Basic information
Locus name	AT5G47220
Alias	ERF2
Organism	Arabidopsis thaliana
Taxonomic identifier	[NCBI]
Function category	Hormone response pathway
Effect for Senescence	unclear
Gene Description	ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 2 (ERF2); FUNCTIONS IN: transcription factor activity, transcription activator activity, DNA binding; INVOLVED IN: ethylene mediated signaling pathway, positive regulation of transcription, induced systemic resistance, jasmonic acid mediated signaling pathway, response to chitin, regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor and ERF, DNA-binding (InterPro:IPR001471); BEST Arabidopsis thaliana protein match is: ATERF-1 (ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 1); DNA binding / transcription activator/ transcription factor (TAIR:AT4G17500.1); Has 3811 Blast hits to 3685 proteins in 199 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 3801; Viruses - 2; Other Eukaryotes - 6 (source: NCBI BLink).
Evidence	Genomic evidence:microarray data [Ref 1]
References	1: Breeze E, Harrison E, McHattie S, Hughes L, Hickman R, Hill C, Kiddle S, Kim YS, Penfold CA, Jenkins D, Zhang C, Morris K, Jenner C, Jackson S, Thomas B, Tabrett A, Legaie R, Moore JD, Wild DL, Ott S, Rand D, Beynon J, Denby K, Mead A, Buchanan-Wollaston High-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation. Plant Cell 2011 Mar;23(3):873-94
Gene Ontology	biological process regulation of transcription, DNA-dependent molecular function sequence-specific DNA binding transcription factor activity
Sequence	AT5G47220.1 | Genomic | mRNA | CDS | Protein
miRNA Interaction
Details	target: AT5G47220.1  miRNA: ath-miR5658 miRNA: ath-miR5658 mfe: -33.1 kcal/mol  p-value: 0.000065  position: 647  target 5' C                    C  3'             UUCGUCGUCGUCGUCGUCGU                 AAGUAGUAGUAGUAGUAGUA      miRNA  3' A                       5'
Ortholog Group
Ortholog Groups: OG5_150360	Accession Taxon NP_199533 ( AT5G47220 ) Arabidopsis thaliana NP_567530 Arabidopsis thaliana 205919 Chlamydomonas reinhardtii NP_001047614 Oryza sativa Japonica Group NP_001053474 Oryza sativa Japonica Group e_gw1.265.11.1 Physcomitrella patens subsp. patens gw1.2.360.1 Physcomitrella patens subsp. patens gw1.2.361.1 Physcomitrella patens subsp. patens gw1.38.156.1 Physcomitrella patens subsp. patens 28192.m000255 Ricinus communis
Cross Link
Database Entry ID E-value Start End InterPro ID Description PANTHER PTHR31190 1.1E-24 116 191 No hit NA Pfam PF00847 1.1E-16 116 166 IPR001471 AP2/ERF domain ProSiteProfiles PS51032 24.5 116 174 IPR001471 AP2/ERF domain SMART SM00380 5.3E-41 116 180 IPR001471 AP2/ERF domain SUPERFAMILY SSF54171 2.8E-23 116 176 IPR016177 DNA-binding, integrase-type PRINTS PR00367 4.5E-11 117 128 IPR001471 AP2/ERF domain PRINTS PR00367 4.5E-11 140 156 IPR001471 AP2/ERF domain
Subcellular Localization
Localization	nucleus
Evidence	SUBAcon
Pubmed ID	23180787