow mutants to grow on uridine analogue fluorouridine. |
AT5G50950 | Encodes a fumarase enzyme initially shown to be in the mitochondria through proteomic studies but later shown to be present in the cytosol using an RFP fluorescent protein tag. It appears to be important for the accumulation of fumarate from malate in leaves in the light, and helps to promote nitrogen assimilation under high nitrogen conditions. It does not appear to be necessary for lipid metabolism and seedling growth. Inhibition of fumarate accumulation results in an overall shift in the cold response of leaves, with a complete inhibition of cold acclimation of photosynthesis. |
AT1G12050 | Encodes a fumarylacetoacetase that converts fumarylacetoacetate to acetoacetate and fumarate and is likely to be involved in tyrosine catabolism. |
AT1G26630 | Eukaryotic translation initiation factor 5A-2. Involved in programmed cell death triggered as a response to pseudomonas syringae infection. Loss of function mutants are more resistant to infection. The mRNA is cell-to-cell mobile. |
AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
AT2G26300 | Encodes an alpha subunit of a heterotrimeric GTP-binding protein. The active GTP-bound form of GPA1 binds to the GTG1 and GTG2 abscisic acid (ABA) receptors and appears to affect their GTPase and GTP-binding activity, and hence, ABA binding abilities. GPA1 is a positive regulator in ABA-mediated inhibition of stomatal opening. Plants with recessive mutant alleles have complex phenotypes including: reduced brassinolide response, reduced cell divisions, round leaves, short hypocotyls. It is likely to be involved in the signaling events that trigger unfolded protein response-associated cell death. GPA1 is also involved in sugar signaling. The mRNA is cell-to-cell mobile. |
AT3G05120 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The DELLA region alone can interact with GID1A in GA-dependent manner in a Y2H assay. |
AT4G02780 | Catalyzes the conversion of geranylgeranyl pyrophosphate (GGPP) to copalyl pyrophosphate (CPP) of gibberellin biosynthesis |
AT5G44670 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT5G23790 | Predicted to encode a galactinol synthase. |
AT5G19580 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
AT3G01040 | Encodes a protein with putative galacturonosyltransferase activity. |
AT5G15470 | Encodes a protein with putative galacturonosyltransferase activity. |
AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
AT3G62660 | Encodes a protein with putative galacturonosyltransferase activity. |
AT3G52115 | Induced in response to ionizing radiation, shows basal expression in mitotically active cells and high expression in endoreduplicating cells. May be involved in DNA damage-induced growth arrest. Protein sequence contains a PEST destruction box. |
AT4G32940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death. |
AT4G30530 | Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. The mRNA is cell-to-cell mobile. |
AT4G30550 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
AT1G69820 | Note that conflicting nomenclature exists in the literature: At1g69820 is named as GGT4 in Plant J. 2007 Mar 49(5):878-88; and as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32. |
AT4G12960 | Gamma interferon responsive lysosomal thiol (GILT) reductase family protein;(source:Araport11) |
AT2G16200 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
AT4G34450 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
AT1G75750 | GA-responsive GAST1 protein homolog regulated by BR and GA antagonistically. Possibly involved in cell elongation based on expression data The mRNA is cell-to-cell mobile. |
AT4G09600 | One of GASA gene family which is related to a GA-stimulated transcript (GAST) from tomato. |
AT5G26930 | Encodes a member of the GATA factor family of zinc finger transcription factors. Controls lateral root founder cell specification. |
AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT1G73790 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
AT5G28840 | Encodes a protein with GDP-D-mannose 3',5'-epimerase activity. The enzyme is involved in ascorbate biosynthesis. It catalyzes the conversion of GDP-D-mannose to GDP-L-galactose. |
AT3G14225 | Contains lipase signature motif and GDSL domain. |
AT2G25650 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT1G22300 | Encodes a 14-3-3 protein. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Might act as a stabilization factor to mediate the oligomerization of REM on the plasma membrane. |
AT4G27600 | Encodes a phosphofructokinase B-type carbohydrate kinase family protein, NARA5. Regulates photosynthetic gene expression. |
AT2G31400 | Encodes a a chloroplast-localized pentatricopeptide-repeat protein involved in regulation of nuclear gene expression. |
AT3G32040 | Chloroplast localized GFDP synthase. |
AT2G23800 | encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
AT4G38460 | Encodes a type II small subunit of the heteromeric geranyl(geranyl) diphosphate synthase that is localized to the chloroplast, expressed in petals and sepals and is involved in monoterpene biosynthesis. The mRNA is cell-to-cell mobile. |
AT5G20630 | Encodes a germin-like protein. Its transcripts are more abundant in RNA from leaves collected in the evening, suggesting some kind of circadian regulation. |
AT1G09560 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. The mRNA is cell-to-cell mobile. |
AT1G10460 | germin-like protein (GLP7) |
AT1G02400 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins. |
AT1G50960 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. DDF1 binds to GA2OX7 and regulates its expression in response to salt stress. |
AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
AT5G58660 | Encodes a class III gibberellin 2-oxidase that oxidizes GA12 to GA110 and GA9 to GA40. |
AT5G07200 | encodes a gibberellin 20-oxidase. |
AT4G26420 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes GAMT1, a methyltransferase that uses S-adenosine-L-methionine (SAM) as a methyl donor to methylate the carboxyl group of GAs, resulting in the methyl esters of GAs (MeGAs). Expressed most highly in the siliques during seed development. SABATH family methyltransferase. |
AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
AT1G68360 | Encodes a nuclear localized member of the C2H2 family of TFIIIA transcription factors.GIS3 is involved in trichome initiation and development downstream of GA and cytokinin signaling. GIS regulates the expression GIS and GIS2. |
AT2G37585 | Encodes GlcAT14C. Has glucuronosyltransferase activity adding glucuronic acid residues to beta-1,3- and beta-1,6-linked galactans. |
AT2G19880 | Encodes Glucosylceramide synthase (GCS) which catalyzes the final step in glucosylceramide (GlcCer) synthesis by transferring a glucosyl residue from UDP-Glc to the ceramide backbone. |
AT1G30540 | Actin-like ATPase superfamily protein;(source:Araport11) |
AT5G45600 | The GSA41 human homolog is expressed in nuclei and binds NuMA, a component of the nuclear matrix in interphase nuclei. It negatively regulates flowering by controlling the H4 acetylation levels in the FLC and FT chromatin. |
AT4G38880 | GLN PHOSPHORIBOSYL PYROPHOSPHATE AMIDOTRANSFERASE 2 |
AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
AT2G31960 | encodes a protein similar to callose synthase |
AT3G27160 | GHS1 encodes plastid ribosomal protein S21 The mRNA is cell-to-cell mobile. |
AT3G27300 | glucose-6-phosphate dehydrogenase 5;(source:Araport11) |
AT5G25980 | Myrosinase (thioglucoside glucohydrolase) gene involved in glucosinoloate metabolism. The mRNA is cell-to-cell mobile. |
AT2G25450 | Encodes a 2-oxoacid-dependent dioxygenase involved in the production of 2-hydroxybut-3-enyl glucosinolate. |
AT5G34940 | The protein is predicted (WoLF PSORT program) to be membrane-associated. |
AT1G33800 | Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile. |
AT4G09990 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
AT2G24710 | member of Putative ligand-gated ion channel subunit family |
AT5G11210 | member of Putative ligand-gated ion channel subunit family |
AT2G29120 | member of Putative ligand-gated ion channel subunit family |
AT2G29100 | member of Putative ligand-gated ion channel subunit family |
AT1G42540 | member of Putative ligand-gated ion channel subunit family |
AT5G04140 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. The mRNA is cell-to-cell mobile. |
AT5G24920 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
AT5G16570 | Encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
AT1G03850 | Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
AT4G28730 | Encodes a glutaredoxin GrxC5. GrxC5 exists as two forms when expressed in Escherichia coli. The monomeric apoprotein possesses deglutathionylation activity mediating the recycling of plastidial methionine sulfoxide reductase B1 and peroxiredoxin IIE, whereas the dimeric holoprotein incorporates a [2Fe-2S] cluster. |
AT2G31570 | glutathione peroxidase GPx |
AT1G69920 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT2G02390 | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. It functions in vitro as a maleylacetoacetate isomerase and is likely to be involved in tyrosine catabolism. |
AT3G47420 | Encodes a Pi starvation-responsive protein AtPS3. A member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
AT4G01950 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
AT3G11430 | sn-glycerol-3-phosphate 2-O-acyltransferas, involved in the biosynthesis of suberin polyester. |
AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
AT5G41080 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
AT5G43300 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
AT2G05440 | GLYCINE RICH PROTEIN 9;(source:Araport11) |
AT5G07510 | encodes a glycine-rich protein that is expressed in low abundance in stems and leaves, and very low abundance in flowers. |
AT5G07550 | member of Oleosin-like protein family |
AT3G14420 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. The mRNA is cell-to-cell mobile. |
AT2G33470 | glycolipid transfer protein 1;(source:Araport11) |
AT4G09740 | glycosyl hydrolase 9B14;(source:Araport11) |
AT4G23560 | glycosyl hydrolase 9B15;(source:Araport11) |
AT4G39010 | Cellulase involved in cell wall modification during valve dehiscence. |
AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
AT4G11050 | glycosyl hydrolase 9C3;(source:Araport11) |
AT2G27130 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G08280 | Encodes a glycosyltransferase (GT) GALT29A, which belongs to the Carbohydrate Active Enzyme family GT29. GALT29A co-expresses with other arabinogalactan GTs, GALT31A and GLCAT14A. The recombinant GALT29A expressed in Nicotiana benthamiana demonstrated a galactosyltransferase activity, transferring galactose from UDP-galactose to a mixture of various oligosaccharides derived from arabinogalactan proteins. |
AT1G67290 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
AT5G57040 | Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl,drought and high light stress. |
AT1G15380 | Glyoxalase which affects ABA?JA crosstalk. |
AT1G80160 | Vicinal oxygen chelate (VOC) superfamily member. |
AT5G44190 | Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. |
AT1G07290 | Encodes a GDP-mannose transporter. |
AT2G19950 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC1 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (558-715 aa) portion of the protein. |
AT2G46180 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein. |
AT1G31140 | Encodes a B-sister MADS-box protein, GORDITA which is specific to the Brassicaceae. GOA is the most closely related paralog of ABS. GOA represses fruit growth and contributes to integument development. Over-expression of GOA results in disorganized floral structure and addition of carpel-like features to sepals. |
AT5G58960 | Mutant plants display impaired light-regulation of the hypocotyl randomization response. |
AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
AT5G13190 | Encodes a plasma membrane localized LITAF domain protein that interacts with LSD1 and acts as a negative regulation of hypersensitive cell death. |
AT5G28300 | Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor. |
AT5G64300 | encodes GTP cyclohydrolase II that can functionally complement E. coli mutant deficient in this gene. It also has 3,4-dihydroxy-2-butanone-4-phosphate synthase activity which makes it a bifunctional enzyme involved in the formation of the pyrimidine and of the carbohydrate from GTP and ribulose-5-phosphate, respectively The mRNA is cell-to-cell mobile. |
AT5G28050 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
AT2G44100 | GDP dissociation inhibitor involved in vesicular membrane traffic |
AT3G57550 | guanylate kinase |
AT4G20940 | Encodes a plasma-membrane localized LRR receptor-like protein involved in both ABA and H202 mediated signaling involved in stomatal movement. TAIR10 annotation for this gene has a low confidence score (2-star). See Comments field for structural annotation by the community. |
AT3G47950 | mutant has Slight reduction in root and shoot growth; Exaggerated defects in salt stress; Plasma Membrane H+ ATPase |
AT2G07560 | H[+]-ATPase 6;(source:Araport11) |
AT3G42640 | H[+]-ATPase 8;(source:Araport11) |
AT1G80660 | H[+]-ATPase 9;(source:Araport11) |
AT3G10520 | Encodes a class 2 non-symbiotic hemoglobin. Over-expression of AHb2 in seeds led to a 40% increase in the total fatty acid content of developing and mature seeds in three subsequent generations. This was mainly due to an increase in the poly-unsaturated C18:2 (omega-6) linoleic and C18:3 (omega-3) alpha-linolenic acids. |
AT3G18030 | flavin mononucleotide flavoprotein involved in salt and osmotic tolerance HAL3A encodes for phosphopantothenoylcysteine decarboxylase being involved in Coenzyme A biosynthesis. HAL3A is predominant over another gene with the presumably same function (HAL3B). |
AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
AT4G15802 | Encodes a protein with similarity to heat shock factor binding proteins. Involved in negative regulation of heat shock response. Becomes nuclear localized upon heat treatment. |
AT1G11660 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
AT1G46264 | Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions. |
AT5G17450 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G22990 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G35060 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G63950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G28660 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
AT2G35730 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G06130 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G48970 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G03380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G27690 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G19110 | Encodes a protein with similarity to Zn ATPase. Can rescue Zn deficiency in yeast and Cd resistance, suggesting a role in Zn and Cd transport. The mRNA is cell-to-cell mobile. |
AT5G09750 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development. |
AT2G30800 | Has RNA or DNA helicase activity and expressed specifically in tapetum and vascular tissue. First identified member of a new group of the mle helicase group of the DEAH family. |
AT1G58300 | Encodes a member (HO4) of the heme oxygenase family. |
AT5G20270 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
AT2G19860 | Encodes a protein with hexokinase activity (AtHXK2) and acts as a sensor for plant sugar responses. |
AT4G10310 | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
AT5G23420 | Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain. |
AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
AT1G07430 | Encodes a member of the group A protein phosphatase 2C (PP2C) family that is responsible for negatively regulating seed dormancy. |
AT2G29380 | highly ABA-induced PP2C protein 3;(source:Araport11) |
AT1G23200 | ProPME pectin methyl esterase involved in embryo development. |
AT1G27320 | Encodes a histidine kinases, a cytokinin receptor that controls cytokinin-mediated leaf longevity through a specific phosphorylation of the response regulator, ARR2. The mRNA is cell-to-cell mobile. |
AT1G80100 | AHP6 lacks the conserved histidine residue (Asn83 in AHP6b), which is required for phosphotransfer, present in the other AHPs. AHP6 does not appear to have phosphotransfer activity. Acts as an inhibitor of cytokinin signaling by interacting with the phosphorelay machinery. Expressed in developing protoxylem and associated pericycle cell files. Negative regulator of cytokinin signaling. Expression is down-regulated by cytokinins. There are two alternatively spliced genes for this locus, AHP6a and AHP6b, differing in the length of the first exon. In ahp6-2 seedlings, only the AHP6a transcript is present. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
AT1G61270 | Involved in transport of 1-Aminocyclopropane-1-carboxylic acid (ACC). |
AT1G31160 | Encodes a member of the histidine triad nucleotide-binding family of proteins, but its activity has not been determined. |
AT4G16566 | Encodes a protein that has an unexpected bifunctional capability in vitro. The purified enzyme has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) and ADP-sulfurylase activity (E.C. 2.7.7.5). The latter is activated at low pH. The enzyme can exert it phosphorylase activity on a range of related substrates in vitro, but it acts best with APS (adenosine 5'-phsophosulfate). This protein appears to function as a homodimer. |
AT1G06760 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
AT5G22880 | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases. |
AT3G54560 | Encodes HTA11, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA8 and HTA9) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z. |
AT4G27230 | Encodes HTA2, a histone H2A protein. |
AT5G27670 | Encodes HTA7, a histone H2A protein. |
AT1G55250 | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. |
AT2G44150 | Encodes a protein-lysine N-methyltransferase. Located in ER. |
AT3G61890 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems. |
AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
AT2G46680 | encodes a putative transcription factor that contains a homeodomain closely linked to a leucine zipper motif. Transcript is detected in all tissues examined. Is transcriptionally regulated in an ABA-dependent manner and may act in a signal transduction pathway which mediates a drought response. |
AT4G32880 | member of homeodomain-leucine zipper family, acting as a differentiation-promoting transcription factor of the vascular meristems. |
AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
AT2G18550 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
AT5G39760 | Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation. |
AT4G36740 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
AT1G70920 | homeobox-leucine zipper protein 18;(source:Araport11) |
AT3G60390 | Encodes homeobox protein HAT3. |
AT4G17710 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT3G03260 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT5G54080 | Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism. |
AT2G18950 | Encodes homogentisate phytyltransferase involved in tocopherol biosynthesis. Has impact on seed longevity and plays a role in the adaptation to low temperature stress, notably phloem loading. |
AT3G50480 | Homolog of RPW8 |
AT5G64520 | Encodes a protein of the XRCC2 family involved in DNA repair. atxrcc2-1 Mutants are sensitive to MitomycinC but do not show fertility defects. |
AT5G48120 | ARM repeat superfamily protein;(source:Araport11) |
AT4G04330 | Encodes a chloroplast thylakoid localized RbcX protein that acts as a chaperone in the folding of Rubisco. |
AT4G31750 | Encodes HopW1-1-Interacting protein 2 (WIN2). Interacts with the P. syringae effector HopW1-1. WIN2 has protein phosphatase activity. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320). |
AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G32010 | Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing. |
AT4G20930 | Encodes a 3-hydroxyisobutyrate dehydrogenase. |
AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT3G21760 | Encodes HYR1, a UDP glycosyltransferase (UGT). HYR1 glucosylates hypostatin, an inhibitor of cell expansion in vivo to form a bioactive glucoside. |
AT5G24650 | HP30/Tric1 is a component of the mitochondrial protein translocation complex and is involved in tRNA transport along with HP30-2/Tric2.It interacts with several members of the TOM complex such as TOM40 and this interaction is mediated by the SAM domain. Role in protein import into chloroplasts. |
AT5G66985 | hypothetical protein;(source:Araport11) |
AT3G03270 | HRU1 is a hypoxia induced universal stress protein. It exists as two splice variants with AT3G03270.2 , which contains a putative dimerization domain, the predominant transcript found under anoxia. It is induced by RAP2.12. Subcellular localization is dynamic; under anoxia the localization of HRU1 shifts from cytoplasm to the plasma membrane. |
AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
AT1G44350 | encodes a protein similar to IAA amino acid conjugate hydrolase. |
AT5G54680 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G72270 | Encodes IDAP1. Acts together with IDAP2 and IDM1 to regulate active DNA demethylation. |
AT2G43060 | ILI1 binding bHLH 1;(source:Araport11) |
AT5G11470 | SG1 is a Bromo-Adjacent Homology (BAH) domain containing protein involved in CHG methylation within genebodies. Loss of function results in pleiotrophic developmental effects that increase after 4 generations. |
AT5G65040 | senescence-associated family protein (DUF581);(source:Araport11) |
AT5G66730 | C2H2-like zinc finger protein;(source:Araport11) |
AT2G02080 | C2H2 BIRD transcription factor family. |
AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
AT1G21120 | O-methyltransferase family protein;(source:Araport11) |
AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
AT4G14550 | IAA14 is a member of the Aux/IAA protein family. Involved in lateral root development. Gain of function mutation decreases auxin-inducible gene expression. Protein is localized to the nucleus. Expressed in stele and root tip epidermis. Functions as a negative regulator of ARF7/19. |
AT1G80390 | Member of a multigene family of Auxin responsive genes. |
AT1G51950 | indole-3-acetic acid inducible 18;(source:Araport11) |
AT2G46990 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA20 lacks the conserved degron (domain II) found in many family members, and IAA20 fusion proteins are stable in Arabidopsis seedlings. IAA20 transcripts are induced by auxin treatment, and overexpression of IAA20 leads to defects in gravitropism, root development, root meristem maintenance, etiolation, and cotyledon vascular development. |
AT1G15050 | Belongs to auxin inducible gene family. |
AT5G65670 | auxin (indole-3-acetic acid) induced gene The mRNA is cell-to-cell mobile. |
AT3G09922 | Encodes a gene product whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
AT3G18715 | Similar to Inflorescance deficient in abscission (IDA). Involved in floral organ abscission. |
AT1G23420 | Essential for formation and asymmetric growth of the ovule outer integument. Member of the YABBY protein family of putative transcription factors that contain apparent Cys(2)-Cys(2) zinc-finger domains and regions of similarity to the high mobility group (HMG) transcription factors. INO may be required for polarity determination in the central part of the ovule. |
AT1G30220 | Inositol transporter presenting conserved extracellular loop domains homologs of plexins/semaphorin/integrin (PSI) domains from animal type I receptors. |
AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
AT1G07120 | CHUP1-like protein;(source:Araport11) |
AT1G48280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G43680 | Member of IQ67 (CaM binding) domain containing family. |
AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
AT3G22190 | Member of IQ67 (CaM binding) domain containing family. |
AT5G03570 | Encodes FPN2, a tonoplast localized nickel transport protein. FPN2 is one of the Arabidopsis orthologs (AT2G38460/IREG1/FPN1 and AT5G03570/IREG2/FPN2) the iron efflux transporter ferroportin (FPN) identified in animals. |
AT1G26640 | Encodes a cytosolic isopentenyl phosphate kinase that plays an important role in regulating the formation of both MVA (mevalonic acid) and MEP (methylerythritol phosphate) pathway-derived terpenoid compounds by controlling the ratio of IP/DMAP to IPP/DMAPP. IPP and DMAPP are the universal C5 building blocks of all natural terpenoids. IPK enhances terpenoid formation by returning IP/DMAP to the terpenoid biosynthetic network. |
AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
AT3G45300 | Encodes isovaleryl-coenzyme a dehydrogenase. Mutants have increases in 12 seed free amino acids, accumulation of seed homomethionine and 3-isovaleroyloxypropyl-glucosinolate, with a concomitant decrease in seed 3-benzoyloxypropyl-glucosinolate. The mRNA is cell-to-cell mobile. |
AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
AT3G22160 | VQ motif-containing protein. JAV1 is a repressor of jasmonate-mediated defense responses. |
AT1G19180 | JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile. |
AT5G10650 | JUL1 encode a RING-type E3 ubiquitin ligase that is involved in JA responses. It ubiquitinates the JAV1 jasmonic acid response repressor which is then degraded by the proteosome. Participates in ABA-mediated microtubule depolymerization, stomatal closure, and tolerance response to drought stress. |
AT2G26490 | JGB contains seven WD40 repeats and is highly conserved in flowering plants. Overexpression inhibits pollen germination. suggesting JGB is a negative regulator of pollen germination |
AT1G60160 | Member of the KT/KUP/HAK family of proton-coupled potassium transporters which have potential effect on cellular expansion. |
AT4G00630 | Encodes a K(+)/H(+) antiporter that modulates monovalent cation and pH homeostasis in plant chloroplasts or plastids. |
AT1G31120 | potassium transporter |
AT4G37470 | HTL belonging to the alpha/beta fold hydrolase superfamily. Mutant and over-expression studies indicates its involvement in seedling de-etiolation process. Involved in the perception of karrikins. Interacts with MAX2. Important for cotyledon expansion. |
AT4G01575 | Encodes a putative Kazal-type serine proteinase inhibitor that is highly expressed in seeds, mature roots and flowers. |
AT1G12360 | encodes a Sec1 protein and expressed throughout the plant. physically interacts with Syntaxin1 and is required for cytokinesis. |
AT4G10840 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
AT5G10470 | Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA2. Demarcates the division site in plant cells. |
AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
AT2G44130 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family. Component of SCF ubiquitin protein ligase, interacts with phenylalanine ammonia-lyase. AtKFB39 is a homolog of previously identified AtKFB50 (At3g59940) and specifically interacts with Arabidopsis PAL3 and PAL4 in vitro. In planta, together with AtKFB01, KFB20 and KFB50, it regulates PAL protein stability thus controlling phenylpropanoid biosynthesis . |
AT1G62990 | Encodes a homeodomain transcription factor of the Knotted family. May be involved in secondary cell wall biosynthesis. Mutants have moderately irregular xylem development. Expression of this gene is upregulated by SND1 and MYB46. |
AT5G25220 | A member of class II knotted1-like homeobox gene family (together with KNAT4 and KNAT5). Expressed in: hypocotyl-root boundary, anther-filament junction in flowers, ovule-funiculus and peduncle-silique boundaries, petioles and root. Light-regulated expression with differential response to red/far-red light. KNAT3 promoter activity showed cell-type specific pattern along longitudinal root axis, restricted mainly to the differentiation zone of the root, namely in the cortex and pericycle. Not detected in lateral root primordia |
AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
AT1G23380 | homeodomain transcription factor KNAT6, belonging to class I of KN transcription factor family (which also includes KNAT1 and KNAT2). Expression is increased in as and bop1 leaf mutants. |
AT5G63720 | Encodes KOKOPELLI (KPL). kokopelli (kpl) mutants display frequent single-fertilization events indicating that KPL is involved in double fertilization. KPL and an inversely transcribed gene, ARIADNE14 (ARI14), which encodes a putative ubiquitin E3 ligase, generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
AT1G65610 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
AT1G60370 | KUK F-box domain protein. Natural variants are associated with GWAS trait for root meristem and cell length. Polymorphisms in the coding sequence are the major causes of KUK allele? dependent natural variation in root development. |
AT2G46760 | D-arabinono-1,4-lactone oxidase family protein;(source:Araport11) |
AT2G32800 | protein kinase family protein;(source:Araport11) |
AT4G28350 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G03140 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G01540 | Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity. |
AT5G01190 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT2G29130 | Putative laccase, knockout mutant had reduced root elongation under PEG-induced dehydration.miR397b regulates root lignin deposition by regulating LACCASE2 expression during drought and phosphate deficiency. |
AT2G40370 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). Together with DP1/DIR12 involved in neolignan biosynthesis via sinapoylcholine/feruloylcholine. |
AT3G45130 | lanosterol synthase 1;(source:Araport11) |
AT2G03740 | Late embryogenesis abundant protein. Associates with and stabilizes membranes as part of cryoprotective response. |
AT5G06760 | Encodes LEA4-5, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. Most of the diverse set of LEA proteins can be grouped according to properties such as high hydrophilicity and high content of glycine or other small amino acids in what has been termed hydrophilins. LEA4-5 protects enzyme activities from the adverse effects induced by freeze-thaw cycles in vitro. |
AT3G21420 | LATERAL BRANCHING OXIDOREDUCTASE (LBO), encodes an oxidoreductase-like enzyme of the 2-oxoglutarate and Fe(II)-dependent dioxygenase superfamily. It is involved in the biosynthesis of strigolactones. |
AT3G58190 | This gene contains two auxin-responsive element (AuxRE). Required for triggering cell reprogramming during callus formation. |
AT1G18390 | Serine/Threonine kinase family catalytic domain protein;(source:Araport11) |
AT2G40190 | Encodes a putative alpha-1,2-mannosyltransferase in N-linked glycoprotein (homologous to yeast ALG11). Plays vital roles in cell-wall biosynthesis and abiotic stress response. Located in endoplasmic reticulum membrane. |
AT5G61850 | Encodes transcriptional regulator that promotes the transition to flowering.Involved in floral meristem development. LFY is involved in the regulation of AP3 expression, and appears to bring the F-box protein UFO to the AP3 promoter. Amino acids 46-120 define a protein domain that mediates self-interaction. |
AT4G32551 | LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors. |
AT4G10340 | photosystem II encoding the light-harvesting chlorophyll a/b binding protein CP26 of the antenna system of the photosynthetic apparatus The mRNA is cell-to-cell mobile. |
AT2G42610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT3G23290 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT5G58500 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT2G21050 | Encodes LAX2 (LIKE AUXIN RESISTANT), a member of the AUX1 LAX family of auxin influx carriers. Required for the establishment of embryonic root cell organization. |
AT3G18220 | Phosphatidic acid phosphatase (PAP2) family protein;(source:Araport11) |
AT2G15050 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT3G51590 | Encodes a member of the lipid transfer protein family. Proteins of this family are generally small (~9 kD), basic, expressed abundantly and contain eight Cys residues. The proteins can bind fatty acids and acylCoA esters and can transfer several different phospholipids. They are localized to the cell wall. The LTP12 promoter is active exclusively in the tapetum during the uninucleate microspore and bicellular pollen stages. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
AT1G68790 | Member of small gene family in Arabidopsis containing 4 members (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
AT3G52770 | ZPR3 is a small-leucine zipper containing protein that is involved in the establishment of leaf polarity. |
AT2G36307 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT2G24260 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
AT1G07900 | LOB domain-containing protein 1;(source:Araport11) |
AT2G40470 | LOB-domain containing protein. Involved in regulation of xylem differentiation- acts as a regulator of VND7 which is a master regulator of xylem cell differentiation. |
AT3G13850 | LOB domain-containing protein 22;(source:Araport11) |
AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
AT3G49940 | LOB domain-containing protein 38;(source:Araport11) |
AT2G19820 | LOB domain-containing protein 9;(source:Araport11) |
AT3G05780 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
AT2G28305 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT4G35190 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
AT2G02450 | NAC domain containing protein 35;(source:Araport11) |
AT3G10525 | Encodes LGO (loss of giant cells from organs) required for endoreduplication in sepal giant cell formation. Giant cells in both leaves and sepals are absent in lgo mutants. LGO is a member of a plant specific cell cycle inhibitor family SIAMESE and was originally named as SMR1(SIAMESE RELATED 1). |
AT1G50120 | Encodes a Golgi-localized protein which regulates pollen tube growth. Required for TGN formation and Golgi structure maintenance. |
AT5G16500 | Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. |
AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
AT4G19038 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT1G49435 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G43505 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G19905 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G14935 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G48231 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G28355 | low-molecular-weight cysteine-rich 5;(source:Araport11) |
AT3G61182 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G30064 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G02100 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. The mRNA is cell-to-cell mobile. |
AT2G25295 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
AT1G78970 | Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation. |
AT4G35180 | LYS/HIS transporter 7;(source:Araport11) |
AT5G40780 | Encodes LHT1 (lysine histidine transporter), a high-affinity transporter for cellular amino acid uptake in both root epidermis and leaf mesophyll. |
AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
AT4G15570 | Similar to yeast Sen1 (splicing endonuclease 1)helicase protein. Involved in female gametophyte development. The mRNA is cell-to-cell mobile. |
AT4G28580 | Transmembrane magnesium transporter that induces Mg transport from tapetum cell to locule. One of nine family members. Functions in pollen development. |
AT5G47480 | RGPR-related protein; SEC16A homolog. Part of endomembrane trafficking system. |
AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants. |
AT3G14720 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
AT2G14680 | myosin heavy chain-like protein;(source:Araport11) |
AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
AT4G14080 | Involved in the formation of the pollen wall. DYT1 and bHLH089 specifically recognize the TCATGTGC box to activate expression. |
AT2G02240 | F-box family protein;(source:Araport11) |
AT1G23230 | Mediator tail subunit, involved in transcriptional regulation. Mediator Complex Subunit, interacts with MED2, MED5, MED16 in the Regulation of Phenylpropanoid Biosynthesis. |
AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
AT1G37140 | Amember of mei2-like gene family; phylogenetic analysis revealed that it belongs to the fourth clade of mei2-like proteins, with conserved C-terminal RNA recognition motif (RRM) only. MCT1 expression is increased in the presence of ABA and RNAi suppression showed increased germination rates in the presence of ABA. |
AT1G60460 | Encodes a structural homolog of the archaeal topo VIB subunit that forms a complex with the two Arabidopsis thaliana SPO11 orthologs required for meiotic DSB formation (SPO11-1 and SPO11-2) and is essential for meiotic DSB formation. |
AT4G27860 | vacuolar iron transporter (VIT) family protein;(source:Araport11) |
AT5G52870 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT5G50440 | Member of Membrin Gene Family. Encodes a Golgi-localized SNARE protein MEMB12. MEMB12 is a target of miR393b-mediated gene silencing during Pseudomonas syringae pv. Tomato infection. Loss of function of MEMB12 leads to increased exocytosis of an antimicrobial pathogenesis-related protein, PR1. |
AT1G79340 | Encodes MCP2d, the predominant and constitutively expressed member of type II metacaspases (MCPs). MCP2d plays a positive regulatory role in biotic and abiotic stress-induced programmed cell death (PCD). Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. The mRNA is cell-to-cell mobile. |
AT2G29410 | member of Zinc transporter (ZAT) family |
AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
AT5G49810 | Arabidopsis thaliana methionine S-methyltransferase, an enzyme that catalyzes S -methylmethionine formation. The mRNA is cell-to-cell mobile. |
AT2G23620 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES1 appears to be involved in MeSA hydrolysis in planta. Expression of MES1 can restore systemic acquired resistance in SAR-deficient tobacco plants. This protein does not act on MeGA4, or MEGA9 in vitro. |
AT2G23590 | Encodes a protein shown to have carboxylesterase activity in vitro. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
AT5G23010 | Encodes a methylthioalkylmalate synthase, catalyzes the condensation reactions of the first two rounds of methionine chain elongation in the biosynthesis of methionine-derived glucosinolates. The mRNA is cell-to-cell mobile. |
AT5G55835 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAAAGAGAGCAC |
AT1G66725 | Encodes a microRNA that targets several SAMT family members. miR163, is highly expressed in A. thaliana diploids but down-regulated in A. thaliana autotetraploids and repressed in A. arenosa and A. suecica. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGAAGAGGACUUGGAACUUCGAU |
AT2G47585 | Encodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA. The miR164a pri-mRNA also encodes a regulatory peptide miPEP164a (AT2G47584) that regulates accumulation of its own miRNA. |
AT5G27807 | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCG. Early extra petal mutant (eep1). Pri-mRNA coordinates for MIR164c (converted to TAIR10 based on PMID19304749): Chr5: 9852483-9853314 (forward), length: 832 bp; exon coordinates: exon 1: 9852483-9853314; mature miRNA and miRNA* are located on exon 1. |
AT5G41905 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
AT3G04765 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAAGCUGCCAGCAUGAUCUUG |
AT5G58465 | Encodes a microRNA that targets the TAS3 family of tasiRNA-generating transcripts. Cleavage of TAS3 transcripts by miR390 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AAGCUCAGGAGGGAUAGCGCC |
AT1G26973 | Encodes a microRNA that targets both APS and AST family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CUGAAGUGUUUGGGGGAACUC. Predicted targets are ATP sulfurylases. |
AT4G05105 | Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG |
AT5G62162 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAGUUGCCCUG |
AT1G52185 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAGAATGCTATTGTAATCCAG |
AT4G03455 | Encodes a microRNA that targets several 2-phosphoglycerate kinase-related family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGGGACGAGAUGUUUUGUUG |
AT5G03552 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGCGGGAAGCAUUUGCACAUG |
AT4G24415 | Encodes a microRNA that targets AGL16. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGACCAUUUGUGAGAAGGGA |
AT3G53016 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUCGGUUCGCGAUCCACAAG |
AT4G14504 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AAGAUAAGCGCCUUAGUUCUGA |
AT2G17780 | Encodes a mechanosensitive channel candidate MCA2. The three-dimensional structure of MCA2 was reconstructed and appears to comprise a small transmembrane region and large cytoplasmic region. |
AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G42560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO9 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO10. The gene is expressed during early seedling growth, in cotyledon vascular system, in flowers (with strong expression in anthers) in siliques and fruit abscission zone; not expressed in roots, or in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
AT1G26800 | MPSR1 is cytoplasmic E3 ligase that senses misfolded proteins independently of chaperones and targets those proteins for degradation via the 26S proteasome. Involved in the regulation of the homeostasis of sensor NLR immune receptors. |
AT2G04540 | Encodes a mitochondrial beta-ketoacyl-ACP synthase. |
AT1G09575 | Mitochondrial calcium channel. |
AT1G48030 | Encodes a mitochondrial lipoamide dehydrogenase whose expression is induced by light. |
AT5G40440 | Encodes a mitogen-activated protein kinase kinase. Activates MPK8 and is a target of MPKKK20. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization. |
AT3G50310 | Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5. |
AT4G36950 | member of MEKK subfamily |
AT3G07980 | MAP3K epsilon protein kinase 2 is functionally redundant with MAP3Ke1. Required for pollen development but not essential. |
AT3G13530 | MAP3K epsilon protein kinase 1 is functionally redundant with MAP3Ke2. Required for pollen development but not essential. map3ke1;map3ke2 double-mutant pollen grains develop plasma membrane irregularities following pollen mitosis I. Localized primarily in the plasma membrane. Expressed in leaf trichomes, root columella cells and developing ovules. |
AT5G11300 | mitotic-like cyclin, core cell cycle gene that is expressed only in roots (RT_PCR), portions with mitotic activity only (whole mount in situ). |
AT1G01453 | HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals. |
AT1G31720 | chitin synthase, putative (DUF1218);(source:Araport11) |
AT2G28390 | SAND family protein;(source:Araport11) |
AT1G19850 | Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder. |
AT4G18640 | Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile. |
AT2G03720 | Involved in root hair development |
AT2G33340 | Encodes MAC3B, a U-box proteins with homology to the yeast and human E3 ubiquitin ligase Prp19. Associated with the MOS4-Associated Complex (MAC). Involved in plant innate immunity. Regulator of flowering time. |
AT1G28280 | VQ motif-containing protein;(source:Araport11) |
AT5G10490 | A member of MscS-like gene family, structurally very similar to MSL3, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL2-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. |
AT1G58200 | A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity. |
AT2G17010 | MSL8 encodes a protein with similarity to mechano-sensitive channel proteins. MSL8 is expressed specifically in pollen and germinating pollen tubes.It regulates pollen germination and is needed to maintain cellular integrity during pollen hydration and germination. |
AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
AT3G06860 | Encodes a multifunctional protein. Involved in peroxisomal fatty acid beta oxidation. Loss-of-function mutant lacks hydroxyacyl-CoA dehydrogenase activity and have reduced levels of long-chain enoyl-CoA hydratase activity. The mutant has fewer but larger peroxisomes. The mRNA is cell-to-cell mobile. |
AT1G04150 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
AT1G22610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT2G42680 | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is developmentally regulated. The mRNA is cell-to-cell mobile. |
AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
AT2G25230 | Encodes a putative transcription factor (MYB100). |
AT2G32460 | Member of the R2R3 factor gene family. |
AT1G63910 | member of MYB3R- and R2R3- type MYB- encoding genes |
AT1G69560 | Encodes LOF2 (LATERAL ORGAN FUSION2), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF1 (At1g26780). |
AT3G02940 | Encodes a putative transcription factor (MYB107). |
AT3G55730 | putative transcription factor MYB109 (MYB109) mRNA, |
AT1G48000 | Encodes a putative transcription factor (MYB112). |
AT1G26780 | Encodes LOF1 (LATERAL ORGAN FUSION1), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF2 (At1g69560). |
AT5G58850 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB119). |
AT5G55020 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB120). |
AT1G74080 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB122). |
AT1G06180 | member of MYB3R- and R2R3- type MYB- encoding genes |
AT3G23250 | Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity |
AT5G15310 | Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation. |
AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
AT2G47190 | Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin. |
AT2G39880 | Encodes a putative transcription factor (MYB25). |
AT5G61420 | Encodes a nuclear localized member of the MYB transcription factor family. Involved in positive regulation of aliphatic glucosinolate biosynthesis.Expression is induced by touch, wounding and glucose. |
AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
AT3G24310 | snapdragon myb protein 305 homolog (myb) |
AT1G74650 | Member of the R2R3 factor gene family. |
AT4G34990 | Member of the R2R3 factor gene family. |
AT3G48920 | Member of the R2R3 factor gene family. |
AT3G46130 | Encodes a putative transcription factor (MYB48) that functions to regulate flavonol biosynthesis primarily in cotyledons. |
AT5G54230 | MYB49 transcription factor. Binds to and promotes expression of genes involved in cadmium accumulation. Interacts with ABI5 which acts as a repressor preventing MYB49 induced expression of target genes. |
AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
AT1G79180 | Member of the R2R3 factor gene family. |
AT5G11050 | Member of R2R3-MYB transcription factor gene family. |
AT3G11440 | Member of the R2R3-MYB gene family. Similar to GA-induced Barley myb gene. May be induced during germination in response to GA. Double mutants with MYB33 are male sterile, showing defects in pollen development and anther development. Contains a binding site for miRNA159 and may be spatially regulated by this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. The male sterile phenotype of the MYB33/MYB65 double mutant is light and temperature sensitive. Fertility can be restored with increased light intensity and lower temperatures. |
AT5G65790 | Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development. |
AT1G56160 | Encodes a member of the R2R3 transcription factor gene family that is involved in mediating induced systemic resistance. Genetic analysis of loss of function mutants and overexpressor lines indicates MYB72 is necessary but not sufficient for ISR.Interacts in vivo with EIL3. |
AT4G37260 | Member of the R2R3 factor gene family. The mRNA is cell-to-cell mobile. |
AT4G05100 | Member of the R2R3 factor gene family. |
AT5G52600 | Encodes a nuclear-localized transcription activator that is a member of the R2R3 factor gene family. MYB82 and GL1 can form homodimers and heterodimers at R2R3-MYB domains. At least one of the two introns in MYB82 is essential to the protein?s trichome developmental function. |
AT3G49690 | Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB84, regulates axillary meristem formation. |
AT4G22680 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
AT5G26660 | myb domain protein 86;(source:Araport11) |
AT5G10280 | Encodes a putative transcription factor (MYB92). |
AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
AT1G71030 | Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves. |
AT2G46810 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
AT1G14520 | Encodes MIOX1. Belongs to myo-inositol oxygenase gene family. |
AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
AT4G26260 | Encodes a myo-inositol oxygenase, which is the first enzyme in the inositol route to ascorbate (L‐ascorbic acid, AsA, vitamin C). Overexpression results in enhanced biomass and abiotic stress tolerance. |
AT1G08800 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT5G57020 | Arabidopsis thaliana myristoyl-CoA:protein N-myristoyltransferase. |
AT1G52040 | Encodes myrosinase-binding protein expressed in flowers. |
AT3G16440 | myrosinase-binding protein-like protein (AtMLP-300B) mRNA, |
AT5G14180 | Myzus persicae-induced lipase 1;(source:Araport11) |
AT2G22910 | N-acetyl-l-glutamate synthase 1;(source:Araport11) |
AT1G31070 | Encodes a protein that functions as an N-acetylglucosamine-1-phosphate uridylyltransferase that catalyzes the formation of UDP-N-acetylglucosamine (UDP-GlcNAc). This is an essential precursor for glycolipid and glycoprotein synthesis and is also used for regulatory protein modification in signaling pathways. The enzyme can also catalyze the reverse reaction using both UDP-GlcNAc and the less common UDP-N-acetylgalactosamine as substrates. |
AT2G39030 | Encodes a protein that acts as an ornithine N-delta-acetyltransferase, leading to the formation of N-delta-actetylornithine. This compound is likely used in plant defense and levels of it are increased in Arabidopsis plants in response to MeJA and ABA. The mRNA is cell-to-cell mobile. |
AT2G19620 | Plays a role in dehydration stress response. |
AT4G17830 | NAOD encodes a functional acetylornithine deacetylase. Silenced lines plants flower early but have reduced fertility (siliques do not develop) as well as reduced ornithine levels.NAOD mediates a linear pathway for ornithine biosynthesis. |
AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
AT1G14660 | member of putative Na+/H+ antiporter (AtNHX) family. Functions as a plasma membrane Li+/H+ antiporter. Involved in Li+ efflux and detoxification. |
AT2G46770 | NAC transcription factor NST1. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls and siliques. An NST1 promoter fusion was detected in various tissues in which lignified secondary walls develop. Both MYC2 and MYC4 bind to the NST1 promoter and appear to regulate its expression in response to blue light. |
AT1G33060 | NAC 014;(source:Araport11) |
AT5G39610 | Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510. |
AT1G56010 | Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. |
AT1G28470 | NAC domain containing protein 10;(source:Araport11) |
AT5G61430 | NAC domain containing protein 100;(source:Araport11) |
AT1G61110 | NAC transcription regulator. Regulates endosperm cell expansion during germination. |
AT1G65910 | NAC domain containing protein 28;(source:Araport11) |
AT1G02220 | NAC domain transcription factor which functions as a negative regulator of the TDIF-PXY module and fine-tunes TDIF signaling in vascular development. Controls the balance of xylem formation and cambial cell divisions. |
AT3G29035 | Encodes a protein with transcription factor activity. Note: this protein (AT3G29035) on occasion has also been referred to as AtNAC3, not to be confused with the AtNAC3 found at locus AT3G15500. The mRNA is cell-to-cell mobile. |
AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
AT2G17040 | Member of the NAC transcription factor family and more specifically, the ONAC022 subfamily. Involved in leaf and inflorescence stem morphogenesis. The mRNA is cell-to-cell mobile. |
AT2G33480 | NAC domain containing protein 41;(source:Araport11) |
AT2G43000 | Encodes a NAC transcription factor induced by hydrogen peroxide (H2O2). Involved in senescence. Over expression of the gene strongly delays senescence and enhances tolerance to various abiotic stresses. |
AT3G04060 | NAC046 is a member of the NAC domain containing family of transcription factors. It was identified in a screen for regulators of chlorophyll protein gene expression. Mutants in NAC046 have delayed senescence and increased CHL content suggesting a role in regulation of senescence and chlorophyll degradation. |
AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
AT3G17730 | NAC domain containing protein 57;(source:Araport11) |
AT3G18400 | NAC domain containing protein 58;(source:Araport11) |
AT4G10350 | NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root. |
AT5G07680 | NAC domain containing protein 80;(source:Araport11) |
AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
AT5G14000 | NAC domain containing protein 84;(source:Araport11) |
AT5G14490 | NAC domain containing protein 85;(source:Araport11) |
AT5G22380 | NAC domain containing protein 90;(source:Araport11) |
AT5G41090 | NAC domain containing protein 95;(source:Araport11) |
AT5G46590 | Transcription factor required for the initiation of cell division during wound healing. Redundantly involved with ANAC071 in the process of "cambialization". |
AT1G21640 | Encodes a protein with NAD kinase activity. The protein was also shown to bind calmodulin. |
AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
AT2G20800 | NAD(P)H dehydrogenase B4;(source:Araport11) |
AT4G00570 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the beta family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the alpha-type NAD-ME2 (At2g13560). NAD-ME2 transcript and protein levels are higher during the night than during the day. |
AT4G09350 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G53460 | NADH-dependent glutamate synthase The mRNA is cell-to-cell mobile. |
AT1G16520 | NAI1 interacting protein, involved in ER body and vesicle formation. |
AT3G11660 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus. Localization of the gene product is similar to that of NHL3 (plasma membrane) but it is yet inconclusive. |
AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
AT1G74360 | NILR1 encodes a serine/threonine kinase involved in defense response to nematodes. |
AT2G17730 | Intrinsic thylakoid membrane protein that fixes RPOTmp on the stromal side of the thylakoid membrane. |
AT3G22790 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It binds filamentous actin and is localized to the plasma membrane and plasmodesmata. |
AT2G22560 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT2G38010 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
AT5G58980 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
AT2G46870 | Member of the RAV family of DNA binding proteins. Contains B3 domain. Recognizes 5'-CACCTG-'3 motif. |
AT1G01030 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT5G23230 | nicotinamidase 2;(source:Araport11) |
AT2G23420 | nicotinate phosphoribosyltransferase 2;(source:Araport11) |
AT5G55810 | encodes a bi-functional enzyme that expresses both nicotinamide-nucleotide adenylyltransferase (2.7.7.1) and nicotinate-nucleotide adenylyltransferase (2.7.7.18)activity. |
AT1G42470 | Patched family protein;(source:Araport11) |
AT4G38350 | Patched family protein;(source:Araport11) |
AT3G12320 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism. |
AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
AT4G24020 | Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile. |
AT1G64530 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT2G43500 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT3G59580 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
AT1G08100 | Encodes a high-affinity nitrate transporter. |
AT1G08090 | High-affinity nitrate transporter. Up-regulated by nitrate. Functions as a repressor of lateral root initiation independently of nitrate uptake. |
AT1G62580 | Encodes a flavin monooxygenase that binds NO, has a higher affinity for NO than for O(2) and can generate cGMP from GTP in vitro in an NO-dependent manner. |
AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
AT5G22300 | encodes a nitrilase isomer. The purified enzyme shows a strong substrate specificity for beta-cyano-L-alanine, a intermediate product of the cyanide detoxification pathway. The mRNA is cell-to-cell mobile. |
AT3G16390 | Encodes a nitrile-specifier protein NSP3. NSP3 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile. |
AT5G48180 | Encodes a nitrile-specifier protein NSP5. NSP5 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. |
AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
AT4G18910 | Encodes an aquaporin homolog. Functions in arsenite transport and tolerance.When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
AT4G10380 | Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells. |
AT4G19030 | an aquaporin whose expression level is reduced by ABA, NaCl, dark, and desiccation. is expressed at relatively low levels under normal conditions. Also functions in arsenite transport and tolerance. |
AT2G37010 | member of NAP subfamily |
AT5G64330 | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
AT3G03530 | PHOSPHOESTERASE FAMILY PROTEIN, NPC4 is significantly induced upon phosphate starvation and plays an important role in the supply of inorganic phosphate and diacylglycerol from membrane-phospholipids during phosphate deprivation.Has a preference for glycosylinositolphosphorylceramide (GIPC) as a substrate. |
AT1G64280 | This gene is a key regulator of the salicylic acid (SA)-mediated systemic acquired resistance (SAR) pathway. It is similar to the transcription factor inhibitor I kappa B, and contains ankyrin repeats. It confers resistance to the pathogens Pseudomonas syringae and Peronospora parasitica in a dosage-dependent fashion. Although transgenic Arabidopsis plants overexpressing NPR1 acquire enhanced sensitivity to SA and (benzothiadiazole) BTH, they display no obvious detrimental morphological changes and do not have elevated pathogenesis-related gene expression until activated by inducers or pathogens. |
AT1G65420 | Chloroplast localized YCF20-like gene involved in nonphotochemical quenching. Has overlapping functions with npq6. |
AT4G11910 | Acts antagonistically with SGR1 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
AT5G67385 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
AT1G27080 | Encodes a protein with low-affinity nitrate transporter activity that is expressed in the vascular tissue of the funiculus and the silique. This plasma membrane-localized enzyme is predicted to have 12 transmembrane domains. Plants lacking NRT1.6 have reduced levels of nitrate in their seeds and have increased levels of early embryonic developmental defects and seed abortion. |
AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile. |
AT1G68570 | NPF3.1 is a membrane localized GA transporter that is expressed in the root endodermis. |
AT3G25260 | Major facilitator superfamily protein;(source:Araport11) |
AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
AT1G69850 | Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems. |
AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
AT3G21670 | Major facilitator superfamily protein;(source:Araport11) |
AT4G21680 | Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance. |
AT1G32450 | Transmembrane nitrate transporter. Involved in xylem transport of nitrate from root to shoot. Induced in response to high and low concentrations of nitrate. Not involved in nitrate uptake. Expressed in root pericycle cells under the control of MYB59. Also functions as a proton-coupled H+/K+ antiporter for K+ loading into the xylem. |
AT4G13350 | Encodes a GTPase that interacts with nuclear shuttle proteins (NSPs) from a number of different plant viruses. The gene is widely expressed and NIG transcript levels do not rise in response to viral infection. This cytoplasmic protein does not directly interact with a viral movement protein (MP), but, it does promote the movement of NSP from the nucleus to the cytoplasm. Overexpression of NIG in Arabidopsis plants renders them more sensitive to geminivirus infection. |
AT3G25560 | NSP-interacting kinase 2;(source:Araport11) |
AT2G27300 | NTL8 is a membrane-associated NAC transcription factor that binds both TRY and TCL1. Overexpression results in fewer trichomes. |
AT2G19400 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT1G06670 | nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins The mRNA is cell-to-cell mobile. |
AT1G02560 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
AT5G08190 | nuclear factor Y, subunit B12;(source:Araport11) |
AT2G47810 | nuclear factor Y, subunit B5;(source:Araport11) |
AT5G47670 | Encodes LEC1-Like (L1L), closely related to LEC1 (Leafy Cotyledon1). Functions as a regulator of embryo development. |
AT1G19520 | Ribosomal pentatricopeptide repeat protein |
AT3G57660 | Encodes a subunit of RNA polymerase I (aka RNA polymerase A). The mRNA is cell-to-cell mobile. |
AT1G63020 | Encodes one of two alternative largest subunits of a putative plant-specific RNA polymerase IV (aka RNA polymerase D). Required for posttranscriptional gene silencing. |
AT1G10540 | nucleobase-ascorbate transporter 8;(source:Araport11) |
AT4G31240 | protein kinase C-like zinc finger protein;(source:Araport11) |
AT5G18860 | Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. |
AT5G50960 | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. |
AT1G80300 | Encodes an ATP/ADP transporter. The mRNA is cell-to-cell mobile. |
AT4G25434 | nudix hydrolase homolog 10;(source:Araport11) |
AT3G26690 | Encodes AtNUDT13, a mitochondrial Nudix hydrolase specific for long-chain diadenosine polyphosphates. |
AT5G47650 | Encodes an ADP-ribose pyrophosphatase that confers enhanced tolerance to oxidative stress. |
AT5G44160 | NUC is a member of the BIRD group of transcriptional regulators and is required for the formative divisions that pattern the root. the ground tissue into cortex and endodermis. |
AT5G60850 | Encodes a zinc finger protein. |
AT5G53450 | OBP3-responsive protein 1;(source:Araport11) |
AT2G06010 | encodes a novel protein whose expression level is induced in lines overexpressing salicylic-acid (SA)-inducible Arabidopsis DNA binding with one finger (Dof) transcription factor, called OBF-binding protein 3. |
AT5G06960 | Encodes a basic leucine zipper (B-ZIP) containing protein that interacts with NPR1 to promote expression of salicylic acid induced genes. Binds the ocs-element. |
AT1G06160 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT5G01170 | hypothetical protein (DUF740);(source:Araport11) |
AT3G46990 | DUF740 family protein, putative (DUF740);(source:Araport11) |
AT4G25140 | Encodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds. |
AT4G10770 | oligopeptide transporter |
AT2G41225 | Encodes a protein of unknown function that is involved in regulation of cell expansion. Based on sequence similarity OSR2 is localized to the plasma membrane. It is expressed in organs that are undergoing cell expansion. Over-expression modifies plant sensitivity to ethylene, leading to improved drought tolerance. |
AT2G15820 | Encodes a protein that promotes splicing of type II introns. otp51 mutants fail to splice intron 2 of plastid ycf3 transcripts, a factor required for the assembly of Photosystem I. Therefore, homozygous otp51 mutants have profound photosynthetic defects and can only survive in sucrose-supplemented in vitro cultures under low light conditions. OTP51 may also be involved in splicing several other transcripts and precursor forms of the trnL, trnG, trnI, and trnA transcripts also accumulate in otp51 mutants. Although OTP51 shares some homology with DNA endonucleases, it lacks key catalytic residues suggesting that it does not participate in DNA cleavage. |
AT1G73220 | Encodes Organic Cation Transporter 1 (OCT1), likely to be involved in polyamine transport. |
AT2G35720 | Encodes OWL1, a J-domain protein involved in perception of very low light fluences. |
AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
AT4G22540 | OSBP(oxysterol binding protein)-related protein 2A;(source:Araport11) |
AT3G09300 | OSBP(oxysterol binding protein)-related protein 3B;(source:Araport11) |
AT4G25860 | OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11) |
AT5G57240 | OSBP(oxysterol binding protein)-related protein 4C;(source:Araport11) |
AT4G11650 | osmotin-like protein |
AT5G04820 | ovate family protein 13;(source:Araport11) |
AT2G30395 | Member of the plant specific ovate protein family of unknown function. |
AT2G18500 | ovate family protein 7;(source:Araport11) |
AT2G25840 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
AT2G05590 | TLDc domain protein that confers increased tolerance to oxidative stress. |
AT1G12480 | Encodes a membrane protein with 10 predicted transmembrane helices. SLAC1 is a multispanning membrane protein expressed predominantly in guard cells that plays a role in regulating cellular ion homeostasis and S-type anion currents. SLAC1 is important for normal stomatal closure in response to a variety of signals including elevated CO2, ozone, ABA, darkness, and humidity. SLAC1:GFP localizes to the plasma membrane. |
AT3G07680 | Encodes an Golgi-localized p24 protein. Interacts with p24delta5 at ER export sites for ER exit and coupled transport to the Golgi apparatus. The mRNA is cell-to-cell mobile. |
AT5G18660 | Encodes a protein with 3,8-divinyl protochlorophyllide a 8-vinyl reductase activity. Mutants accumulate divinyl chlorophyll rather than monovinyl chlorophyll. |
AT1G19300 | The PARVUS/GLZ1 gene encodes a putative family 8 glycosyl transferase that contributes to xylan biosynthesis. Its gene expression shows good co-variance with the IRX3 gene involved in secondary cell wall synthesis. PARVUS/GLZ1 is predicted to have galacturonosyltransferase activity and may be involved in the formation of the complex oligosaccharide sequence present at the reducing end of xylan. PARVUS is expressed in cells undergoing secondary wall thickening, and parvus mutants have thinner cell walls. |
AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
AT2G14610 | PR1 gene expression is induced in response to a variety of pathogens. It is a useful molecular marker for the SAR response. Though the Genbank record for the cDNA associated to this gene is called 'PR-1-like', the sequence actually corresponds to PR1. Expression of this gene is salicylic-acid responsive. |
AT3G57260 | beta 1,3-glucanase |
AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
AT1G74490 | Protein kinase superfamily protein;(source:Araport11) |
AT1G26970 | Protein kinase superfamily protein;(source:Araport11) |
AT2G28590 | Protein kinase superfamily protein;(source:Araport11) |
AT5G01020 | Protein kinase superfamily protein;(source:Araport11) |
AT3G62060 | Pectinacetylesterase family protein;(source:Araport11) |
AT4G19410 | Pectinacetylesterase family protein;(source:Araport11) |
AT4G19420 | Pectinacetylesterase family protein;(source:Araport11) |
AT2G45220 | Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea. |
AT1G53830 | encodes a pectin methylesterase |
AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
AT4G15340 | Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast. |
AT5G04810 | Pentatricopeptide which is essential during the early stages of embryo development and acts in the plastid nucleoids as the factor responsible of rps12 intron 1 trans-splicing and, indirectly, in the assembly of 70S ribosomes and plastid translation. |
AT2G03380 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G25130 | Encodes a chloroplast-localized methionine sulfoxide reductase that is a member of the MSRA family. Involved in protection of chloroplasts from oxidative stress. |
AT5G49570 | Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants). |
AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT5G23940 | Encodes PERMEABLE LEAVES3 (PEL3), a putative acyl-transferase. Mutation in this locus results in altered trichome phenotype (trcichomes become tangled during leaf expansion). Additional phenotype includes altered cuticle layer. |
AT2G41480 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
AT4G11290 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
AT1G14540 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
AT3G49120 | Class III peroxidase Perx34. Expressed in roots, leaves and stems. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
AT1G44970 | Encodes a class III peroxidase that is genetically redundant with PRX40, expressed in the tapetum, and essential for proper anther and pollen development. Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
AT3G47430 | member of the peroxin11 (PEX11) gene family, located on the peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile. |
AT3G61070 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
AT3G04460 | RING finger protein involved in peroxisome biogenesis. Also involved in peroxisomal import of nitric oxide synthase. Has been demonstrated to have E3 ubiquitin ligase activity. |
AT3G06050 | Encodes a mitochondrial matrix localized peroxiredoxin involved in redox homeostasis. Knockout mutants have reduced root growth under certain oxidative stress conditions. |
AT2G22780 | encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
AT5G35210 | Encodes a chloroplast envelope-bound plant homeodomain (PHD) transcription factor with transmembrane domains that functions in multiple retrograde signal pathways. The proteolytic cleavage of PTM occurs in response to retrograde signals and amino-terminal PTM accumulates in the nucleus, where it activates ABI4 transcription in a PHD-dependent manner associated with histone modifications. |
AT2G37040 | Encodes PAL1, a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
AT3G29670 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. The mRNA is cell-to-cell mobile. |
AT5G04230 | Member of Phenylalanine ammonialyase (PAL) gene family. Differs significantly from PAL1 and PAL2 and other sequenced plant PAL genes. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
AT5G13800 | Encodes a pheophytinase that is involved in chlorophyll breakdown. Its transcript levels increase during senescence and pph-1 mutants have a stay-green phenotype. |
AT5G02460 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT1G63090 | phloem protein 2-A11;(source:Araport11) |
AT5G52120 | phloem protein 2-A14;(source:Araport11) |
AT5G45090 | phloem protein 2-A7;(source:Araport11) |
AT2G02230 | phloem protein 2-B1;(source:Araport11) |
AT5G39400 | Calcium/lipid-binding (CaLB) phosphatase;(source:Araport11) |
AT3G23430 | Encodes a protein with the mainly hydrophilic N-terminal and the C-terminal containing 6 potential membrane-spanning domains. The mutant is deficient in the transfer of phosphate from root epidermal and cortical cells to the xylem. Its expression is repressed by phosphate (Pi) in shoots, and transiently induced by phosphite (Phi) in roots and shoots. PHO is expressed in developing ovules and plays a role in the transfer of Ph from maternal tissues to filial tissues. |
AT5G43350 | Encodes an inorganic phosphate transporter Pht1;1. Mutants display enhanced arsenic accumulation. Under high arsenate concentrations, PHT1;1 levels are reduced and it is delocalized from the plasma membrane. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).PHT1;1 expression is transcriptionally regulated by WRKY6 and by PHR1. |
AT5G43360 | Encodes Pht1;3, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
AT5G43370 | Encodes a phosphate transporter Pht1;2. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341) The mRNA is cell-to-cell mobile. |
AT3G48850 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
AT1G35140 | EXL1 is involved in the C-starvation response. Phenotypic changes of an exl1 loss of function mutant became evident only under corresponding experimental conditions. For example, the mutant showed diminished biomass production in a short-day/low light growth regime, impaired survival during extended night, and impaired survival of anoxia stress. |
AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
AT3G09920 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) family member. Family members are key enzymes in the process of phosphatidylinositol signaling pathway and have essential functions in growth, development, and biotic and abiotic stresses responses in plants |
AT1G03050 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
AT1G15110 | PSS1 encodes a base-exchange-type Phosphatidylserine (PS) synthase. Mutant analysis revealed its role in pollen maturation. |
AT2G42600 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.PPC1 and PPC2 are crucial for balancing carbon and nitrogen metabolism. |
AT1G08650 | Encodes a phosphoenolpyruvate carboxylase kinase that is expressed at highest levels in leaves. Expression is induced by light. The mRNA is cell-to-cell mobile. |
AT1G12680 | phosphoenolpyruvate carboxylase-related kinase 2;(source:Araport11) |
AT4G29220 | phosphofructokinase 1;(source:Araport11) |
AT5G26570 | chloroplastidic phosphoglucan, water dikinase (PWD) which is required for normal degradation of leaf starch in Arabidopsis. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C3 position. |
AT4G24450 | phosphoglucan, water dikinase;(source:Araport11) |
AT1G13680 | Encodes a phospholipase C-like protein that serves as a convergence point for fumonisin B1 and extracellular ATP signalling, and functions in Arabidopsis stress response to fumonisin B1. |
AT5G25370 | member of C2-PLD subfamily. Analyses on the gene structures/sequences, overall amino acid sequences, and domain structures indicate that PLDalpha3 is most closely related to other two PLDalphas than to other PLDs. Phylogenetic analysis has not identified a true ortholog for PLDalpha3. Involved in hyperosmotic response. |
AT4G39670 | Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes. |
AT5G13640 | arabidopsis phospholipid:diacylglycerol acyltransferase (PDAT) |
AT2G42910 | Phosphoribosyltransferase family protein;(source:Araport11) |
AT1G32060 | phosphoribulokinase;(source:Araport11) |
AT1G12370 | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
AT3G12810 | Encodes a protein similar to ATP-dependent, chromatin-remodeling proteins of the ISWI and SWI2/SNF2 family. Genetic analyses suggest that this gene is involved in multiple flowering pathways. Mutations in PIE1 results in suppression of FLC-mediated delay of flowering and causes early flowering in noninductive photoperiods independently of FLC. PIE1 is required for expression of FLC in the shoot apex but not in the root.Along with ARP6 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). The mRNA is cell-to-cell mobile. |
AT3G13670 | MUT9-like protein kinase. Contributes to phosphorylation of photoexcited CRY2. Interaction with CRY2 occurs via the non catalytic PPKC domain.MLK4 phosphorylates the conserved H2A serine 95 residue. Synthetic mutants that cannot phosphorylate H2AS95 fail to complement the late flowering phenotype suggesting that MLK4 promotes long day flowering via phosphorylation.MLK4 is required for H2A295 phosphorylation of GI. |
AT5G43750 | NAD(P)H dehydrogenase 18;(source:Araport11) |
AT1G14150 | Encodes a subunit of the NAD(P)H dehydrogenase complex located in the chloroplast thylakoid lumen. |
AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
AT2G30170 | Encodes a chloroplast PP2C phosphatase that is required for efficient dephosphorylation of PSII proteins and involved in light acclimation.Loss of function enhances immunity to bacterial pathogens. |
AT2G20890 | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane?delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. The mRNA is cell-to-cell mobile. |
AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
AT5G29000 | MYB-CC family member. PHL1 acts redundantly with PHR1 to regulate responses to Pi starvation. |
AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
AT3G16500 | phytochrome-associated protein 1 (PAP1) |
AT3G46640 | Encodes a myb family transcription factor with a single Myb DNA-binding domain (type SHAQKYF) that is unique to plants and is essential for circadian rhythms, specifically for transcriptional regulation within the circadian clock. LUX is required for normal rhythmic expression of multiple clock outputs in both constant light and darkness. It is coregulated with TOC1 and seems to be repressed by CCA1 and LHY by direct binding of these proteins to the evening element in the LUX promoter. The mRNA is cell-to-cell mobile. |
AT4G16500 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT2G02220 | Encodes a protein interacting with phytosulfokine, a five amino acid sulfated peptide (YIYTQ). Contains dual guanylate cyclase and kinase catalytic activities that operate in vivo. |
AT5G65870 | Probable phytosulfokines 5 precursor, coding for a unique plant peptide growth factor. |
AT1G54570 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
AT2G48060 | Similar to mechanically sensitive ion channel identified in mouse. Mutants display root helical growth phenotype in agar media suggesting a role in mechanoperception at the root cap. |
AT2G01190 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT2G01140 | Aldolase superfamily protein;(source:Araport11) |
AT1G73590 | Encodes an auxin efflux carrier involved in shoot and root development. It is involved in the maintenance of embryonic auxin gradients. Loss of function severely affects organ initiation, pin1 mutants are characterised by an inflorescence meristem that does not initiate any flowers, resulting in the formation of a naked inflorescence stem. PIN1 is involved in the determination of leaf shape by actively promoting development of leaf margin serrations. In roots, the protein mainly resides at the basal end of the vascular cells, but weak signals can be detected in the epidermis and the cortex. Expression levels and polarity of this auxin efflux carrier change during primordium development suggesting that cycles of auxin build-up and depletion accompany, and may direct, different stages of primordium development. PIN1 action on plant development does not strictly require function of PGP1 and PGP19 proteins. |
AT1G76520 | Auxin efflux carrier family protein;(source:Araport11) |
AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
AT4G02075 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT2G32960 | Encodes an atypical dual-specificity phosphatase. |
AT1G55010 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
AT4G33330 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
AT1G54940 | Encodes a xylan glucuronosyltransferase. |
AT4G35470 | Encodes PIRL4, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
AT4G26050 | Encodes PIRL8, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
AT5G42340 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT3G54790 | ARM repeat superfamily protein;(source:Araport11) |
AT5G18320 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress.Expression in roots is enhanced by auxin and to a lesser extent ABA and cytokinin treatment. |
AT4G21350 | Encodes a U-box/ARM repeat protein required fore self-incompatibility. |
AT3G07360 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT1G23030 | Encodes a plant U-Box protein that is capable of binding and ubiquitinating a variety of targets including MYC2,LRR1,KIN and acting as an E3 ligase. Regulates a number of physiological hormonal and environment al responses via selective degradation of targets.Unlike PUB10, its closest homolog in Arabidopsis, it does not appear to play a major role in the MeJA-mediated response. |
AT3G54110 | Member of Uncoupling protein PUMP2 family. Encodes a mitochondrial uncoupling protein AtUCP1 involved in maintain the redox poise of the mitochondrial electron transport chain to facilitate photosynthetic metabolism. Disruption of UCP1 results in a photosynthetic phenotype. Specifically there is a restriction in photorespiration with a decrease in the rate of oxidation of photorespiratory glycine in the mitochondrion. This change leads to an associated reduced photosynthetic carbon assimilation rate. The mRNA is cell-to-cell mobile. |
AT4G00430 | a member of the plasma membrane intrinsic protein subfamily PIP1. involved redundantly with PIP1;1/2/3/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
AT3G54820 | plasma membrane intrinsic protein 2;(source:Araport11) |
AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
AT1G69295 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
AT5G43980 | Encodes a plasmodesmal protein that affects the intercellular movement of molecules through the plasmodesmata. The cytoplasmic C-terminal portion of the protein is connected to the apoplastic N-terminal portion of the protein by a single transmembrane domain (TMD). It is transported to the plasmodesmata through the secretory pathway. PDLP1 has two DUF26 domains and a signal peptide, but the proper localization of the protein appears to depend on the TMD. |
AT1G04520 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. |
AT1G19880 | Encodes a regulator of chromatin condensation 1 (RCC1) family protein; confers plasticity of rosette diameter in response to changes in N availability. |
AT5G53280 | An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid division machinery. Similar to ARC5, PDV1 localized to a discontinuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. Topological analysis showed that the large N-terminal region of PDV1 upstream of the transmembrane helix bearing a putative coiled-coil domain is exposed to the cytosol. Mutation of the conserved PDV1 C-terminal Gly residue did not block PDV1 insertion into the outer envelope membrane but did abolish its localization to the division site. The mRNA is cell-to-cell mobile. |
AT3G62590 | PLIP3 is a glycerolipid A1 lipase with substrate specificity for phosphatidylglycerol. Expression is induced by ABA. |
AT1G42550 | Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile. |
AT5G26160 | light-independent protochlorophyllide reductase subunit;(source:Araport11) |
AT4G20130 | PEP complex component. |
AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
AT5G16150 | Encodes a putative plastidic glucose transporter. |
AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
AT3G20840 | Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors. |
AT1G51190 | Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors. |
AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
AT2G16505 | Encodes a Maternally expressed gene (MEG) family protein. Expressed in pollen and involved in pollen-stigma interaction. |
AT1G50610 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
AT1G22760 | Putative poly(A) binding protein May there fore function in posttranscriptional regulation, including mRNA turnover and translational initiation. Expression detected only in floral organs. |
AT5G22470 | PARP3 is one of three canonical PARPs in Arabidopsis. |
AT2G43020 | Encodes a polyamine oxidase. |
AT1G31820 | Encodes POLYAMINE UPTAKE TRANSPORTER 1, an amino acid permease family protein. |
AT3G26610 | Encodes an apoplast-localized polygalacturonase involved in cell elongation and flower development. |
AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
AT1G56710 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G72590 | Encodes a polyphenol reductase. |
AT2G16530 | Encodes polyprenol reductase involved in N-gylcosylation. Mutants are defective in pollen development. Knockouts are embryo lethal |
AT3G20160 | Terpenoid synthases superfamily protein;(source:Araport11) |
AT3G01150 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
AT4G05320 | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. The mRNA is cell-to-cell mobile. |
AT3G47640 | Encodes POPEYE (PYE), a bHLH transcription factor regulating response to iron deficiency in Arabidopsis roots. |
AT2G31370 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT2G30070 | Encodes a high affinity potassium transporter. |
AT5G58600 | Belongs to a large family of plant-specific genes of unknown function. Involved in resistance to the powdery mildew species Erysiphe cichoracearum and Erysiphe orontii, but not to the unrelated pathogens Pseudomonas syringae or Peronospora parasitica. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G49800 | Homolog of PIP1. |
AT5G23290 | prefoldin 5;(source:Araport11) |
AT5G05987 | prenylated RAB acceptor 1.A2;(source:Araport11) |
AT3G11397 | prenylated RAB acceptor 1.A3;(source:Araport11) |
AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
AT4G38570 | Putative CDP-diacylglycerol-inositol 3-phosphatidyltransferase 2;(source:Araport11) |
AT1G56650 | Encodes a putative MYB domain containing transcription factor involved in anthocyanin metabolism and radical scavenging. Essential for the sucrose-mediated expression of the dihydroflavonol reductase gene. Auxin and ethylene responsiveness of PAP1 transcription is lost in myb12 mutants. Interacts with JAZ proteins to regulate anthocyanin accumulation. |
AT4G29350 | Encodes profilin2, a low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Expressed in vegetative organs. The first intron of PRF2 enhances gene expression. The mRNA is cell-to-cell mobile. |
AT4G32710 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT5G35590 | Encodes 20S proteasome subunit PAA1 (PAA1). |
AT4G17420 | PAWH1 along with PAWH2 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway. |
AT1G55480 | Encodes a member of a novel plant protein family containing a PDZ, a K-box, and a TPR motif. mRNA but not protein levels decrease after wounding. ZKT is phosphorylated at Thr and Ser residues after wounding. The mRNA is cell-to-cell mobile. |
AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
AT2G44830 | AGCVIII kinase involved in the pulse-induced first positive phototropism. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with BRX, thereby timing PPSE differentiation. Activates PIN-mediated auxin efflux. |
AT5G53920 | Protein methyltransferase. One target is PRPL11 which it methylates on Lys 109. |
AT3G11410 | Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA. |
AT3G51390 | DHHC-type zinc finger family protein;(source:Araport11) |
AT3G48330 | Encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination. |
AT4G21900 | Encodes a proteinaceous RNase P that supports RNase P activity in vivo in both organelles and the nucleus. It is also involved in the maturation of small nucleolar RNA (snoRNA) and mRNA. |
AT5G54190 | light-dependent NADPH:protochlorophyllide oxidoreductase A |
AT1G03630 | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
AT5G60110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G60180 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT3G16810 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT1G19770 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
AT3G17790 | Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
AT3G52810 | purple acid phosphatase 21;(source:Araport11) |
AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
AT5G63140 | purple acid phosphatase 29;(source:Araport11) |
AT1G52940 | Encodes a purple acid phosphatase that is induced under prolonged phosphate (Pi) starvation and is required for maintaining basal resistance against Pseudomonas syringae and Botrytis cinerea. |
AT2G01880 | PEP complex component. |
AT2G01890 | Encodes a purple acid phosphatase (PAP) belonging to the low molecular weight plant PAP group. |
AT2G47750 | Encodes GH3.9, a member of the GH3 family auxin-responsive genes. gh3.9-1 mutants had greater primary root length, increased sensitivity to indole-3-acetic acid (IAA)-mediated root growth inhibition, but no obvious effects on apical dominance or leaf morphology. |
AT1G77720 | Encodes a predicted protein kinase based on sequence similarity. |
AT3G27860 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
AT5G01890 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT5G45860 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
AT4G01026 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of ABI1 and ABI2. |
AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
AT2G18230 | Encodes a protein that might have inorganic pyrophosphatase activity. |
AT5G09650 | Encodes a protein with inorganic pyrophosphatase activity. |
AT3G06483 | Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily. |
AT4G15530 | Encodes a dual-targeted protein believed to act as a pyruvate, orthophosphate dikinase. These enzymes are normally associated with C4 photosynthesis which does not occur in Arabidopsis. However, PPDK may play a role in remobilizing nitrogen during leaf senescence in Arabidopsis. The product of the long transcript (.1 gene model) was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol. The two proteins were also found to be expressed in slightly different tissues. |
AT2G01350 | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
AT5G50210 | Encodes an Fe-S binding protein with quinolinate synthase (QS) activity and cysteine desulfurase activator activity. The QS activity was demonstrated by functional complementation of corresponding E. coli mutants and complementation of embryo-lethal phenotypes of the QS homozygous null allele in Arabidopsis. The SufE domain of the protein also stimulates the cysteine desulfurase activity of CpNifS (AT1G08490) in vitro. This protein binds a (4Fe-Su)2+ cluster in its NadA domain and is localized in the chloroplast. |
AT2G20815 | QWRF motif protein (DUF566);(source:Araport11) |
AT2G24070 | QWRF motif protein (DUF566);(source:Araport11) |
AT3G12070 | RAB geranylgeranyl transferase beta subunit 2;(source:Araport11) |
AT4G18800 | Encodes RabA1d, a member of the RabA subfamily of small Rab GTPases. |
AT5G03530 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. CFP:RabC2a appears to co-localize with peroxisomes. |
AT3G18820 | RAB7 homolog, forms retromer complex with VPS35; ES17 prevents the retromer complex to endosome anchoring, resulting in retention of RABG3f. The interaction of RABG3f?VPS35 functinons as a checkpoint in the control of traffic toward the vacuole. |
AT5G06070 | Isolated as a mutation defective in petal development with specific effects on adaxial petals which are filamentous or absent. Encodes a Superman (SUP) like protein with zinc finger motifs. Transcript is detected in petal primordia and protein is localized to the nucleus. |
AT4G36570 | RAD-like 3;(source:Araport11) |
AT5G50340 | DNA repair protein RadA-like protein;(source:Araport11) |
AT1G71100 | Encodes a ribose 5-phosphate isomerase involved in the formation of uridine used for the synthesis of UDP-sugars. Mutants of this gene are affected in cellulose biosynthesis. |
AT1G16190 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
AT2G33775 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile. |
AT3G05880 | Induced by low temperatures, dehydration and salt stress and ABA. Encodes a small (54 amino acids), highly hydrophobic protein that bears two potential transmembrane domains. |
AT5G55080 | A member of RAN GTPase gene family. |
AT4G34220 | Encodes a receptor like kinase involved in ABA-mediated seedling development and drought tolerance.RDK1 is an atypical or pseudokinase and has no phosphorylation activity. Its expression is upregulated in response to ABA.interacts with ABI1 and other PP2C phosphatases. |
AT1G65790 | An alternatively spliced gene that encodes a functional transmembrane receptor serine/threonine kinase, alternate form may not have transmembrane domain. |
AT1G65800 | Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile. |
AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
AT1G71390 | receptor like protein 11;(source:Araport11) |
AT2G25440 | receptor like protein 20;(source:Araport11) |
AT2G25470 | receptor like protein 21;(source:Araport11) |
AT2G32660 | receptor like protein 22;(source:Araport11) |
AT3G23010 | receptor like protein 36;(source:Araport11) |
AT4G13900 | pseudogene of receptor like protein 47;(source:Araport11) |
AT4G13920 | receptor like protein 50;(source:Araport11) |
AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
AT4G00340 | Encodes a receptor-like protein kinase that is expressed in roots. |
AT3G46530 | Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile. |
AT4G16950 | Contains a putative nucleotide binding site and leucine-rich repeats. Similar to the plant resistance genes N and L6, and to the toll and interleukin-1 receptors. Confers resistance to Peronospora parasitica.Redundant function together with SIKIC1 and 3 in SNC1-mediated autoimmunity. Protein levels controlled by MUSE1 and MUSE2. |
AT1G67500 | Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
AT3G15820 | Functions as phosphatidylcholine:diacylglycerol cholinephosphotransferase, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway |
AT1G19360 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
AT5G46340 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
AT2G34410 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
AT5G40450 | Encodes a member of a plant gene family, APK_ORTHOMCL5144,of unknown function. RBB1 is localized to the cytosol and involved in vacuolar biogenesis and organization. RBB1 mutants have increased number of vacuolar bulbs and fewer trans-vacuolar strands. |
AT1G20920 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G01360 | Encodes RCAR1 (regulatory components of ABA receptor). Interacts with and regulates the type 2C protein phosphatases (PP2Cs) ABI1 and ABI2. Functions as abscisic acid sensor. The mRNA is cell-to-cell mobile. |
AT1G54130 | This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
AT4G36900 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1. |
AT3G14230 | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
AT1G78080 | Encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family (RAP2.4). The protein contains one AP2 domain. Role in mediating light and ethylene signaling. The mRNA is cell-to-cell mobile. |
AT1G22190 | The gene encodes a putative transcription factor belongings to the abiotic stress-associated DREB A-6 clade. The mRNA is cell-to-cell mobile. |
AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT3G57540 | Remorin family protein;(source:Araport11) |
AT5G22010 | Encodes RFC1, the largest subunit of replication factor C. Mediates genomic stability and transcriptional gene silencing. |
AT5G02030 | Mutant has additional lateral organs and phyllotaxy defect. Encodes a homeodomain transcription factor. Has sequence similarity to the Arabidopsis ovule development regulator Bell1. Binds directly to the AGAMOUS cis-regulatory element. Its localization to the nucleus is dependent on the coexpression of either STM or BP. |
AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
AT5G23730 | Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling. |
AT2G16210 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
AT2G47160 | Encodes a key transporter under boron (B) limitation in the soil. Protein accumulates in shoots and roots under conditions of boron deficiency and is degraded within several hours of restoring boron supply. Localized to the plasma membrane under B limitation, and to the cytoplasm after B application before degradation. Protein is transferred via the endosomes to the vacuole for degradation. Localized to the inner plasma membrane domain in the columella, lateral root cap, epidermis, and endodermis in the root tip region, and in the epidermis and endodermis in the elongation zone. Under high-boron is transported to the vacuole for degradation. Thought to be a B transceptor, directly senses the B concentration and promotes its own polyubiquitination and vacuolar sorting for quick and precise maintenance of B homeostasis. |
AT1G74810 | HCO3- transporter family;(source:Araport11) |
AT3G57710 | Protein kinase superfamily protein;(source:Araport11) |
AT1G64070 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. |
AT5G22330 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G22790 | Encodes a plasma membrane localized MATE type transporter that is involved in CO2 signaling during stomatal aperture regulation. RHC1 regulates HT1 which phosphorylates OST1, a kinase that regulates the SLAC1 anion channel and thus stomatal closing. |
AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
AT3G45810 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
AT2G27070 | member of Response Regulator: B- Type |
AT3G04280 | Encodes an atypical subtype of the ARR (Arabidopsis response regulator) protein family. ARR22 is more similar to the receiver domains of hybrid kinases than other response regulators. It acts as a phosphohistidine phosphatase when tested with phospho-AHP5 in vitro suggesting that it might be involved in a two-component phosphorelay. Expression of ARR22 transcripts appears to be localized to the chalaza and to be induced by wounding. Ectopic expression of ARR in other parts of the plant leads to reduced cytokinin-related responses and impaired root, shoot, and flower development. Overexpression of wild-type ARR22 in an arr22 mutant background causes variable defects in plant growth and fertility. But, in the same ar22 background, over-expression of versions of ARR22 that should act as dominant-negative or constitutively active proteins, based on mutations to the conserved Asp residue, do not show any phenotypic abnormalities, raising the possibility that these may not act as canonical response regulators. |
AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
AT5G24660 | response to low sulfur 2;(source:Araport11) |
AT4G39090 | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R?mediated resistance response. |
AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
AT2G21620 | Encodes gene that is induced in response to desiccation; mRNA expression is seen 10 and 24 hrs after start of desiccation treatment. |
AT4G27410 | Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
AT3G08640 | alphavirus core family protein (DUF3411);(source:Araport11) |
AT3G56140 | DUF399 family protein, putative (DUF399 and DUF3411);(source:Araport11) |
AT4G01230 | Reticulon family protein. Mutants are resistant to agrobacterium infection. |
AT3G61560 | Reticulon family protein;(source:Araport11) |
AT5G52660 | Encodes RVE6, a homolog of the circadian rhythm regulator RVE8. rve4 rve6 rve8 triple mutants display an extremely long circadian period, with delayed and reduced expression of evening-phased clock genes. |
AT3G08900 | RGP3 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It is a reversibly autoglycosylated protein. Fluorescently-tagged RGP3 is found in the cytosol and associated with Golgi-like particles when expressed in tobacco leaves. An RGP3-YFP fusion protein under the control a native promoter can be found in the endosperm of Arabidopsis embryos during the linear and bent cotyledon stages of development. |
AT5G50750 | RGP4 is a reversibly glycosylated polypeptide. Analyses using tagged RGP4 suggest that it is present in the cytosol and in association with the Golgi apparatus. Recombinant RGP4 does not have UDP-arabinose mutase activity based on an in vitro assay even though the related RGP1, RGP2, and RGP3 proteins do have activity in the same assay. RGP4 can form complexes with RGP1 and RGP2. RGP4 is expressed during seed development. |
AT1G66350 | Negative regulator of GA responses, member of GRAS family of transcription factors. Also belongs to the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. RGL1 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Involved in flower and fruit development. |
AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
AT1G34110 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT2G12646 | Plant AT-rich sequence and zinc-binding transcription factor (PLATZ) family protein which plays central role in mediating RGF1 signalling. Controls root meristem size through ROS signalling. |
AT2G22620 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
AT1G56550 | Encodes a rhamnogalacturonan II specific xylosyltransferase. |
AT3G51300 | Encodes a pollen-specific Rop GTPase, member of the Rho family of small GTP binding proteins that interacts with RIC3 and RIC4 to control tip growth in pollen tubes. These three proteins promote the proper targeting of exocytic vesicles in the pollen tube tip. ROP1 activity is regulated by the REN1 GTPase activator protein. |
AT3G53780 | RHOMBOID-like protein 4;(source:Araport11) |
AT2G02990 | Encodes a member of the ribonuclease T2 family that responds to inorganic phosphate starvation, and inhibits production of anthocyanin. Also involved in wound-induced signaling independent of jasmonic acid. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. |
AT2G21790 | encodes large subunit of ribonucleotide reductase involved in the production of deoxyribonucleoside triphosphates (dNTPs) for DNA replication and repair |
AT3G23580 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes (RNR2A). Functionally redundant with the ribonucleotide reductase TSO2. mRNA was shown to specifically accumulate during the S-phase of the cell cycle in synchronized tobacco BY2 cells. Critical for cell cycle progression, DNA damage repair and plant development. |
AT3G05590 | Encodes cytoplasmic ribosomal protein L18. |
AT2G44860 | cytosolic ribosomal protein gene, part of eL24 family |
AT2G37600 | cytosolic ribosomal protein gene, part of eL36 familyl |
AT5G40040 | cytosolic ribosomal protein gene, part of bL12 family |
AT5G41520 | The gene belongs to the three-member Arabidopsis gene family encoding the eukaryote-specific protein S10e of the small cytoplasmic ribosomal subunit. |
AT3G46040 | Regulated by TCP20. The mRNA is cell-to-cell mobile. |
AT4G31700 | Encodes a putative ribosomal protein S6 (rps6a). RPS6A and RPS6B are fully redundant and essential during gametogenesis. |
AT3G16780 | Ribosomal protein L19e family protein;(source:Araport11) |
AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
AT3G01650 | Encodes RGLG1 (RING domain ligase 1), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. ABA inhibits myristoylation and induces shuttling of the RGLG1 to promote nuclear degradation of PP2CA. |
AT5G14420 | Encodes RGLG2 (RING domain ligase 2), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. |
AT3G43750 | E3 ubiquitin ligases, member of the RING between RING fingers (RBR)-type RSL1/RFA family, are key regulators of ABA receptor stability in root and leaf tissues, targeting ABA receptors for degradation in different subcellular locations. |
AT3G45570 | RING/U-box protein with C6HC-type zinc finger domain-containing protein;(source:Araport11) |
AT5G22920 | Encodes a protein with sequence similarity to RING, zinc finger proteins. Loss of function mutations show reduced (15%) stomatal aperture under non stress conditions. |
AT4G11360 | Encodes a putative RING-H2 finger protein RHA1b. The mRNA is cell-to-cell mobile. |
AT1G15100 | Encodes a putative RING-H2 finger protein RHA2a. |
AT4G35480 | Encodes a putative RING-H2 finger protein RHA3b. |
AT4G00335 | RING-H2 finger B1A;(source:Araport11) |
AT1G29730 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
AT5G05450 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G42520 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G45810 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT5G57980 | NRPB5-like protein of unknown function; homologous to budding yeast RPB5 |
AT4G13850 | Encodes a glycine-rich RNA-binding protein. Gene expression is induced by cold. |
AT1G58470 | Encodes an mRNA-binding protein that contains two RNA recognition motifs (RRMs) and is expressed in proliferating tissues. Preferentially binds UUAGG, GUAGG and/or UUAGU. Loss of function of RBP1 causes decreased root length. |
AT4G00660 | RNAhelicase-like 8;(source:Araport11) |
AT1G66470 | ROOT HAIR DEFECTIVE6;(source:Araport11) |
AT2G04025 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT2G30520 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
AT5G19560 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT3G16130 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT2G45890 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits |
AT5G02010 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Required for periodic formation of secondary cell wall pits. |
AT4G13240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT5G10520 | ROP binding protein kinases 1;(source:Araport11) |
AT2G46710 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
AT3G53232 | ROTUNDIFOLIA like 1;(source:Araport11) |
AT3G14362 | ROTUNDIFOLIA like 10;(source:Araport11) |
AT1G64585 | ROTUNDIFOLIA like 22;(source:Araport11) |
AT1G07490 | ROTUNDIFOLIA like 3;(source:Araport11) |
AT5G59510 | ROTUNDIFOLIA like 5;(source:Araport11) |
AT1G12210 | RFL1 has high sequence similarity to the adjacent disease resistance (R) gene RPS5. |
AT2G32415 | Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain-containing protein;(source:Araport11) |
AT5G38410 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
AT3G25570 | S-adenosylmethionine decarboxylase family member. |
AT4G01850 | S-adenosylmethionine synthetase 2;(source:Araport11) |
AT1G45976 | S-ribonuclease binding protein 1;(source:Araport11) |
AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
AT5G24270 | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium. |
AT1G06040 | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT. |
AT3G07700 | ABC1K7 is a member of an atypical protein kinase family that is induced by salt stress. Loss of function mutations affect the metabolic profile of chloroplast lipids. It appears to function along with ABC1K8 in mediating lipid membrane changes in response to stress. |
AT5G22270 | hypothetical protein;(source:Araport11) |
AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
AT1G27760 | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
AT1G15215 | Encodes SHH1, a homeodomain protein required for DNA methylation. It is an atypical RNA-directed DNA methylation component, and functions in transcriptional silencing through both DNA methylation-dependent and -independent pathways. |
AT1G21450 | Encodes a scarecrow-like protein (SCL1). Member of GRAS gene family. The mRNA is cell-to-cell mobile. |
AT5G11860 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). |
AT4G14785 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT4G32714 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT5G45875 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT3G62440 | Encodes an F-box protein which is predominantly expressed in flower tissues and interacts with ASK19 protein. Mutations in this gene suggest it acts as a negative regulator of endothecial secondary wall thickening in anthers. |
AT3G04240 | Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570). |
AT4G39180 | encodes a protein that complements the function of a sec14(ts) mutant of S. cerevisiae |
AT1G03550 | Secretory carrier membrane protein (SCAMP) family protein;(source:Araport11) |
AT1G29760 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction motif on SEIPIN2 for VAP27-1 is restricted to the N-terminal 30 amino acids that contain an FFAT motif. |
AT3G23800 | selenium-binding protein 3;(source:Araport11) |
AT4G35770 | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
AT5G14930 | encodes an acyl hydrolase involved in senescence . |
AT4G02380 | Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses. |
AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
AT2G03710 | This gene belongs to the family of SEP genes. It is involved in the development of sepals, petals, stamens and carpels. Additionally, it plays a central role in the determination of flower meristem and organ identity. |
AT1G55920 | Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. The mRNA is cell-to-cell mobile. |
AT1G33540 | serine carboxypeptidase-like 18;(source:Araport11) |
AT5G23210 | serine carboxypeptidase-like 34;(source:Araport11) |
AT5G08260 | serine carboxypeptidase-like 35;(source:Araport11) |
AT1G43780 | serine carboxypeptidase-like 44;(source:Araport11) |
AT3G10450 | serine carboxypeptidase-like 7;(source:Araport11) |
AT5G01820 | Encodes a CBL-interacting serine/threonine protein kinase. |
AT5G08160 | Encodes a serine/threonine protein kinase. |
AT1G43850 | Encodes a transcriptional co-regulator of AGAMOUS, that functions with LEUNIG to repress AG in the outer floral whorls. |
AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
AT1G57870 | shaggy-like kinase 42;(source:Araport11) |
AT3G58780 | One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells. |
AT4G24190 | encodes an ortholog of GRP94, an ER-resident HSP90-like protein and is involved in regulation of meristem size and organization. Single and double mutant analyses suggest that SHD may be required for the correct folding and/or complex formation of CLV proteins. Lines carrying recessive mutations in this locus exhibits expanded shoot meristems, disorganized root meristems, and defective pollen tube elongation. Transcript is detected in all tissues examined and is not induced by heat. Endoplasmin supports the protein secretory pathway and has a role in proliferating tissues. |
AT1G75520 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.SRS5 is a positive regulator of photomorphogenesis. |
AT1G19790 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
AT1G15360 | Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. This gene is involved in wax biosynthesis. Over-expression of the gene results in glossy leaf phenotype and increased drought tolerance. Two closely related genes, AT5G25390 and AT5G11190 have similar phenotypes when over-expressed. Strong expression levels in flowers. Binds to the promoter of LACS2. |
AT1G31480 | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole. |
AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
AT3G26612 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT2G47130 | Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria. |
AT2G18330 | AAA-type ATPase family protein;(source:Araport11) |
AT5G24740 | Encodes a vacuolar sorting protein that interacts with the plant-specific GRAS family transcription factor SHORT-ROOT and acts in a pathway that controls root growth and radial patterning. It provides a connections between gibberellic acid, SHR and PLT signaling in the root. |
AT5G02220 | cyclin-dependent kinase inhibitor;(source:Araport11) |
AT3G01670 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
AT5G24120 | Encodes a specialized sigma factor that functions in regulation of plastid genes and is responsible for the light-dependent transcription at the psbD LRP. Activation of SIG5 is dependent upon blue light and mediated by cryptochromes. |
AT1G73990 | Encodes a putative protease SppA (SppA). |
AT1G63690 | SIGNAL PEPTIDE PEPTIDASE-LIKE 2;(source:Araport11) |
AT1G01650 | SIGNAL PEPTIDE PEPTIDASE-LIKE 4;(source:Araport11) |
AT3G47720 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
AT1G10450 | Encodes SIN3-like 6, a homolog of the transcriptional repressor SIN3 (AT1G24190). |
AT2G22990 | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
AT2G03160 | SKP1-like 19;(source:Araport11) |
AT4G28090 | SKU5 similar 10;(source:Araport11) |
AT5G51480 | GPI anchored protein, highly expressed in reproductive tissues. |
AT1G76160 | SKU5 similar 5;(source:Araport11) |
AT1G41830 | SKU5-similar 6;(source:Araport11) |
AT1G62280 | Encodes a protein with ten predicted transmembrane helices. The SLAH1 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. Although it is not expressed in guard cells, it can complement a slac1-2 mutant suggesting that it performs a similar function. SLAH1:GFP localizes to the plasma membrane. |
AT5G18010 | Encodes SAUR19 (small auxin up RNA 19). Note that TAIR nomenclature is based on Plant Mol Biol. 2002, 49:373-85 (PMID:12036261). In Planta (2011) 233:1223?1235 (PMID:21327815), At5g18010 is SAUR24. |
AT2G45210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G16510 | Encodes a clade III SAUR gene with a distinctive expression pattern in root meristems. It is normally expressed in the quiescent center and cortex/endodermis initials and upon auxin stimulation, the expression is found in the endodermal layer. Overexpression studies suggest roles in cell expansion and auxin transport. |
AT5G66260 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G38860 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G61900 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G31320 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT2G28085 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G20220 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G75580 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G60690 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G29420 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G17345 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G05540 | small RNA degrading nuclease 2;(source:Araport11) |
AT4G29920 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Loss of function mutants show increased sensitivity to salt stress and drought. |
AT2G29970 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. The mRNA is cell-to-cell mobile. |
AT3G01090 | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase |
AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
AT3G06370 | member of Sodium proton exchanger family |
AT3G53530 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
AT3G19490 | member of Na+/H+ antiporter-Putative family |
AT1G15240 | Encodes a member of the Arabidopsis sorting nexin family. |
AT2G15900 | Encodes a member of the Arabidopsis sorting nexin family. |
AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile. |
AT2G19070 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091). BAHD acyltransferase. Uses hydroxycinnamoyl CoAs, including caffeoyl/feruoyl/p-coumaroyl/sinapoyl-CoA as acyl donors to fully substitute the N1, N5, and N10 positions of spermidine. |
AT1G14290 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
AT3G61580 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
AT4G21540 | Encodes a sphingosine kinase, also has enzyme activity towards other plant long-chain sphingoid bases. Involved in guard cell ABA signalling and seed germination. |
AT4G16340 | Encodes SPIKE1 (SPK1), the lone DOCK family guanine nucleotide exchange factor (GEF) in Arabidopsis. SPK1 is a peripheral membrane protein that accumulates at, and promotes the formation of, a specialized domain of the endoplasmic reticulum (ER) termed the ER exit site (ERES). SPK1 promotes polarized growth and cell-cell adhesion in the leaf epidermis. Mutant has seedling lethal; cotyledon, leaf-shape, trichome defects. |
AT4G37760 | squalene epoxidase 3;(source:Araport11) |
AT1G20980 | Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. The mRNA is cell-to-cell mobile. |
AT1G02065 | Encodes an SBP-box gene, a member of the SPL gene family. Mutants are affected in micro- and megasporogenesis, trichome formation on sepals, and stamen filament elongation. |
AT5G03650 | Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves. |
AT1G07420 | Arabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA. The sterol 4alpha-methyl oxidase2 family proteins SMO2-1 and SMO2-2 function partially through effects on auxin accumulation, auxin response and PIN1 expression to regulate embryogenesis in Arabidopsis. |
AT1G76090 | Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway. |
AT1G04110 | Initially identified as a mutation affecting stomatal development and distribution. Encodes a protein similar to serine proteases. |
AT4G22820 | A member of the A20/AN1 zinc finger protein family involved in stress response.Expression is increased in response to water, salt , pathogen and other stressors.SAP9 can pull down both K48-linked and K63- linked tetraubiquitin chains and functions as a E3 ubiquitin ligase suggesting a role in proteasome-dependent protein degradation. |
AT4G12040 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT1G55760 | Expression induced under NaCl, mannitol, ABA and indole-3-acetic acid (IAA) treatment. |
AT1G74020 | Encodes AtSS-2 strictosidine synthase. |
AT1G08470 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
AT3G51420 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
AT1G78980 | STRUBBELIG-receptor family 5;(source:Araport11) |
AT1G68830 | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation. STN7 is involved in state transitions. |
AT3G51060 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. STY1/STY2 double mutants showed defective style, stigma as well as serrated leaves. Binds to the promoter of YUC4 and YUC8 (binding site ACTCTAC) |
AT5G59090 | subtilase 4.12;(source:Araport11) |
AT2G39851 | Proteinase inhibitor, propeptide;(source:Araport11) |
AT2G46390 | predicted to encode subunit 8 of mitochondrial complex II and to participate in the respiratory chain |
AT1G04920 | Encodes a sucrose-phosphate synthase whose activity is stimulated by Glc-6-P and inhibited by Pi. |
AT4G10120 | Encodes a sucrose-phosphate synthase. |
AT5G20830 | Encodes a protein with sucrose synthase activity (SUS1). |
AT4G02280 | Encodes a protein with sucrose synthase activity (SUS3). It appears to be important for sucrose metabolism in developing seeds, especially during the late maturation phase, about 18 days after flowering. |
AT1G73370 | Encodes a protein with sucrose synthase activity (SUS6). |
AT2G02860 | encodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding. |
AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
AT1G22710 | Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage. |
AT1G77210 | AtSTP14 belongs to the family of sugar transport proteins (AtSTPs)in volved in monosaccharide transport. Heterologous expression in yeast revealed that AtSTP14 is the transporter specifc for galactose and does not transport other monosaccharides such as glucose or fructose. |
AT3G19930 | Encodes a sucrose hydrogen symporter that is induced by wounding. The mRNA is cell-to-cell mobile. |
AT5G13550 | Encodes a sulfate transporter. |
AT4G33030 | involved in sulfolipid biosynthesis The mRNA is cell-to-cell mobile. |
AT3G45070 | Encodes a sulfotransferase with sulfating activity toward flavonoids. |
AT5G07000 | Encodes a member of the sulfotransferase family of proteins. Although it has 85% amino acid identity with ST2A (At5g07010), this protein is not able to transfer a sulfate group to 11- or 12-hydroxyjasmonic acid in vitro. It may be able to act on structurally related jasmonates. |
AT5G66170 | Encodes a thiosulfate sulfurtransferase/rhodanese. |
AT2G03760 | Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens. |
AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
AT4G33620 | Encodes a SUMO protease that, along with ASP1,is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
AT4G24940 | Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein. |
AT2G21470 | Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein. |
AT3G23130 | Flower-specific gene controlling the boundary of the stamen and carpel whorls. Similar to zinc finger transcription factors. Involved in shoot regenaration from root explants. |
AT3G43220 | Phosphoinositide phosphatase family protein;(source:Araport11) |
AT1G17340 | Phosphoinositide phosphatase family protein;(source:Araport11) |
AT1G79820 | Major facilitator superfamily protein;(source:Araport11) |
AT2G27600 | Encodes a SKD1 (Suppressor of K+ Transport Growth Defect1) homolog. Localized to the cytoplasm and to multivesicular endosomes. Involved in multivesicular endosome function. The mRNA is cell-to-cell mobile. |
AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile. |
AT1G21580 | Encodes a zinc-finger protein that co-localizes with the exosome-associated RNA helicase HEN2 and functions as a co-factor of nuclear RNA quality control by the nucleoplasmic exosome. |
AT2G43710 | Encodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. ssi2 mutants resulted in hyper-resistance to green peach aphid and antibiosis activity in petiole exudates. Redundant Δ9 stearoyl-ACP desaturase gene which together with AAD1 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with AAD1, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
AT5G25440 | Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain. |
AT5G11410 | Similar to receptor like kinase but does not appear to have kinase activity (psuedokinase). It is involved in HopZ1a effector triggered immunity. Interacts with ZAR1 and ZED1.Localization to membrane is dependent on N-terminal myristoylation domain |
AT4G02020 | Encodes a polycomb group protein. Forms part of a large protein complex that can include VRN2 (VERNALIZATION 2), VIN3 (VERNALIZATION INSENSITIVE 3) and polycomb group proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE) and CURLY LEAF (CLF). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. Performs a partially redundant role to MEA in controlling seed initiation by helping to suppress central cell nucleusendosperm proliferation within the FG. |
AT5G16830 | member of SYP2 Gene Family. Over-expression of the gene in tobacco protoplasts leads to a disruption of vacuolar transport from the prevacuolar compartment (PVC) to the vacuole, but not from the Golgi apparatus to the plasma membrane. |
AT1G61290 | member of SYP12 Gene Family |
AT3G03800 | member of SYP13 Gene Family |
AT1G79590 | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
AT3G61450 | syntaxin of plants 73 (SYP73) |
AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
AT4G20280 | Encodes TAF11, a putative TBP-associated factor (TBP: TATA binding protein). |
AT2G18000 | TBP-associated factor 14;(source:Araport11) |
AT1G27720 | TBP-associated factor 4B;(source:Araport11) |
AT1G35560 | Encodes a member of the TCP-P subfamily that is involved in flowering time control and plant development. Mutants present an early flowering phenotype. |
AT2G45680 | TCP family transcription factor;(source:Araport11) |
AT4G28840 | Encodes TCP INTERACTOR-CONTAINING EAR MOTIF PROTEIN 1 (TIE1), an important repressor of CINCINNATA (CIN)-like TEOSINTE BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factors, which are key for leaf development. |
AT5G16850 | Encodes the catalytic subunit of telomerase reverse transcriptase. Involved in telomere homeostasis. Homozygous double mutants with ATR show gross morphological defects over a period of generations. TERT shows Class II telomerase activity in vitro, indicating that it can initiate de novo telomerase synthesis on non-telomeric DNA, often using a preferred position within the telomerase-bound RNA. Loss of function mutants have reduced telomere length in roots and over a period of generations, decreasing root meristem function. |
AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
AT1G25560 | Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. |
AT1G30210 | TCP family protein involved in heterochronic regulation of leaf differentiation. |
AT1G69690 | AtTCP15 is involved in the regulation of endoreduplication. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
AT5G17690 | Regulates the meristem response to light signals and the maintenance of inflorescence meristem identity. Influences developmental processes controlled by APETALA1. TFL2 silences specific genes within euchromatin but not genes positioned in heterochromatin. TFL2 protein localized preferentially to euchromatic regions and not to heterochromatic chromocenters. Involved in euchromatin organization. Required for epigenetic maintenance of the vernalized state. |
AT4G16740 | Encodes an (E,E)-alpha-farnesene synthase in the Col ecotype of Arabidopsis. This enzyme can also catalyze the formation of (E)-beta-ocimene as well as trace amounts of myrcene and other related compounds in vitro. The cytosolic localization of the protein may make it favor (E,E)-alpha-farnesene biosynthesis because the precursor of this product, FPP, is primarily cytosolic. Transcript levels for this gene increase in response to treatment with the jasmonic acid mimic coronalon or in response to the insect Plutella xylostella. TPS03 transcripts can also be detected in flowers. A similar protein from the C24 ecotype with one amino acid change (S267F) has a different substrate specificity. |
AT2G24210 | terpene synthase 10;(source:Araport11) |
AT5G48110 | The Col variant has no enzyme activity due to various substitution and deletion mutations. |
AT3G29410 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
AT1G31950 | Sesterterpene synthase which produces various sesterpne backbones bia type-A cyclization mechanism. |
AT1G70080 | Terpene synthase. Expressed in roots and has low enzyme activity in vitro. Products include dolabellane type diterpenes. Sesterterpene synthase which produces various sesterpne backbones via type-B cyclization mechanism. |
AT1G68540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G01960 | Member of TETRASPANIN family |
AT4G30430 | Member of TETRASPANIN family |
AT1G78120 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT1G04130 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Interacts with Hsp90/Hsp70 as co-chaperone. |
AT5G21990 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Functions as a chaperone receptor at the chloroplast outer envelope, mediating Hsp70-dependent protein targeting to chloroplasts. It has been localized to the ER membrane, interacts with the Sec translocon, and has a potential function in post-translational protein transport into the ER. The mRNA is cell-to-cell mobile. |
AT1G53300 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
AT3G14950 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
AT1G22070 | Encodes a transcription factor. Like other TGAla-related factors, TGA3 has a highly conserved bZIP region and exhibits similar DNA-binding properties. |
AT5G06839 | bZIP transcription factor family protein;(source:Araport11) |
AT1G77920 | bZIP transcription factor family protein;(source:Araport11) |
AT5G48010 | Encodes an oxidosqualene cyclase involved in the biosynthesis of thalianol, a tricyclic triterpenoid of unknown function. Overexpression of THAS leads to dwarfing in the aerial tissues of Arabidopsis plants, but increases their root length. THAS is part of a small operon-like cluster of genes (with At5g48000 (THAH) and At5g47990 (THAD)) involved in thalianol metabolism. |
AT1G75030 | encodes a PR5-like protein |
AT1G72260 | Encodes a thionin which is a cysteine rich protein having antimicrobial properties. Thi2.1 is expressed in response to a variety of pathogens and induced by ethylene and jasmonic acid. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. |
AT1G59730 | Thioredoxin H-type 7 , oxidoreductase located in cytosol and ER. Interacts with GPT1. |
AT1G50320 | encodes a prokaryotic thioredoxin |
AT2G30440 | Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile. |
AT5G23070 | Encodes a thymidine kinase that salvages DNA precursors. The pyrimidine salvage pathway is crucial for chloroplast development and genome replication, as well as for the maintenance of its integrity. |
AT4G23640 | Functions as a potassium transporter and is required for the establishment of root tip growth. |
AT5G11590 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT4G23440 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT1G66090 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
AT2G38410 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT1G63670 | hypothetical protein (DUF3741);(source:Araport11) |
AT3G61380 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
AT3G53540 | afadin;(source:Araport11) |
AT5G62170 | LOW protein: M-phase inducer phosphatase-like protein;(source:Araport11) |
AT2G36420 | nucleolin-like protein;(source:Araport11) |
AT3G63430 | zinc finger CCCH domain protein;(source:Araport11) |
AT5G47560 | Encodes a tonoplast malate/fumarate transporter. |
AT3G26520 | gamma tonoplast intrinsic protein 2 (TIP2). expressed throughout the plant and transcript level is increased upon NaCl or ABA treatments. NaCl stress-sensitive yeast mutant strains exhibit more resistance to salt when expressing this protein. |
AT2G25810 | tonoplast intrinsic protein 4;(source:Araport11) |
AT3G20780 | Encodes putative eukaryotic homolog of archaebacterial topoisomerase VI subunit B, TOP6B. Is essential for endoreduplication and is involved in cell expansion and cell proliferation. The hlq (harlequin) dwarf mutant has fewer root hair and leaf trichome. It has abnormal epidermal cell and accumulates callose. |
AT5G37770 | Encodes a protein with 40% similarity to calmodulin. Binds Ca(2+) and, as a consequence, undergoes conformational changes. CML24 expression occurs in all major organs, and transcript levels are increased from 2- to 15-fold in plants subjected to touch, darkness, heat, cold, hydrogen peroxide, abscisic acid (ABA), and indole-3-acetic acid. However, CML24 protein accumulation changes were not detectable. The putative CML24 regulatory region confers reporter expression at sites of predicted mechanical stress; in regions undergoing growth; in vascular tissues and various floral organs; and in stomata, trichomes, and hydathodes. CML24-underexpressing transgenics are resistant to ABA inhibition of germination and seedling growth, are defective in long-day induction of flowering, and have enhanced tolerance to CoCl(2), molybdic acid, ZnSO(4), and MgCl(2). Also regulates nitric oxide levels. |
AT5G57560 | Encodes a cell wall-modifying enzyme, rapidly upregulated in response to environmental stimuli. |
AT2G07360 | TPLATE-associated SH3 domain containing protein. |
AT3G25795 | Encodes a trans-acting siRNA that is phosphate starvation-upregulated and activated by PAP1 (MYB75). Has been identified as a translated small open reading frame by ribosome profiling. |
AT1G50055 | Trans-acting siRNA1b primary transcript (TAS1b). Regulated by miR173. |
AT3G60750 | Transketolase;(source:Araport11) |
AT1G20350 | mitochondrial inner membrane translocase |
AT2G01820 | Transmembrane kinase (TMK), member of the plant receptor-like kinase (RLK) family. TMKs are characterized by an extracellular leucine-rich-repeat (LRR) domain, a single transmembrane region and a cytoplasmic kinase domain. TMKs have been shown to act as critical modulators of cell expansion and cell proliferation. |
AT3G24660 | member of Receptor kinase-like protein family |
AT1G55130 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. |
AT3G55120 | Catalyzes the conversion of chalcones into flavanones. Required for the accumulation of purple anthocyanins in leaves and stems. Co-expressed with CHS. |
AT5G23260 | Encodes a MADS box protein. Regulates proanthocyanidin biosynthesis in the inner-most cell layer of the seed coat. Also controls cell shape of the inner-most cell layer of the seed coat. Also shown to be necessary for determining the identity of the endothelial layer within the ovule. Paralogous to GOA. Plays a maternal role in fertilization and seed development. |
AT3G17900 | Plant specific component of TRAPPII vesicle transport complex. |
AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
AT2G18700 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
AT1G22210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G35910 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G10100 | Trehalose-6-phosphate phosphatase which enhances drought tolerance by regulating stomatal apertures. |
AT5G65140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G16980 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
AT1G06910 | Arabidopsis thaliana myb family transcription factor (At1g06910) |
AT1G45201 | Target of AtGRP7 regulation. |
AT5G20680 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT4G23790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues.A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G29050 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G42570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT5G49340 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G73980 | TTM1 is a triphosphate tunnel metalloenzyme that displays pyrophosphatase activity. It contains both a uridine kinase (UK) domain,CYTH domain, a coiled-coil domain and a transmembrane domain at the C-terminal Mutants show a delay in leaf senescence. Can functionally complement TTM1 and vise versa. (PMID:28733390) |
AT3G02320 | Involved in posttranscriptional modification of tRNA. |
AT3G56330 | Involved in posttranscriptional modification of plastid tRNA. |
AT4G27340 | Met-10+ like family protein;(source:Araport11) |
AT1G34060 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT1G52410 | Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers. The mRNA is cell-to-cell mobile. |
AT1G53320 | Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain. |
AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
AT5G36160 | Encodes a cytosolic L-tyrosine aminotransferase. AtTAT2 exhibits much broader amino donor specificity than AtTAT1 and can use not only Tyr but also Phe, Trp, His, Met, Leu, Ala, Ser, Cys, Asp, Asn, Gln, and Arg as amino donors. |
AT5G53970 | Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. AtTAT1 prefers Tyr as an amino donor but can also use Phe, Trp, His, Met, and Leu. The mRNA is cell-to-cell mobile. |
AT4G05050 | polyubiquitin gene, belongs to a subtype group with UBQ10 and UBQ14. Various ecotypes of Arabidopsis have different numbers of ubiquitin repeats within this gene. |
AT4G10590 | encodes a member of the ubiquitin-specific protease family, UBP10 |
AT3G20630 | Encodes a ubiquitin-specific protease. Identical to TTN6. Loss of function mutations are embryo lethals, having development arrested at the preglobular/globular stage. Also involved in root responses to phosphate deficiency. |
AT5G65450 | Encodes a ubiquitin-specific protease. The mRNA is cell-to-cell mobile. |
AT4G17895 | Encodes a ubiquitin-specific protease. |
AT5G22030 | ubiquitin-specific protease 8;(source:Araport11) |
AT3G60280 | Encodes blue copper-binding protein III. |
AT4G00110 | Encodes a putative membrane-anchored UDP-D-glucuronate 4-epimerase. |
AT4G12250 | UDP-D-glucuronate 4-epimerase |
AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
AT4G23010 | UDP-galactose transporter 2;(source:Araport11) |
AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
AT1G01420 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT3G50740 | UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism. |
AT3G53150 | UDP-glucosyl transferase 73D1;(source:Araport11) |
AT2G31750 | Encodes an auxin glycosyltransferase that is likely to be involved in regulation of auxin by glycosylation. |
AT1G05530 | Encodes a protein with glucosyltransferase activity with high sequence homology to UGT1 (AT1G05560). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT2 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. |
AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
AT5G05860 | Encodes a cytokinin N-glucosyltransferase that is involved in cytokinin homeostasis and cytokinin response in planta through cytokinin N-glucosylation. Expression is induced by ABA, mannitol and drought stress. Analysis of overexpressors and loss of function mutants indicate a role in response to osmotic and drought stress. |
AT3G46660 | UDP-glucosyl transferase 76E12;(source:Araport11) |
AT5G59590 | UDP-glucosyl transferase 76E2;(source:Araport11) |
AT1G22340 | UDP-glucosyl transferase 85A7;(source:Araport11) |
AT3G16520 | UDP-glucosyl transferase 88A1;(source:Araport11) |
AT5G59290 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
AT2G15490 | UDP-glycosyltransferase 73B4;(source:Araport11) |
AT5G49690 | UDP-glycosyltransferase that can act upon sulcotrione herbicide. Overexpression confers resistance to herbicide. |
AT1G34020 | Nucleotide-sugar transporter family protein. Can function in yeast as glucose transporter. |
AT4G02500 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile. |
AT4G37180 | UIF1 is a nuclear and cytoplasmically localized myb-domain containing member of the GARP G2-like subfamily of transcription factors. Interacts with ULT1 and binds to the WUS promoter. UIF1 binding domains are also found in CUC and AG promoters suggesting they are also direct targets. This locus was also identified as a putative cytoskeletal protein in a yeast screen. |
AT1G29300 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
AT2G12940 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. |
AT3G58450 | USP domain containing protein, member of the universal stress protein family, regulated by ABA and possibly regulated by the ABA-dependent transcription factor AREB/ABF. Involved in the regulation of seed germination. |
AT2G47270 | Encodes UPBEAT1 (UPB1), a transcription factor with a bHLH domain. Regulates the expression of a set of peroxidases that modulate the balance of reactive oxygen species (ROS) between the zones of cell proliferation and the zone of cell elongation where differentiation begins. Disruption of UPB1 activity alters this ROS balance, leading to a delay in the onset of differentiation. Regulates growth by mediating cell cycle progression. |
AT1G05680 | Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. |
AT3G27190 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
AT3G27440 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
AT1G05620 | Encodes a cytosolic inosine nucleoside hydrolase. It forms a heterocomplex with NSH1 with almost two orders of magnitude higher catalytic efficiency for xanthosine hydrolysis than observed for NSH1 alone. Transcript levels for this gene are elevated in older leaves suggesting that it may play a role in purine catabolism during senescence. |
AT2G37460 | nodulin MtN21-like transporter family protein |
AT2G39510 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
AT1G25270 | nodulin MtN21-like transporter family protein |
AT1G01070 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
AT4G01430 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
AT4G01450 | nodulin MtN21-like transporter family protein |
AT4G28040 | nodulin MtN21-like transporter family protein |
AT4G30420 | nodulin MtN21-like transporter family protein |
AT3G28100 | nodulin MtN21-like transporter family protein The mRNA is cell-to-cell mobile. |
AT3G28070 | nodulin MtN21-like transporter family protein |
AT4G11150 | Encodes a vacuolar H+-ATPase subunit E isoform 1 which is required for Golgi organization and vacuole function in embryogenesis. The mRNA is cell-to-cell mobile. |
AT1G64200 | vacuolar H+-ATPase subunit E isoform 3;(source:Araport11) |
AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
AT2G01770 | Encodes an iron transporter required for iron sequestration into vacuoles. Expressed in developing embryo and seed. Localized in the vacuolar membrane. |
AT1G21140 | The gene encodes nodulin-like1 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
AT1G76800 | The gene encodes nodulin-like2 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
AT3G25190 | The gene encodes nodulin-like21 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
AT1G63010 | Encodes an SPX domain protein that transports Pi into the vacuole and is essential for phosphate homeostasis. |
AT4G21560 | vacuolar protein sorting-associated protein-like protein;(source:Araport11) |
AT4G20110 | VACUOLAR SORTING RECEPTOR 7;(source:Araport11) |
AT3G21710 | transmembrane protein;(source:Araport11) |
AT2G32280 | Encodes a member of a plant-specific gene family that is required for embryo provasculature development. The gene product regulates vascular network complexity and connectivity in cotyledons. |
AT5G24780 | encodes an acid phosphatase similar to soybean vegetative storage proteins. Gene expression is induced by wounding and jasmonic acid. |
AT4G24220 | encodes a progesterone-5beta-reductase-like protein. It has enone reductase activity against a wide range of substrates, including 3-oxo-Δ-4,5-steroids in vitro. The in vivo substrates and product of this enzyme have not yet been elucidated but it is likely to participate in steroid metabolism. The protein contains a mammalian death domain involved in programmed cell death. The gene is expressed in the vascular system and mutants carrying a dominant mutation in the gene have defective vascular patterning. VEP1 gene expression is induced specifically by wounding. |
AT5G18000 | Encodes VERDANDI (VDD), a putative transcription factor belonging to the reproductive meristem (REM) family. VDD is a direct target of the MADS domain ovule identity complex. Mutation in VDD affects embryo sac differentiation. |
AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
AT1G21810 | Encodes a protein that localizes at motile vesicle-like small compartments in differentiating xylem cells that is associated with microtubule plus-ends. VETH-positive compartments are unlikely to be elements in conventional endomembrane trafficking pathways. It can associate with COG2, and together these two proteins co-localize with the EXO70A1 exocyst subunit, tethering EXO70A1 to compartments associated with cortical microtubules. |
AT2G41740 | Encodes a protein with high homology to animal villin. |
AT4G11220 | VIRB2-interacting protein 2;(source:Araport11) |
AT1G43700 | Encodes a VirE2-interacting protein. VIP1 mediates nuclear translocation of VirE2 via its amino half, and interacts with histone H2A via it carboxyl half. Involved in osmosensory response. The mRNA is cell-to-cell mobile. |
AT5G04490 | Encodes a protein with phytol kinase activity involved in tocopherol biosynthesis. |
AT2G44340 | VQ18 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ26, it is involved in negative regulation of ABA responses during early seedling development. |
AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
AT1G79680 | Encodes a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that is critically dependent on the second messenger cGMP. |
AT1G21240 | encodes a wall-associated kinase The mRNA is cell-to-cell mobile. |
AT1G21210 | cell wall-associated ser/thr kinase involved in cell elongation and lateral root development |
AT1G16140 | Encodes a predicted WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16110 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall. |
AT1G72290 | Encodes a Kunitz-protease inhibitor, a water-soluble chlorophyll protein involved in herbivore resistance activation. |
AT3G23090 | Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark, |
AT2G35880 | Microtubule-stabilizing protein. |
AT3G04910 | Serine/threonine protein kinase, whose transcription is regulated by circadian rhythm. |
AT3G22420 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
AT5G11390 | Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells. |
AT3G54320 | WRINKLED1 encodes transcription factor of the AP2/ERWEBP class. Protein has two plant-specific (AP2/EREB) DNA-binding domains and is involved in the control of storage compound biosynthesis in Arabidopsis. Mutants have wrinkled seed phenotype, due to a defect in the incorporation of sucrose and glucose into triacylglycerols. Transgenic sGsL plants (21-day-old) grown on 6% sucrose for 24 hours had 2-fold increase in levels of expressions (sGsL line carries a single copy of T-DNA containing the Spomin::GUS-Spomin::LUC dual reporter genes in the upper arm of chromosome 5 of ecotype Col-0. The sporamin .minimal. promoter directs sugar-inducible expression of the LUC and GUS reporters in leaves). Regulation by LEC2 promotes fatty acid accumulation during seed maturation. Splice form 3 is the major form expressed in seedlings.Mutations in the C terminal intrinsically disordered region increase the stability of WRI1 and lead to increased oil production. |
AT4G39410 | Encodes a member of the Group II-c WRKY Transcription Factor family that is involved in stem development and has been shown to directly bind to the promoter of NST2. WRKY13 binds to the promoter of DCD to upregulate its expression and hydrogen sulfide production to enhance plant cadmium tolerance. Mutants show a weak stem phenotype and show decreased expression of lignin-synthesis-related genes. |
AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
AT5G07100 | Encodes WRKY DNA-binding protein 26 (WRKY26). |
AT5G24110 | member of WRKY Transcription Factor; Group III |
AT4G22070 | member of WRKY Transcription Factor; Group II-b |
AT2G21900 | member of WRKY Transcription Factor; Group II-c |
AT1G18860 | member of WRKY Transcription Factor; Group II-b |
AT1G29280 | member of WRKY Transcription Factor; Group II-e The mRNA is cell-to-cell mobile. |
AT3G58710 | member of WRKY Transcription Factor; Group II-e |
AT5G13080 | WRKY75 is one of several transcription factors induced during Pi deprivation. It is nuclear localized and regulated differentially during Pi starvation. RNAi mediated suppression of WRKY75 made the plants more susceptible to Pi stress as indicated by the higher accumulation of anthocyanin during Pi starvation. |
AT5G12420 | WSD7 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
AT1G20710 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
AT5G59340 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. WOX2 has a putative Zinc finger domain downstream of the homeodomain. Transcripts are expressed in the egg cell, the zygote and the apical cell lineage and are reduced in met3-1 early embryos. This gene is necessary for cell divisions that form the apical embryo domain. |
AT3G04630 | Member of a small gene family which have a KLEEK domain which may be involved in protein- protein interactions. Over expression of WDL1 results in abnormal root development. |
AT4G34890 | Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance. |
AT2G28840 | Putative E3 Ub protein ligase; regulates thermoresponsive hypocotyl growth through mediating degradation of the thermosensor ELF3. |
AT5G64530 | xylem NAC domain 1;(source:Araport11) |
AT5G33290 | Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis. |
AT3G48580 | xyloglucan endotransglucosylase/hydrolase 11;(source:Araport11) |
AT5G57540 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. |
AT4G30270 | encodes a protein similar to endo xyloglucan transferase in sequence. It is also very similar to BRU1 in soybean, which is involved in brassinosteroid response. |
AT4G37800 | xyloglucan endotransglucosylase/hydrolase 7;(source:Araport11) |
AT4G25810 | xyloglucan endotransglycosylase-related protein (XTR6) |
AT5G24380 | closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1 |
AT3G27020 | Arabidopsis thaliana metal-nicotianamine transporter YSL6 |
AT1G65730 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
AT3G51430 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
AT4G06634 | Encodes an ABA responsive C2H2-type zinc finger transcription factor with both transcriptional repression and activation domains, that binds a G-rich, 11-bp DNA-binding motif. YY1 binds to the promoter of ABR1 and disruption represses ABA- and salt-induced ABR1 expression. |
AT4G30260 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
AT2G33230 | Encodes a flavin monooxygenase gene which belongs to the tryptophan-dependent auxin biosynthetic pathway and enhances drought resistance. |
AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
AT1G69600 | Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. |
AT2G32930 | Encodes a zinc finger protein. |
AT5G16540 | Encodes a zinc finger protein. |
AT4G17810 | C2H2 domain regulatory protein. Functions downstream of GL2 during root hair development and regulates expression of targets RDH6, RSL2 and RSL4. |
AT5G57520 | Encodes a zinc finger protein containing only a single zinc finger. |
AT5G25160 | Encodes a zinc finger protein containing only a single zinc finger. |
AT2G41940 | Encodes a zinc finger protein containing only a single zinc finger. |
AT5G13750 | zinc induced facilitator-like 1;(source:Araport11) |
AT3G43790 | zinc induced facilitator-like 2;(source:Araport11) |
AT2G32270 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. also response to iron deficiency. |
AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |