37 senescence-associated transcription factors (Sen-TFs) ChIP-seq or DAP-seq data
| WRKY70 Targets | Description |
| AT2G28580 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G14280 | LL-diaminopimelate aminotransferase;(source:Araport11) |
| AT5G35240 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, blastp match of 47%25 identity and 9.3e-52 P-value to GP|13122426|dbj|BAB32907.1||AP003047 putative transposable element {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT3G51270 | protein serine/threonine kinase;(source:Araport11) |
| AT5G02890 | Encodes a protein with similarity to transferases in plants and fungi. |
| AT3G55840 | Hs1pro-1 protein;(source:Araport11) |
| AT5G52850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G48640 | transmembrane protein;(source:Araport11) |
| AT4G09090 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
| AT1G09980 | Putative serine esterase family protein;(source:Araport11) |
| AT1G74820 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G03370 | C2 calcium/lipid-binding and GRAM domain containing protein;(source:Araport11) |
| AT1G67060 | peptidase M50B-like protein;(source:Araport11) |
| AT5G63040 | transmembrane protein;(source:Araport11) |
| AT3G32917 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.0e-114 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G46170 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G07580 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT3G17070 | Peroxidase family protein;(source:Araport11) |
| AT1G51270 | vesicle-associated protein 1-4;(source:Araport11) |
| AT2G03110 | putative RNA-binding protein;(source:Araport11) |
| AT3G60940 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT3G47800 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT1G31355 | pseudogene of Translation protein SH3-like family protein;(source:Araport11) |
| AT3G11395 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT5G51400 | PLAC8 family protein;(source:Araport11) |
| AT5G48020 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G33200 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 28%25 identity and 4.2e-16 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10) |
| AT1G11905 | B-cell receptor-associated protein 31-like protein;(source:Araport11) |
| AT2G20320 | DENN (AEX-3) domain-containing protein;(source:Araport11) |
| AT4G03460 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G53910 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G13500 | hypothetical protein;(source:Araport11) |
| AT1G30550 | S-adenosyl-L-methionine-dependent methyltransferase superfamily protein;(source:Araport11) |
| AT3G24518 | Natural antisense transcript overlaps with AT3G24520;(source:Araport11) |
| AT3G02710 | Encodes a protein with a putative role in mRNA splicing. |
| AT3G27845 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G41790 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 0.00017 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G11220 | hypothetical protein;(source:Araport11) |
| AT5G04830 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
| AT2G43480 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G14470 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT1G47480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G42930 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G19530 | Encodes a TIR-NB-LRR resistance protein. Transient expression in tobacco induces cell death. |
| AT3G24580 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G02440 | transmembrane protein;(source:Araport11) |
| AT3G04181 | hypothetical protein;(source:Araport11) |
| AT3G63240 | DNAse I-like superfamily protein;(source:Araport11) |
| AT3G43200 | pseudogene of target of trans acting-siR480/255 protein;(source:Araport11) |
| AT3G46690 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G21840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G46340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G11490 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT2G42020 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT1G10385 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
| AT1G04680 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G55350 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G33020 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G44090 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G80130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G10730 | Protein kinase superfamily protein |
| AT4G35500 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G31540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G04645 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G19050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G09625 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 9.1e-76 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G52130 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G09670 | loricrin-like protein;(source:Araport11) |
| AT1G52270 | hypothetical protein;(source:Araport11) |
| AT1G36441 | Pseudogene of AT1G66235 |
| AT2G33900 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G51620 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G17490 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.3e-199 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G43303 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G28375 | transmembrane protein;(source:Araport11) |
| AT5G42785 | transmembrane protein;(source:Araport11) |
| AT1G28700 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT5G26582 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-42 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G13250 | RING finger protein;(source:Araport11) |
| AT5G53380 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT3G44810 | F-box family protein;(source:Araport11) |
| AT2G29010 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G22845 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT1G70820 | phosphoglucomutase, putative / glucose phosphomutase;(source:Araport11) |
| AT2G21110 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT3G43420 | hypothetical protein;(source:Araport11) |
| AT3G16900 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G05170 | Galactosyltransferase family protein;(source:Araport11) |
| AT1G28980 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G05010 | clathrin adaptor complexes medium subunit family protein;(source:Araport11) |
| AT2G28710 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT1G10310 | encodes a NADPH-dependent pterin aldehyde reductase that accepts pterin aldehyde as well as dihydropterin aldehyde as substrates involved in metabolism and salvage of folate and its derivatives. |
| AT1G77260 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G34044 | pseudogene of 50S ribosomal protein L34;(source:Araport11) |
| AT1G07476 | transmembrane protein;(source:Araport11) |
| AT5G60760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G34570 | Essential protein Yae1, N-terminal;(source:Araport11) |
| AT4G01860 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT5G35860 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G38037.1);(source:TAIR10) |
| AT3G62455 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-232 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G50140 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G14995 | Encodes a ECA1 gametogenesis related family protein |
| AT1G67720 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G20470 | transmembrane protein;(source:Araport11) |
| AT2G28200 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT3G44805 | TRAF-like superfamily protein;(source:Araport11) |
| AT2G43210 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT3G54520 | hypothetical protein;(source:Araport11) |
| AT3G28650 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G29870 | Oligosaccharyltransferase complex/magnesium transporter family protein;(source:Araport11) |
| AT1G35990 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-23 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G16660 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G42280 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.3e-71 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G31999 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.3e-44 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G37037 | transposable_element_gene;(source:Araport11) |
| AT5G29060 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
| AT1G76920 | F-box family protein;(source:Araport11) |
| AT3G19870 | AP-5 complex subunit beta-like protein;(source:Araport11) |
| AT5G35460 | membrane protein;(source:Araport11) |
| AT5G27925 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.0e-249 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G40925 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G07260 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT4G23970 | hypothetical protein;(source:Araport11) |
| AT3G58630 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT1G26540 | Agenet domain-containing protein;(source:Araport11) |
| AT5G02650 | hypothetical protein;(source:Araport11) |
| AT1G24320 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT5G58150 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G33910 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G43390 | plant/protein;(source:Araport11) |
| AT5G37145 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-29 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G37352 | Pseudogene of AT2G25010 |
| AT5G41100 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G06380 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT3G32435 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase GI:4335720 from (Arabidopsis thaliana);(source:TAIR10) |
| AT5G64550 | loricrin-like protein;(source:Araport11) |
| AT4G01210 | glycosyl transferase family 1 protein;(source:Araport11) |
| AT3G57120 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G08680 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
| AT1G05380 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger protein;(source:Araport11) |
| AT3G01980 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G03920 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.1e-40 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G04972 | hypothetical protein;(source:Araport11) |
| AT2G42110 | hypothetical protein;(source:Araport11) |
| AT1G60630 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G55100 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT5G37210 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G59160 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G07210 | hypothetical protein;(source:Araport11) |
| AT3G33131 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32610.1);(source:TAIR10) |
| AT3G58590 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G24600 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G24240 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
| AT1G22060 | sporulation-specific protein;(source:Araport11) |
| AT3G26480 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT1G23830 | transmembrane protein;(source:Araport11) |
| AT4G39060 | LOW protein: coatomer subunit alpha-1-like protein;(source:Araport11) |
| AT1G35745 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.5e-62 P-value blast match to GB:CAA38906 Tam3-transposase (hAT-element) (Antirrhinum majus);(source:TAIR10) |
| AT4G27740 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT5G33382 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-126 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT5G02710 | zinc/iron-chelating domain protein;(source:Araport11) |
| AT5G64395 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G01670 | hypothetical protein;(source:Araport11) |
| AT1G21300 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-15 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G60380 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT4G09360 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT4G18630 | hypothetical protein (DUF688);(source:Araport11) |
| AT4G01270 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G07150 | amino acid-ligase;(source:Araport11) |
| AT3G26872 | Pseudogene of AT3G26880; self-incompatibility protein-related |
| AT4G23470 | PLAC8 family protein;(source:Araport11) |
| AT1G57670 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT3G33154 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.5e-36 P-value blast match to GB:CAB39733 rotease, reverse transcriptase, ribonuclease H, integrase (Gypsy_Ty3-element) (Drosophila buzzatii);(source:TAIR10) |
| AT5G08300 | Succinyl-CoA ligase, alpha subunit;(source:Araport11) |
| AT1G64050 | hypothetical protein;(source:Araport11) |
| AT2G39960 | Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11) |
| AT5G40690 | histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11) |
| AT3G47670 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G78530 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G18170 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT4G32470 | Cytochrome bd ubiquinol oxidase, 14kDa subunit;(source:Araport11) |
| AT2G38630 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G31460 | Ribosomal L28 family;(source:Araport11) |
| AT4G01460 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G36930 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G62350 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G04590 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-28 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G14820 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G56270 | RPB1a;(source:Araport11) |
| AT1G16170 | ephrin-A3 protein;(source:Araport11) |
| AT2G45920 | U-box domain-containing protein;(source:Araport11) |
| AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G18450 | PLAC8 family protein;(source:Araport11) |
| AT5G58720 | smr (Small MutS Related) domain-containing protein;(source:Araport11) |
| AT3G30300 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G26010 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G16195 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G46550 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT4G13820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G74610 | pre-tRNA tRNA-Leu (anticodon: CAG);(source:Araport11, TAIR10) |
| AT4G16162 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G13800 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT3G28350 | Pseudogene of AT3G28350; unknown protein |
| AT1G56020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT5G51630 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G43580 | Sphingomyelin synthetase family protein;(source:Araport11) |
| AT4G30910 | Cytosol aminopeptidase family protein;(source:Araport11) |
| AT3G56880 | VQ motif-containing protein;(source:Araport11) |
| AT1G72720 | hypothetical protein (DUF3511);(source:Araport11) |
| AT5G45700 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G54620 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G01513 | hypothetical protein;(source:Araport11) |
| AT1G57650 | ATP binding protein;(source:Araport11) |
| AT3G55690 | hypothetical protein;(source:Araport11) |
| AT5G41290 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT5G54720 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G16400 | transmembrane protein;(source:Araport11) |
| AT5G35339 | pseudogene of Polynucleotidyl transferase;(source:Araport11) |
| AT3G14740 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G51645 | Natural antisense transcript overlaps with AT1G51640;(source:Araport11) |
| AT3G59455 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT3G29520 | pseudogene of hypothetical protein;(source:Araport11) |
| AT1G19410 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT5G60615 | Encodes a defensin-like (DEFL) family protein. |
| AT1G09360 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G45660 | adenine phosphoribosyltransferase;(source:Araport11) |
| AT2G39490 | F-box family protein;(source:Araport11) |
| AT4G20000 | VQ motif-containing protein;(source:Araport11) |
| AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT5G37610 | Eukaryotic porin family protein;(source:Araport11) |
| AT1G35181 | transmembrane protein;(source:Araport11) |
| AT3G47590 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G25615 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.0e-122 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT5G43520 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G05085 | hypothetical protein;(source:Araport11) |
| AT2G34315 | avirulence induced family protein;(source:Araport11) |
| AT5G38340 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G38035 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.9e-71 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G69030 | BSD domain-containing protein;(source:Araport11) |
| AT2G35742 | snoRNA;(source:Araport11) |
| AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G37405 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.0e-229 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G02575 | transmembrane protein;(source:Araport11) |
| AT1G03590 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT2G36480 | pre-mRNA cleavage complex 2 Pcf11-like protein;(source:Araport11) |
| AT1G20270 | 2-oxoglutarate-dependent dioxygenase |
| AT2G41830 | Uncharacterized protein;(source:Araport11) |
| AT3G11310 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT1G09370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G12910 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT3G59110 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G58200 | TRAF-like family protein;(source:Araport11) |
| AT2G04852 | Potential natural antisense gene, locus overlaps with AT2G04850 |
| AT3G44096 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.8e-23 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G39280 | phenylalanyl-tRNA synthetase, putative / phenylalanine-tRNA ligase;(source:Araport11) |
| AT4G36150 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G27180 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT5G03750 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT1G09260 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G78070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G52200 | PLAC8 family protein;(source:Araport11) |
| AT1G75900 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G57035 | U-box domain-containing protein kinase family protein;(source:Araport11) |
| AT5G31909 | pseudogene of DNA-directed RNA polymerase family protein;(source:Araport11) |
| AT1G22160 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT2G13500 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
| AT1G31983 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G57100 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT3G42090 | transposable_element_gene;(source:Araport11);contains domain LIN-9 RELATED (PTHR21689);(source:TAIR10) |
| AT5G32800 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-66 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G13500 | transmembrane protein;(source:Araport11) |
| AT3G62735 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
| AT3G50280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G33100 | protein phosphatase;(source:Araport11) |
| AT4G06474 | transposable_element_gene;(source:Araport11);retroelement pol polyprotein;(source:TAIR10) |
| AT3G14830 | epstein-barr nuclear antigen;(source:Araport11) |
| AT4G17690 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G28915 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT3G46850 | Subtilase family protein;(source:Araport11) |
| AT3G15518 | hypothetical protein;(source:Araport11) |
| AT5G28495 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.8e-77 P-value blast match to gb|AAL06416.1|AF378057_1 reverse transcriptase (Sorghum bicolor) (Gypsy_Ty3-family);(source:TAIR10) |
| AT1G32120 | serine/threonine-protein phosphatase 7 long form-like protein;(source:Araport11) |
| AT5G13890 | plant viral-response family protein (DUF716);(source:Araport11) |
| AT2G14635 | ARABIDILLO protein;(source:Araport11) |
| AT1G66780 | MATE efflux family protein;(source:Araport11) |
| AT4G08360 | KOW domain-containing protein;(source:Araport11) |
| AT4G20770 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G55180 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G76610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G49032 | hypothetical protein;(source:Araport11) |
| AT5G29635 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 7.7e-111 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT1G13050 | proline-rich receptor-like kinase;(source:Araport11) |
| AT4G26120 | Ankyrin repeat family protein / BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G47150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G42792 | transposable_element_gene;(source:Araport11);Mutator-related transposase, temporary automated functional assignment;(source:TAIR10) |
| AT2G16592 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT3G20975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-08 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G52170 | DNA binding protein;(source:Araport11) |
| AT3G05810 | IGR motif protein;(source:Araport11) |
| AT1G60320 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G60095 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G63740 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G60110 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT2G23230 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT3G11590 | golgin family A protein;(source:Araport11) |
| AT3G33215 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to unknown protein GB:AAD20653 (Arabidopsis thaliana) and similar to putative reverse transcriptase GB:AAD15474 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G36430 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G13440 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G24600 | TRP-like ion channel protein (Protein of unknown function, DUF599);(source:Araport11) |
| AT3G05165 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G44500 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G01740 | Mitochondrial ribosomal protein L37;(source:Araport11) |
| AT3G19250 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT2G37500 | arginine biosynthesis protein ArgJ family;(source:Araport11) |
| AT4G39840 | cell wall integrity/stress response component-like protein;(source:Araport11) |
| AT1G64385 | transmembrane protein;(source:Araport11) |
| AT4G31210 | DNA topoisomerase, type IA, core;(source:Araport11) |
| AT4G25070 | caldesmon-like protein;(source:Araport11) |
| AT3G62850 | zinc finger protein-like protein;(source:Araport11) |
| AT2G42100 | Actin-like ATPase superfamily protein;(source:Araport11) |
| AT2G20835 | hypothetical protein;(source:Araport11) |
| AT3G48080 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G56070 | hypothetical protein;(source:Araport11) |
| AT5G07675 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT2G36402 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G36905.1);(source:TAIR10) |
| AT2G34330 | LOW protein: protein BOBBER-like protein;(source:Araport11) |
| AT2G30850 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT3G42656 | transposable_element_gene;(source:Araport11);pseudogene, similar to OJ1029_F04.11, similar to Ac-like transposase;(source:TAIR10) |
| AT5G57010 | calmodulin-binding family protein;(source:Araport11) |
| AT1G55400 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G27590.1);(source:TAIR10) |
| AT2G36040 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30610.1);(source:TAIR10) |
| AT1G35300 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.1e-38 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G47250 | RNA helicase family protein;(source:Araport11) |
| AT5G51930 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT3G42830 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G44093 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-162 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT2G30600 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G37140 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT4G30150 | Urb2/Npa2 family protein;(source:Araport11) |
| AT3G52240 | transcriptional regulator ATRX;(source:Araport11) |
| AT1G63730 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G26130 | cotton fiber protein;(source:Araport11) |
| AT5G42320 | Zn-dependent exopeptidases superfamily protein;(source:Araport11) |
| AT1G34050 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G44125 | Natural antisense transcript overlaps with AT1G44120;(source:Araport11) |
| AT5G57370 | U4/U6.U5 small nuclear ribonucleoprotein;(source:Araport11) |
| AT1G45229 | transmembrane protein;(source:Araport11) |
| AT5G54148 | sarcosine dehydrogenase-2C protein;(source:Araport11) |
| AT2G40630 | Uncharacterized conserved protein (UCP030365);(source:Araport11) |
| AT2G18115 | pseudogene of glycine-rich protein;(source:Araport11) |
| AT5G53486 | transmembrane protein;(source:Araport11) |
| AT3G19550 | glutamate racemase;(source:Araport11) |
| AT3G10590 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT1G22440 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G24610 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G64830 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G71691 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G06630 | protein kinase family protein;(source:Araport11) |
| AT3G26590 | MATE efflux family protein;(source:Araport11) |
| AT5G54145 | hypothetical protein;(source:Araport11) |
| AT4G26480 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT1G24068 | other_RNA;(source:Araport11) |
| AT4G04925 | transmembrane protein;(source:Araport11) |
| AT5G28143 | pseudogene of topoisomerase II;(source:Araport11) |
| AT1G32680 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G35880.1);(source:TAIR10) |
| AT2G22530 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT1G51970 | B3 domain protein;(source:Araport11) |
| AT5G37240 | hypothetical protein;(source:Araport11) |
| AT5G54040 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G11370 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G22790 | Low affinity potassium transport system protein;(source:Araport11) |
| AT1G80620 | S15/NS1, RNA-binding protein;(source:Araport11) |
| AT5G22400 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
| AT3G15604 | hypothetical protein;(source:Araport11) |
| AT4G15775 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT1G66245 | hypothetical protein;(source:Araport11) |
| AT3G47110 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G01060 | lysine-tRNA ligase;(source:Araport11) |
| AT3G63360 | Encodes a defensin-like (DEFL) family protein. |
| AT1G55240 | proteinase inhibitor I4, serpin (DUF716);(source:Araport11) |
| AT4G22285 | Ubiquitin C-terminal hydrolases superfamily protein;(source:Araport11) |
| AT3G48208 | Encodes a Plant thionin family protein |
| AT1G63290 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G45590 | Ribosomal protein L35;(source:Araport11) |
| AT1G33840 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G30838 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-163 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT4G00893 | F-box/kelch-repeat protein;(source:Araport11) |
| AT1G28890 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G42430 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G42390 | kinase C substrate, heavy chain-like protein;(source:Araport11) |
| AT5G56530 | tRNA-splicing ligase (DUF239);(source:Araport11) |
| AT3G15240 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
| AT3G29830 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G11810 | transmembrane protein;(source:Araport11) |
| AT1G52060 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G44020 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G11190 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT1G66870 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT3G57210 | hypothetical protein;(source:Araport11) |
| AT5G38950 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G06744 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G19920 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT5G01120 | hypothetical protein (DUF674);(source:Araport11) |
| AT2G03510 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT4G19460 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G00165 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G71530 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G25200 | hypothetical protein (DUF868);(source:Araport11) |
| AT1G55700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G45063 | copper ion binding / electron carrier protein;(source:Araport11) |
| AT3G06170 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT3G45200 | hypothetical protein;(source:Araport11) |
| AT4G22960 | FAM63A-like protein (DUF544);(source:Araport11) |
| AT3G42550 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G05310 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G03923 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G37190 | plasma membrane, autoregulation-binding site, misato segment II, myosin-like, tubulin/FtsZ protein;(source:Araport11) |
| AT2G01410 | NHL domain-containing protein;(source:Araport11) |
| AT5G66590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT5G22560 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G46370 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G35736 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G03490 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G49030 | PLAC8 family protein;(source:Araport11) |
| AT1G17010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G80610 | hypothetical protein;(source:Araport11) |
| AT5G06990 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT5G19230 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT1G48090 | calcium-dependent lipid-binding family protein;(source:Araport11) |
| AT2G12290 | hypothetical protein;(source:Araport11) |
| AT4G34380 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G57400 | transmembrane protein;(source:Araport11) |
| AT1G65750 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-18 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G03930 | kinase-like protein;(source:Araport11) |
| AT5G52965 | egg cell-secreted-like protein (DUF1278);(source:Araport11) |
| AT2G27590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G04480 | endoribonuclease;(source:Araport11) |
| AT4G02250 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G00090 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G45460 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT3G29220 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30843.1);(source:TAIR10) |
| AT3G44980 | hypothetical protein;(source:Araport11) |
| AT1G27410 | DNA repair metallo-beta-lactamase family protein;(source:Araport11) |
| AT3G63095 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT1G54890 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT5G23160 | transmembrane protein;(source:Araport11) |
| AT1G73440 | calmodulin-like protein;(source:Araport11) |
| AT3G27910 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT3G52330 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G29570 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT4G07950 | DNA-directed RNA polymerase, subunit M, archaeal;(source:Araport11) |
| AT5G49920 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G18210 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G23520 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G41850 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G33920 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT3G26747 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT5G12930 | inactive rhomboid protein;(source:Araport11) |
| AT5G14940 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G52950 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G61280 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT2G43795 | corepressor;(source:Araport11) |
| AT4G21170 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G59260 | pirin;(source:Araport11) |
| AT1G64850 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G27425 | Encodes a ECA1 gametogenesis related family protein |
| AT2G36440 | hypothetical protein;(source:Araport11) |
| AT2G47120 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G43660 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G48290.1);(source:TAIR10) |
| AT5G52815 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT1G65483 | hypothetical protein;(source:Araport11) |
| AT5G32925 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.0e-105 P-value blast match to GB:AAA66266 unknown protein ORF1 transposable element En-1 (CACTA-element) (Zea mays);(source:TAIR10) |
| AT3G24780 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
| AT1G75970 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT4G28260 | acyl-UDP-N-acetylglucosamine O-acyltransferase;(source:Araport11) |
| AT5G60580 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G77290 | Glutathione S-transferase family protein;(source:Araport11) |
| AT5G06520 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT2G34350 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT2G28960 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G25169 | transmembrane protein;(source:Araport11) |
| AT3G42520 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G44875.1);(source:TAIR10) |
| AT2G33847 | hypothetical protein;(source:Araport11) |
| AT1G54355 | Natural antisense transcript overlaps with AT1G54350;(source:Araport11) |
| AT2G40350 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT4G32360 | Pyridine nucleotide-disulfide oxidoreductase family protein;(source:Araport11) |
| AT3G12040 | Encodes a 3-methyladenine-DNA glycosylase. Arabdiopsis cDNA complements the methyl methanesulfonate-sensitive phenotype of an Escherichia coli double mutant deficient in 3-methyladenine glycosylases (DNA-3-methyladenine glycosidases I and II, EC 3.2.2.20 and 3.2.2.21, respectively, encoded by tag and alkA). |
| AT4G20920 | double-stranded RNA-binding domain (DsRBD)-containing protein;(source:Araport11) |
| AT4G17140 | pleckstrin homology (PH) domain-containing protein;(source:Araport11) |
| AT2G39270 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G48710 | DEK domain-containing chromatin associated protein;(source:Araport11) |
| AT1G28850 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT2G09800 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-162 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G47950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-238 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT5G49138 | Natural antisense transcript overlaps with AT5G49130;(source:Araport11) |
| AT3G17225 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G41280 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT5G43040 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G02810 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G46192 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.4e-69 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G23205 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G55610 | isopentenyl-diphosphate delta-isomerase;(source:Araport11) |
| AT5G38250 | Protein kinase family protein;(source:Araport11) |
| AT3G13403 | Encodes a defensin-like (DEFL) family protein. |
| AT5G65380 | MATE efflux family protein;(source:Araport11) |
| AT1G48060 | F-box/associated interaction domain protein;(source:Araport11) |
| AT5G10190 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G10507 | other_RNA;(source:Araport11) |
| AT5G67020 | hypothetical protein;(source:Araport11) |
| AT5G53135 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-199 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G30757 | transmembrane protein;(source:Araport11) |
| AT4G23730 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT1G70590 | F-box family protein;(source:Araport11) |
| AT2G01560 | Plant protein 1589 of unknown function;(source:Araport11) |
| AT5G01200 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT5G19350 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G11420 | beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604);(source:Araport11) |
| AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G77131 | Annotated as pseudogene of PGSIP, glycogenin glucosyltransferase.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G59850 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G30150 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G28770 | Tetraspanin family protein;(source:Araport11) |
| AT1G57580 | F-box family protein;(source:Araport11) |
| AT2G40820 | stomatal closure actin-binding-like protein;(source:Araport11) |
| AT2G34190 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G78840 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G65120 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT3G52470 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G47020 | MraZ;(source:Araport11) |
| AT1G68875 | hypothetical protein;(source:Araport11) |
| AT1G10990 | transmembrane protein;(source:Araport11) |
| AT5G28491 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G28720 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G76780 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G31370 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT5G48830 | phosphoglycolate phosphatase;(source:Araport11) |
| AT4G21437 | unknown pseudogene |
| AT1G65200 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT3G46186 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G79245 | pseudogene of Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
| AT5G59662 | Natural antisense transcript overlaps with AT5G59660;(source:Araport11) |
| AT3G29000 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT3G54366 | Unknown gene The mRNA is cell-to-cell mobile. |
| AT5G54370 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT4G19360 | SCD6 protein-like protein;(source:Araport11) |
| AT2G28970 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G53100 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G38220 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G08160 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT3G56890 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G31240 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G24557 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
| AT3G11640 | transmembrane protein;(source:Araport11) |
| AT2G20010 | Gls protein (DUF810);(source:Araport11) |
| AT1G10890 | arginine/glutamate-rich 1 protein;(source:Araport11) |
| AT4G22640 | LTPG protein |
| AT5G36937 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-09 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G54350 | C2H2-type zinc finger protein;(source:Araport11) |
| AT1G61260 | cotton fiber (DUF761);(source:Araport11) |
| AT5G05830 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G11325 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT3G18150 | RNI-like superfamily protein;(source:Araport11) |
| AT5G07315 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT3G20620 | F-box family protein-like protein;(source:Araport11) |
| AT4G11300 | ROH1, putative (DUF793);(source:Araport11) |
| AT2G03100 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.2e-225 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G17490 | epidermal patterning factor-like protein;(source:Araport11) |
| AT2G36860 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT1G50740 | Transmembrane proteins 14C;(source:Araport11) |
| AT5G50190 | other_RNA;(source:Araport11) |
| AT3G26235 | hypothetical protein;(source:Araport11) |
| AT3G32975 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-133 P-value blast match to gb|AAL06422.1|AF378081_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT1G51790 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G56160 | Sodium Bile acid symporter family;(source:Araport11) |
| AT1G66910 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G43740 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G77765 | transmembrane protein;(source:Araport11) |
| AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT4G37700 | hypothetical protein;(source:Araport11) |
| AT5G12060 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G26350 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G33393.1);(source:TAIR10) |
| AT5G46195 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 8.8e-38 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G37890 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G53965 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT2G05160 | CCCH-type zinc fingerfamily protein with RNA-binding domain-containing protein;(source:Araport11) |
| AT2G43220 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G36360 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G57230 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G36680 | Modifier of rudimentary (Mod(r)) protein;(source:Araport11) |
| AT1G21930 | transmembrane protein;(source:Araport11) |
| AT5G07800 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT1G55546 | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase;(source:Araport11) |
| AT4G04632 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G38550 | Jacalin lectin family protein gene |
| AT1G72820 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT2G36255 | Encodes a defensin-like (DEFL) family protein. |
| AT1G31220 | N10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide |
| AT4G31980 | PPPDE thiol peptidase family protein;(source:Araport11) |
| AT5G23610 | DYAD protein;(source:Araport11) |
| AT3G23960 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G72060 | serine-type endopeptidase inhibitor;(source:Araport11) |
| AT5G10920 | L-Aspartase-like family protein;(source:Araport11) |
| AT3G43890 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G29810 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G60200 | hypothetical protein;(source:Araport11) |
| AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
| AT1G76070 | hypothetical protein;(source:Araport11) |
| AT5G28310 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G36240 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT1G49360 | F-box family protein;(source:Araport11) |
| AT5G42220 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G04900 | NADH dehydrogenase ubiquinone complex I, assembly factor-like protein (DUF185);(source:Araport11) |
| AT3G25960 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G63320 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G23560 | OBP32pep, putative (DUF220);(source:Araport11) |
| AT5G49500 | Signal recognition particle, SRP54 subunit protein;(source:Araport11) |
| AT5G64880 | transmembrane protein;(source:Araport11) |
| AT4G04296 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.4e-13 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G57200 | glycosyltransferase-like protein;(source:Araport11) |
| AT5G24460 | RING-H2 zinc finger protein;(source:Araport11) |
| AT2G43610 | Chitinase family protein;(source:Araport11) |
| AT4G20730 | transposable_element_gene;(source:Araport11);similar to ASY2, DNA binding [Arabidopsis thaliana] (TAIR:AT4G32200.1);(source:TAIR10) |
| AT3G43540 | initiation factor 4F subunit (DUF1350);(source:Araport11) |
| AT1G33230 | TMPIT-like protein;(source:Araport11) |
| AT4G16563 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G66310 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G49960 | Its expression is enriched in root hair cells (compared to non-root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in root hair cells relative to non-root hair cells. |
| AT4G33910 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G12880 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G33845 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT5G29029 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 46%25 identity and 3.0e-30 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10) |
| AT1G77095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.8e-14 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G04000 | hypothetical protein;(source:Araport11) |
| AT4G23540 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G50300 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G30695 | bacterial trigger factor;(source:Araport11) |
| AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G48953 | hypothetical protein;(source:Araport11) |
| AT2G37700 | Fatty acid hydroxylase superfamily;(source:Araport11) |
| AT2G19200 | pseudogene of hypothetical protein (DUF626);(source:Araport11) |
| AT2G23321 | hypothetical protein;(source:Araport11) |
| AT1G14930 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G07450 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G77790 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G23037 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G78170 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT3G21940 | Receptor protein kinase-like protein;(source:Araport11) |
| AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
| AT3G59310 | solute carrier family 35 protein (DUF914);(source:Araport11) |
| AT4G09870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G22570 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G57510 | cotton fiber protein;(source:Araport11) |
| AT3G43715 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT2G23160 | F-box family protein;(source:Araport11) |
| AT4G30030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G25495 | pseudogene of leucine-rich repeat protein |
| AT4G36120 | filament-like protein (DUF869);(source:Araport11) |
| AT4G08555 | hypothetical protein;(source:Araport11) |
| AT4G32390 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT2G30780 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G43140 | Cullin family protein;(source:Araport11) |
| AT1G75870 | hypothetical protein;(source:Araport11) |
| AT2G25409 | hypothetical protein;(source:Araport11) |
| AT1G75460 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT5G66455 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
| AT3G59120 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G02065 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G45120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G75163 | snoRNA;(source:Araport11) |
| AT3G60440 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT4G16220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G10490 | GNAT acetyltransferase (DUF699);(source:Araport11) |
| AT2G36410 | transcriptional activator (DUF662);(source:Araport11) |
| AT5G18661 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G21780 | hypothetical protein;(source:Araport11) |
| AT5G39090 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G13210 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
| AT5G59670 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G46190 | TRAF-like family protein;(source:Araport11) |
| AT5G39390 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G42460 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT2G26270 | BRCT domain DNA repair protein;(source:Araport11) |
| AT3G30708 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.3e-90 P-value blast match to gb|AAL06420.1|AF378078_1 reverse transcriptase (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT3G60710 | F-box family protein. |
| AT1G69020 | Prolyl oligopeptidase family protein;(source:Araport11) |
| AT5G53740 | hypothetical protein;(source:Araport11) |
| AT1G80230 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT5G64190 | neuronal PAS domain protein;(source:Araport11) |
| AT1G79570 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT1G70100 | neurofilament heavy protein;(source:Araport11) |
| AT1G13820 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G16840 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-06 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10) |
| AT1G02260 | Divalent ion symporter;(source:Araport11) |
| AT3G46360 | transmembrane protein;(source:Araport11) |
| AT3G20590 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G12760 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT4G39952 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G27745 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT2G04110 | pseudogene of expressed protein;(source:Araport11) |
| AT2G22030 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G25930 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT1G45015 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
| AT4G02540 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G65320 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G19120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G42895 | Encodes a ECA1 gametogenesis related family protein |
| AT3G42722 | pseudogene of the F-box protein family |
| AT2G03970 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 33%25 identity and 1.2e-17 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10) |
| AT3G25030 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G25415 | hypothetical protein (DUF239);(source:Araport11) |
| AT3G06437 | pseudogene of hypothetical protein;(source:Araport11) |
| AT2G38790 | hypothetical protein;(source:Araport11) |
| AT4G36230 | transmembrane protein;(source:Araport11) |
| AT3G44800 | Meprin and TRAF (MATH) homology domain-containing protein;(source:Araport11) |
| AT1G30190 | cotton fiber protein;(source:Araport11) |
| AT3G05510 | Phospholipid/glycerol acyltransferase family protein;(source:Araport11) |
| AT1G30860 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G17570 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
| AT3G25720 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT3G47050 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT2G04740 | ankyrin repeat family protein;(source:Araport11) |
| AT1G53370 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G13851 | pseudogene of hypothetical protein;(source:Araport11) |
| AT5G67411 | GRAS family transcription factor;(source:Araport11) |
| AT3G29680 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G01516 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G43910 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT4G00905 | NC domain-containing protein-like protein;(source:Araport11) |
| AT3G18050 | GPI-anchored protein;(source:Araport11) |
| AT5G48430 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G26270 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT1G09750 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G10865 | cytochrome C oxidase assembly factor;(source:Araport11) |
| AT1G48220 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G31350 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT2G36470 | DUF868 family protein, putative (DUF868);(source:Araport11) |
| AT5G65305 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT3G46700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G28450 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT1G52870 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT1G05790 | lipase class 3 family protein;(source:Araport11) |
| AT3G10880 | tropomyosin;(source:Araport11) |
| AT3G10185 | Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein |
| AT3G51350 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G01540 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G45660 | Encodes a member of the NAXT NPF subfamily. |
| AT1G61890 | MATE efflux family protein;(source:Araport11) |
| AT4G34500 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G66330 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G42796 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-31 P-value blast match to reverse transcriptase (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G14688 | E3 ubiquitin ligase;(source:Araport11) |
| AT4G11580 | RNI-like superfamily protein;(source:Araport11) |
| AT3G49200 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT5G53895 | hypothetical protein;(source:Araport11) |
| AT1G29320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G01710 | methyltransferase;(source:Araport11) |
| AT4G03370 | Ubiquitin family protein;(source:Araport11) |
| AT1G30990 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G30320 | Remorin family protein;(source:Araport11) |
| AT5G51680 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G06534 | transmembrane protein;(source:Araport11) |
| AT3G44280 | peptidyl-prolyl cis-trans isomerase G;(source:Araport11) |
| AT3G45256 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT1G11210 | cotton fiber protein, putative (DUF761);(source:Araport11) |
| AT4G23490 | fringe-like protein (DUF604);(source:Araport11) |
| AT1G80510 | Encodes a close relative of the amino acid transporter ANT1 (AT3G11900). |
| AT2G18150 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G15350 | G14 enzyme |
| AT1G69550 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT4G26380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G14730 | Unknown protein, expression induced by IDL7 and stress. |
| AT5G01881 | transmembrane protein;(source:Araport11) |
| AT5G37790 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G61370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G24090 | homer protein;(source:Araport11) |
| AT2G28570 | hypothetical protein;(source:Araport11) |
| AT5G63180 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G38960 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G02030 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G35450 | pseudogene of Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G23510 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT2G32179 | Natural antisense transcript overlaps with AT2G32180;(source:Araport11) |
| AT5G05310 | TLC ATP/ADP transporter;(source:Araport11) |
| AT1G17495 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-213 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT4G30500 | transmembrane protein (DUF788);(source:Araport11) |
| AT3G03610 | ELMO/CED-12 family protein;(source:Araport11) |
| AT1G05450 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT4G15070 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G24920 | secE/sec61-gamma protein transport protein;(source:Araport11) |
| AT2G16895 | pseudogene of UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G28515 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G48960 | Ribosomal protein L13e family protein;(source:Araport11) |
| AT5G58610 | PHD finger transcription factor;(source:Araport11) |
| AT4G28930 | hypothetical protein;(source:Araport11) |
| AT1G63820 | CCT motif family protein;(source:Araport11) |
| AT4G29120 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT5G56880 | hypothetical protein;(source:Araport11) |
| AT1G53625 | hypothetical protein;(source:Araport11) |
| AT1G67270 | Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
| AT4G21950 | hypothetical protein;(source:Araport11) |
| AT5G25990 | core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G64035 | pseudogene of serpin 2;(source:Araport11) |
| AT2G27340 | N-acetylglucosaminylphosphatidylinositol de-N-acetylase family protein;(source:Araport11) |
| AT5G15260 | ribosomal protein L34e superfamily protein;(source:Araport11) |
| AT1G11572 | Encodes a Plant thionin family protein |
| AT1G04490 | hypothetical protein (DUF3527);(source:Araport11) |
| AT1G05140 | Peptidase M50 family protein;(source:Araport11) |
| AT1G53420 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G76660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G02795 | transmembrane protein;(source:Araport11) |
| AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT5G23650 | Homeodomain-like transcriptional regulator;(source:Araport11) |
| AT3G62510 | disulfide isomerase-like protein;(source:Araport11) |
| AT4G08340 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
| AT2G28270 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G09645 | transmembrane protein;(source:Araport11) |
| AT1G26550 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G55830 | coiled-coil protein;(source:Araport11) |
| AT3G47040 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G23245 | hypothetical protein;(source:Araport11) |
| AT5G32678 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0. P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G10520 | Subtilase family protein;(source:Araport11) |
| AT1G21286 | Pseudogene of AT1G21245; wall-associated kinase-related protein |
| AT1G24657 | pseudogene of Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G27180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G25520 | Drug/metabolite transporter superfamily protein;(source:Araport11) |
| AT1G33475 | SNARE-like superfamily protein;(source:Araport11) |
| AT3G13280 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT3G20380 | TRAF-like family protein;(source:Araport11) |
| AT2G11190 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-90 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT3G13560 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G33140 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT4G32000 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G37440 | DNAse I-like superfamily protein;(source:Araport11) |
| AT2G01400 | hypothetical protein;(source:Araport11) |
| AT1G09620 | ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11) |
| AT3G18790 | pre-mRNA-splicing factor ISY1-like protein;(source:Araport11) |
| AT1G73970 | obscurin-like protein;(source:Araport11) |
| AT1G61830 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G28610 | LOW protein: ATP-dependent RNA helicase DRS1-like protein;(source:Araport11) |
| AT1G53110 | proton pump-interactor;(source:Araport11) |
| AT2G38823 | hypothetical protein;(source:Araport11) |
| AT3G49630 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G60720 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT3G27325 | hydrolases, acting on ester bond;(source:Araport11) |
| AT5G28935 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.0e-48 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G13260 | myosin;(source:Araport11) |
| AT1G50660 | actin cytoskeleton-regulatory complex pan-like protein;(source:Araport11) |
| AT3G01030 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT2G39795 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT1G74750 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G76705 | calmodulin binding protein;(source:Araport11) |
| AT3G58600 | Adaptin ear-binding coat-associated protein 1 NECAP-1;(source:Araport11) |
| AT4G13180 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT5G28635 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.1e-162 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G61540 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11) |
| AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT3G45935 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT2G39710 | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT1G80690 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT2G35250 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT5G42690 | transcription factor, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT4G27620 | intracellular protein transporter;(source:Araport11) |
| AT5G39861 | pseudogene of receptor kinase 3;(source:Araport11) |
| AT3G60470 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G37476 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-18 P-value blast match to GB:CAA37925 orf 3 (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G25020 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
| AT1G14730 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
| AT4G14280 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G53340 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G25480 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT4G29590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G27630 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G11670 | MATE efflux family protein;(source:Araport11) |
| AT2G12170 | hypothetical protein;(source:Araport11) |
| AT2G23710 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
| AT1G56130 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT4G15430 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT5G04860 | splicing factor 3A subunit;(source:Araport11) |
| AT5G50860 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G35985 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT1G35625 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G70770 | Involved in cell wall modifications resulting in resistance to the biotroph Hpa. |
| AT1G57720 | Translation elongation factor EF1B, gamma chain;(source:Araport11) |
| AT1G76220 | hypothetical protein (DUF241);(source:Araport11) |
| AT4G08750 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G08760.1);(source:TAIR10) |
| AT2G37540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G49170 | hypothetical protein;(source:Araport11) |
| AT3G47295 | hypothetical protein;(source:Araport11) |
| AT3G62280 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G14390 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G11660 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT4G23720 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT1G02590 | Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding protein;(source:Araport11) |
| AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
| AT5G57970 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT3G28923 | Pseudogene of AT5G01080; beta-galactosidase |
| AT1G11925 | Encodes a Stigma-specific Stig1 family protein |
| AT4G27400 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT5G24430 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT2G45590 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G38130 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G08145 | transposable_element_gene;(source:Araport11);hypothetical protein, contains Pfam domain, PF04827: Protein of unknown function (DUF635);(source:TAIR10) |
| AT1G52110 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT2G22795 | hypothetical protein;(source:Araport11) |
| AT1G03210 | Phenazine biosynthesis PhzC/PhzF protein;(source:Araport11) |
| AT2G43620 | Chitinase family protein;(source:Araport11) |
| AT1G11360 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G51220 | ubiquinol-cytochrome C chaperone family protein;(source:Araport11) |
| AT1G73770 | coiled-coil protein;(source:Araport11) |
| AT4G14600 | Target SNARE coiled-coil domain protein;(source:Araport11) |
| AT2G23960 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT4G12270 | Copper amine oxidase family protein;(source:Araport11) |
| AT4G07940 | pre-mRNA-splicing factor CWC22-like protein, putative (DUF3245);(source:Araport11) |
| AT1G69900 | Actin cross-linking protein;(source:Araport11) |
| AT1G01920 | SET domain-containing protein;(source:Araport11) |
| AT3G55960 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G60783 | cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11) |
| AT1G36140 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G07740 | actin binding protein;(source:Araport11) |
| AT5G61445 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT5G38975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-15 P-value blast match to GB:CAA30503 pol polypeptide (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10) |
| AT4G10695 | CDC68-like protein;(source:Araport11) |
| AT1G61400 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G05430 | RNA-binding protein;(source:Araport11) |
| AT2G29520 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT5G13980 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
| AT2G33970 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G47940 | 40S ribosomal protein S27;(source:Araport11) |
| AT5G36903 | pseudogene of protein related to self-incompatibility |
| AT4G15563 | F-box-like protein;(source:Araport11) |
| AT1G28990 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT3G29340 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT2G13975 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10) |
| AT1G18382 | Natural antisense transcript overlaps with AT1G18380;(source:Araport11) |
| AT2G24350 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G13665 | Natural antisense transcript overlaps with AT2G13660;(source:Araport11) |
| AT1G25510 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G40065 | other_RNA;(source:Araport11) |
| AT2G15670 | transmembrane protein;(source:Araport11) |
| AT4G06538 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G27220 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT2G36630 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT4G01090 | Hypothetical protein; participates in wound-induced lateral root development. |
| AT5G23700 | coiled-coil protein;(source:Araport11) |
| AT1G58390 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT5G25040 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G54240 | membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11) |
| AT5G61260 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT1G40089 | pseudogene of fructose-2;(source:Araport11) |
| AT3G47230 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G12505.1);(source:TAIR10) |
| AT3G55080 | SET domain-containing protein;(source:Araport11) |
| AT3G03000 | Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner |
| AT3G62570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT2G32295 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT2G30820 | aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit;(source:Araport11) |
| AT4G04200 | Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11) |
| AT1G74640 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G13228 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G27300 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G25970 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G54860 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G28950 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT4G22020 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G26720 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
| AT5G67220 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT2G02060 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G28950 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT4G04790 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G30380 | Encodes a Plant Natriuretic Peptide (PNP). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. |
| AT3G58770 | hypothetical protein;(source:Araport11) |
| AT4G10603 | Encodes a defensin-like (DEFL) family protein. |
| AT3G25510 | disease resistance protein (TIR-NBS-LRR class) family protein;(source:Araport11) |
| AT5G20860 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G08450 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G10890 | myosin heavy chain-like protein;(source:Araport11) |
| AT1G11440 | hypothetical protein;(source:Araport11) |
| AT2G04510 | pseudogene of ribonuclease H;(source:Araport11) |
| AT4G22190 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT1G29020 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G00350 | MATE efflux family protein;(source:Araport11) |
| AT3G55605 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT1G24733 | pseudogene of CCoAMT (caffeoyl-CoA 3-O-methyltransferase) |
| AT5G17110 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G72141 | transmembrane protein;(source:Araport11) |
| AT1G52440 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G60420 | phosphoglycerate mutase family protein;(source:Araport11) |
| AT1G24200 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT2G15780 | Cupredoxin superfamily protein;(source:Araport11) |
| AT3G50120 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT1G11920 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G02655 | transmembrane protein;(source:Araport11) |
| AT3G12650 | transmembrane protein;(source:Araport11) |
| AT4G31150 | endonuclease V family protein;(source:Araport11) |
| AT3G27997 | pseudogene of expressed protein;(source:Araport11) |
| AT1G02020 | nitroreductase family protein;(source:Araport11) |
| AT4G08953 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-22 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G02160 | Bromodomain transcription factor;(source:Araport11) |
| AT3G03510 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G11860 | sterile alpha motif (SAM) domain protein;(source:Araport11) |
| AT4G23515 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT4G00342 | hypothetical protein;(source:Araport11) |
| AT1G02470 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT5G28220 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT1G53610 | transmembrane protein;(source:Araport11) |
| AT5G27495 | Encodes a defensin-like (DEFL) family protein. |
| AT1G27921 | Natural antisense transcript overlaps with AT1G27920;(source:Araport11) |
| AT1G73210 | hypothetical protein (DUF789);(source:Araport11) |
| AT2G45060 | alanine-tRNA ligase;(source:Araport11) |
| AT3G54750 | downstream neighbor of Son;(source:Araport11) |
| AT3G52480 | transmembrane protein;(source:Araport11) |
| AT5G47250 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT5G03705 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT1G26620 | T-box transcription factor, putative (DUF863);(source:Araport11) |
| AT4G02480 | AAA-type ATPase family protein;(source:Araport11) |
| AT3G11300 | hypothetical protein;(source:Araport11) |
| AT3G13820 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G19810 | pseudogene of cell division cycle 48C;(source:Araport11) |
| AT5G10110 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT3G58940 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G22550 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT1G04425 | other_RNA;(source:Araport11) |
| AT1G13609 | Encodes a defensin-like (DEFL) family protein. |
| AT2G24750 | pseudogene of glutamate receptor 2.2;(source:Araport11) |
| AT1G77520 | O-methyltransferase family protein;(source:Araport11) |
| AT2G46735 | death domain associated protein;(source:Araport11) |
| AT3G09385 | pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G05894 | hypothetical protein;(source:Araport11) |
| AT1G67480 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G42100 | transposable_element_gene;(source:Araport11);similar to AT hook motif-containing protein-related [Arabidopsis thaliana] (TAIR:AT1G35940.1);(source:TAIR10) |
| AT5G27095 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G63990 | Inositol monophosphatase family protein;(source:Araport11) |
| AT2G39040 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
| AT1G73230 | Nascent polypeptide-associated complex NAC;(source:Araport11) |
| AT5G26330 | Cupredoxin superfamily protein;(source:Araport11) |
| AT1G27750 | nucleic acid binding protein;(source:Araport11) |
| AT5G28823 | hypothetical protein;(source:Araport11) |
| AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G26370 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
| AT3G14910 | Rab3 GTPase-activating protein non-catalytic subunit;(source:Araport11) |
| AT3G22540 | hypothetical protein (DUF1677);(source:Araport11) |
| AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G24485 | ER protein carbohydrate-binding protein;(source:Araport11) |
| AT3G53220 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G02270 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
| AT2G46150 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G19060 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT3G29800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G53775 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT5G16900 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G10970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G44065 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G21745 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
| AT3G42255 | transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10) |
| AT3G33530 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT1G54240 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
| AT1G25400 | transmembrane protein;(source:Araport11) |
| AT1G67640 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G65560 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G13470 | hypothetical protein (DUF1262);(source:Araport11) |
| AT1G55410 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G15610 | hypothetical protein (DUF1685);(source:Araport11) |
| AT2G35810 | ureidoglycolate hydrolase;(source:Araport11) |
| AT2G26610 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT3G15534 | hypothetical protein;(source:Araport11) |
| AT5G65650 | sugar transporter, putative (DUF1195);(source:Araport11) |
| AT1G80450 | VQ motif-containing protein;(source:Araport11) |
| AT3G59230 | RNI-like superfamily protein;(source:Araport11) |
| AT1G10050 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT4G21323 | Subtilase family protein;(source:Araport11) |
| AT1G69520 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G17830 | hypothetical protein (DUF789);(source:Araport11) |
| AT1G24405 | hypothetical protein;(source:Araport11) |
| AT5G55330 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G21520 | hypothetical protein;(source:Araport11) |
| AT4G28990 | RNA-binding protein-like protein;(source:Araport11) |
| AT4G26940 | Galactosyltransferase family protein;(source:Araport11) |
| AT5G08690 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
| AT3G44700 | transmembrane protein;(source:Araport11) |
| AT2G16870 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G03030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G38750 | asparaginyl-tRNA synthetase family;(source:Araport11) |
| AT5G28600 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
| AT3G44516 | Pseudogene of AT1G31990; unknown protein |
| AT1G53120 | RNA-binding S4 domain-containing protein;(source:Araport11) |
| AT5G20310 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G10695 | methionyl-tRNA synthetase;(source:Araport11) |
| AT1G28620 | pseudogene of GDSL-like Lipase/Acylhydrolase superfamily protein;(source:Araport11) |
| AT5G22050 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G58050 | RNA helicase family protein;(source:Araport11) |
| AT2G18370 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT3G03341 | cold-regulated protein;(source:Araport11) |
| AT1G15830 | hypothetical protein;(source:Araport11) |
| AT1G32928 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT1G15810 | S15/NS1, RNA-binding protein;(source:Araport11) |
| AT3G23300 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G45244 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT4G02370 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G54700 | hypothetical protein;(source:Araport11) |
| AT5G60290 | hypothetical protein;(source:Araport11) |
| AT3G25210 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G51150 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT4G09480 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-45 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G36885 | translation initiation factor;(source:Araport11) |
| AT5G54870 | inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11) |
| AT4G14746 | neurogenic locus notch-like protein;(source:Araport11) |
| AT3G57950 | cotton fiber protein;(source:Araport11) |
| AT3G44718 | Encodes a Plant thionin family protein |
| AT5G14860 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G20970 | calponin-like domain protein;(source:Araport11) |
| AT3G47010 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G58890 | RNI-like superfamily protein;(source:Araport11) |
| AT1G28870 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT3G07510 | maternal effect embryo arrest protein;(source:Araport11) |
| AT2G01810 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G23700 | Itga6 (Protein of unknown function, DUF547);(source:Araport11) |
| AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G54905 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.3e-08 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G70380 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G36350 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
| AT5G06220 | LETM1-like protein;(source:Araport11) |
| AT1G55690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G14260 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT5G52530 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT5G26990 | Drought-responsive family protein;(source:Araport11) |
| AT1G63580 | Encodes a plasma membrane-localized protein with two DUF26 domains and a GPI anchor domain. |
| AT1G02380 | transmembrane protein;(source:Araport11) |
| AT5G66558 | Natural antisense transcript overlaps with AT5G66560;(source:Araport11) |
| AT1G80570 | RNI-like superfamily protein;(source:Araport11) |
| AT3G27150 | Target gene of MIR2111-5p. |
| AT4G16980 | arabinogalactan-protein family;(source:Araport11) |
| AT2G05260 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G03430 | phosphoadenosine phosphosulfate (PAPS) reductase family protein;(source:Araport11) |
| AT5G10820 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G29033 | glycine-rich protein;(source:Araport11) |
| AT1G22230 | nucleolar GTP-binding protein;(source:Araport11) |
| AT1G28740 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT2G41780 | hypothetical protein;(source:Araport11) |
| AT5G61970 | signal recognition particle-related / SRP-like protein;(source:Araport11) |
| AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G17740 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G17940 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
| AT1G67620 | Lojap-related protein;(source:Araport11) |
| AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
| AT5G51795 | DNA/RNA-binding protein Kin17, conserved region;(source:Araport11) |
| AT3G28570 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G23600 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G02550 | hypothetical protein;(source:Araport11) |
| AT2G23210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G48405 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT3G57470 | Insulinase (Peptidase family M16) family protein;(source:Araport11) |
| AT3G56300 | Cysteinyl-tRNA synthetase, class Ia family protein;(source:Araport11) |
| AT5G05598 | Encodes a Defensin-like (DEFL) family protein |
| AT3G58370 | TRAF-like family protein;(source:Araport11) |
| AT1G75550 | glycine-rich protein;(source:Araport11) |
| AT3G16175 | Thioesterase superfamily protein;(source:Araport11) |
| AT5G12410 | THUMP domain-containing protein;(source:Araport11) |
| AT5G28280 | pseudogene of sterol desaturase domain-containing protein;(source:Araport11) |
| AT2G17340 | pantothenate kinase;(source:Araport11) |
| AT2G29150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G52050 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G09220 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G16225 | Target SNARE coiled-coil domain protein;(source:Araport11) |
| AT3G53590 | LRR receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT2G05340 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0.00039 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G11540 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT3G43522 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative Ta11-like non-LTR retroelement protein;(source:TAIR10) |
| AT2G39580 | zinc finger C3H1 domain protein;(source:Araport11) |
| AT1G02360 | Chitinase family protein;(source:Araport11) |
| AT5G18940 | Mo25 family protein;(source:Araport11) |
| AT5G07650 | Actin-binding FH2 protein;(source:Araport11) |
| AT3G46270 | receptor protein kinase-like protein;(source:Araport11) |
| AT3G30705 | transmembrane protein;(source:Araport11) |
| AT2G37420 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G07570 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT1G58130 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G26055 | transmembrane protein;(source:Araport11) |
| AT4G11200 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30370.1);(source:TAIR10) |
| AT1G02550 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G20220 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT4G30060 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G21215 | transmembrane protein;(source:Araport11) |
| AT4G16330 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G10560 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT1G66190 | hypothetical protein;(source:Araport11) |
| AT5G14495 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT1G61360 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G38790 | ER lumen protein retaining receptor family protein;(source:Araport11) |
| AT4G16267 | Encodes a Plant thionin family protein [pseudogene] |
| AT3G07190 | B-cell receptor-associated protein 31-like protein;(source:Araport11) |
| AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT2G38800 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT1G35660 | erythroid differentiation factor-like protein;(source:Araport11) |
| AT3G23760 | transferring glycosyl group transferase;(source:Araport11) |
| AT1G03390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G12640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.7e-25 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G62080 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT2G22122 | hypothetical protein;(source:Araport11) |
| AT5G28580 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.3e-33 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G50310 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G37975 | Yos1-like protein;(source:Araport11) |
| AT2G35120 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT1G01440 | hypothetical protein (DUF3133);(source:Araport11) |
| AT2G16420 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.8e-39 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G41540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G45605 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.0e-230 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G06980 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G36808 | Natural antisense transcript overlaps with AT4G36810;(source:Araport11) |
| AT5G01070 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT4G01110 | late embryogenesis abundant hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G19055 | hypothetical protein;(source:Araport11) |
| AT4G31510 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT1G16430 | Surfeit locus protein 5 subunit 22 of Mediator complex;(source:Araport11) |
| AT3G49640 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT3G27390 | transmembrane protein;(source:Araport11) |
| AT5G01750 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G43850 | hypothetical protein;(source:Araport11) |
| AT4G27840 | SNARE-like superfamily protein;(source:Araport11) |
| AT3G01960 | hypothetical protein;(source:Araport11) |
| AT3G03855 | Annotated as pseudogene of disease resistance protein.Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
| AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G80520 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT1G48268 | pseudogene of F-box family protein |
| AT5G38440 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT2G11220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-16 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT4G33820 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT3G45050 | transmembrane protein;(source:Araport11) |
| AT1G15610 | transmembrane protein;(source:Araport11) |
| AT1G79980 | pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10) |
| AT1G20430 | hypothetical protein;(source:Araport11) |
| AT1G77370 | Glutaredoxin family protein;(source:Araport11) |
| AT1G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G33930 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G37795 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT2G39920 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT2G32160 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G47790 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT1G70185 | other_RNA;(source:Araport11) |
| AT1G12890 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G57840 | pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G03972 | pseudogene of heat shock protein |
| AT1G10340 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G63860 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G08310 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G15115 | serine/arginine repetitive matrix protein;(source:Araport11) |
| AT4G07470 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30600.1);(source:TAIR10) |
| AT5G15270 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT3G28530 | UDP-glucose 4-epimerase;(source:Araport11) |
| AT5G46295 | transmembrane protein;(source:Araport11) |
| AT3G46600 | GRAS family transcription factor;(source:Araport11) |
| AT5G53030 | hypothetical protein;(source:Araport11) |
| AT5G48680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT5G41380 | CCT motif family protein;(source:Araport11) |
| AT1G53350 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT3G56750 | plant/protein;(source:Araport11) |
| AT5G41890 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G31175 | cytochrome C oxidase biogenesis Cmc1-like protein;(source:Araport11) |
| AT2G33890 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G48770 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G58410 | HEAT/U-box domain-containing protein;(source:Araport11) |
| AT3G24190 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G65720 | transmembrane protein;(source:Araport11) |
| AT4G36510 | hypothetical protein;(source:Araport11) |
| AT2G06770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.7e-15 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G40270 | Protein kinase family protein;(source:Araport11) |
| AT1G10330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G11320 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 41%25 identity and 1.7e-199 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT4G19870 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G50850 | Putative methyltransferase family protein;(source:Araport11) |
| AT4G36470 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G45480 | transmembrane protein, putative (DUF594);(source:Araport11) |
| AT5G66540 | U3 small nucleolar ribonucleoprotein;(source:Araport11) |
| AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT1G03820 | E6-like protein;(source:Araport11) |
| AT5G05070 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G15357 | phosphopantothenoylcysteine decarboxylase subunit;(source:Araport11) |
| AT4G32950 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G51620 | Uncharacterized protein family (UPF0172);(source:Araport11) |
| AT4G05018 | transmembrane protein;(source:Araport11) |
| AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
| AT2G45360 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
| AT4G03364 | Pseudogene of AT4G05230; ubiquitin family protein |
| AT5G28927 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.9e-45 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT1G05960 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G42830 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G26140 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
| AT3G44060 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G17390 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G36905.1);(source:TAIR10) |
| AT5G37220 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G36515 | trichohyalin-like protein;(source:Araport11) |
| AT3G15310 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32621.1);(source:TAIR10) |
| AT4G06518 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G43030 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G14500 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G11540 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G15810 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G36630 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 2.5e-213 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
| AT2G28770 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT5G17270 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT4G35530 | phosphatidylinositolglycan-like protein;(source:Araport11) |
| AT5G24610 | cyclic AMP-responsive element-binding protein;(source:Araport11) |
| AT5G01150 | hypothetical protein (DUF674);(source:Araport11) |
| AT3G60760 | hypothetical protein;(source:Araport11) |
| AT4G07790 | transposable_element_gene;(source:Araport11);hypothetical protein;(source:TAIR10) |
| AT2G18570 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G58720 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G15020 | hypothetical protein;(source:Araport11) |
| AT2G16410 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G15550.1);(source:TAIR10) |
| AT1G45832 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.3e-80 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT3G49140 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G74680 | Exostosin family protein;(source:Araport11) |
| AT3G46280 | kinase-like protein;(source:Araport11) |
| AT1G07473 | hypothetical protein;(source:Araport11) |
| AT5G09960 | sorbin/SH3 domain protein;(source:Araport11) |
| AT3G54980 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G40720 | C3H4 type zinc finger protein (DUF23);(source:Araport11) |
| AT1G45246 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT2G39980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G43570 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G43550 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G42645 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-127 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT2G42760 | DUF1685 family protein;(source:Araport11) |
| AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT2G36180 | EF hand calcium-binding protein family;(source:Araport11) |
| AT2G33255 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G80865 | hypothetical protein;(source:Araport11) |
| AT3G27420 | bromodomain testis-specific protein;(source:Araport11) |
| AT4G25400 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G25820 | Exostosin family protein;(source:Araport11) |
| AT5G51790 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G04230 | rRNA-processing EFG1-like protein (DUF2361);(source:Araport11) |
| AT5G63200 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
| AT1G07280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G01680 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G49180 | protein kinase family protein;(source:Araport11) |
| AT5G23760 | Copper transport protein family;(source:Araport11) |
| AT3G02270 | Trimeric LpxA-like enzyme;(source:Araport11) |
| AT1G28930 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT4G16745 | Exostosin family protein;(source:Araport11) |
| AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G11385 | hypothetical protein;(source:Araport11) |
| AT2G24130 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT5G47225 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT1G78922 | transmembrane protein;(source:Araport11) |
| AT5G10460 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G26240 | Transmembrane proteins 14C;(source:Araport11) |
| AT2G05770 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0043H09.1, blastp match of 30%25 identity and 1.6e-29 P-value to GP|21740634|emb|CAD40195.1||AL606611 OSJNBb0043H09.1 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT2G13125 | hypothetical protein;(source:Araport11) |
| AT3G63052 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G23340 | RNI-like superfamily protein;(source:Araport11) |
| AT4G16230 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G12915 | Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11) |
| AT2G18200 | transmembrane protein;(source:Araport11) |
| AT2G31860 | pseudogene of poly(ADP-ribose) glycohydrolase 2;(source:Araport11) |
| AT4G06750 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 3.0e-60 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G52030 | F-box family protein with WD40/YVTN repeat doamin;(source:Araport11) |
| AT3G53560 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G11140 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT4G17990 | hypothetical protein;(source:Araport11) |
| AT1G28090 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
| AT4G12115 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT5G56975 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT3G10460 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G14517 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-38 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G04545 | Encodes a defensin-like (DEFL) family protein. |
| AT3G09080 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G19400 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G54190 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G10865 | transposable_element_gene;(source:Araport11);non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT2G30220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G11550 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G18700 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT4G01897 | dihydroorotate dehydrogenase;(source:Araport11) |
| AT4G01245 | hypothetical protein;(source:Araport11) |
| AT5G62610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G75810 | transmembrane protein;(source:Araport11) |
| AT4G32440 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
| AT4G34103 | pseudogene of protein binding / zinc ion binding protein |
| AT3G58640 | Mitogen activated protein kinase kinase kinase-like protein;(source:Araport11) |
| AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT1G49500 | transcription initiation factor TFIID subunit 1b-like protein;(source:Araport11) |
| AT3G12850 | COP9 signalosome complex-related / CSN complex-like protein;(source:Araport11) |
| AT5G04730 | Ankyrin-repeat containing protein;(source:Araport11) |
| AT3G09440 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT2G29995 | PSY3-like protein;(source:Araport11) |
| AT1G59550 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
| AT1G67680 | SRP72 RNA-binding domain-containing protein;(source:Araport11) |
| AT2G46535 | hypothetical protein;(source:Araport11) |
| AT2G28440 | proline-rich family protein;(source:Araport11) |
| AT2G32520 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G32291 | Pseudogene of AT2G31470; F-box family protein |
| AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G23915 | Encodes an alanine tRNA with the anticodon CGC that recognizes the alanine codon GCG. |
| AT3G61820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G39020 | SH3 domain-containing protein;(source:Araport11) |
| AT1G66890 | 50S ribosomal-like protein;(source:Araport11) |
| AT5G18460 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
| AT5G48605 | Encodes a defensin-like (DEFL) family protein. |
| AT1G11320 | GDSL esterase/lipase;(source:Araport11) |
| AT4G16235 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT3G52710 | hypothetical protein;(source:Araport11) |
| AT5G52760 | Copper transport protein family;(source:Araport11) |
| AT3G04717 | Based on qRT-PCR data, this annotated pseudogene is expressed and upregulated in response to infection with the yellow strain of Cucumber mosaic virus in C24 and Col-0. |
| AT1G36700 | pseudogene of Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G66860 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT3G12150 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT4G08860 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT2G27870.1);(source:TAIR10) |
| AT2G33360 | cadherin EGF LAG seven-pass G-type receptor, putative (DUF3527);(source:Araport11) |
| AT1G26690 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT3G48570 | secE/sec61-gamma protein transport protein;(source:Araport11) |
| AT5G59500 | protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase;(source:Araport11) |
| AT1G75670 | DNA-directed RNA polymerase;(source:Araport11) |
| AT3G57350 | Nucleoporin interacting component (Nup93/Nic96-like) family protein;(source:Araport11) |
| AT5G22620 | encodes a putative 2-carboxy-D-arabinitol 1-phosphate phosphatase |
| AT4G11900 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G21070 | Fe(3+) dicitrate transport system permease;(source:Araport11) |
| AT2G31018 | hypothetical protein;(source:Araport11) |
| AT2G03900 | pseudogene of zinc transporter 7 precursor;(source:Araport11) |
| AT4G34420 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G59725 | DNAJ heat shock family protein;(source:Araport11) |
| AT4G16650 | O-fucosyltransferase family protein;(source:Araport11) |
| AT4G23610 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT4G33830 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT1G23330 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G25870 | hypothetical protein;(source:Araport11) |
| AT4G33467 | hypothetical protein;(source:Araport11) |
| AT3G06180 | Ribosomal protein L34e superfamily protein;(source:Araport11) |
| AT2G16380 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G55750 | BSD domain (BTF2-like transcription factors, Synapse-associated proteins and DOS2-like proteins);(source:Araport11) |
| AT4G28706 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT1G66480 | Involved in chloroplast avoidance movement under intermediate and high light intensities; PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT3G27200 | Cupredoxin superfamily protein;(source:Araport11) |
| AT4G39900 | adenine deaminase;(source:Araport11) |
| AT5G35607 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.6e-07 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G23110 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT1G54955 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05145.1);(source:TAIR10) |
| AT3G43826 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G59960 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT4G28380 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G22410 | Class-II DAHP synthetase family protein;(source:Araport11) |
| AT4G26288 | hypothetical protein;(source:Araport11) |
| AT3G50790 | esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT4G28550 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT4G10980 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-44 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G12460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G54850 | hexon;(source:Araport11) |
| AT1G06620 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
| AT5G08540 | ribosomal RNA small subunit methyltransferase J;(source:Araport11) |
| AT4G21865 | hypothetical protein;(source:Araport11) |
| AT2G13940 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.4e-197 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT4G33985 | membrane insertase, putative (DUF1685);(source:Araport11) |
| AT4G38660 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT4G01735 | polyhomeotic-like protein;(source:Araport11) |
| AT3G33157 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G33950 | pre-tRNA tRNA-Pro (anticodon: CGG);(source:Araport11, TAIR10) |
| AT3G03845 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT3G09050 | 8-amino-7-oxononanoate synthase;(source:Araport11) |
| AT3G12030 | transmembrane/coiled-coil protein (Protein of unknown function DUF106, transmembrane);(source:Araport11) |
| AT2G42640 | Mitogen activated protein kinase kinase kinase-like protein;(source:Araport11) |
| AT4G01920 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G50770 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
| AT4G15960 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G74300 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G57840 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091) |
| AT1G55430 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G07600 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G50210 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G36640 | transmembrane protein;(source:Araport11) |
| AT4G08039 | Encodes a defensin-like (DEFL) family protein. |
| AT5G52272 | pseudogene of ACYB-2/ACYB-1 (cytochrome b reductase) |
| AT5G26700 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G18940 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT1G11230 | transmembrane protein, putative (DUF761);(source:Araport11) |
| AT4G11521 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT1G30350 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G61910 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT5G44220 | F-box family protein;(source:Araport11) |
| AT2G14590 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G27606.1);(source:TAIR10) |
| AT3G49950 | GRAS family transcription factor;(source:Araport11) |
| AT5G37480 | maltase-glucoamylase, intestinal protein;(source:Araport11) |
| AT1G77010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G19570 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G27850 | Glycine-rich protein family;(source:Araport11) |
| AT1G54920 | hypothetical protein;(source:Araport11) |
| AT1G67420 | Zn-dependent exopeptidases superfamily protein;(source:Araport11) |
| AT4G37520 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G25950 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT3G21650 | Encodes protein phosphatase 2A (PP2A) B'zeta subunit. Targeted to mitochondria. |
| AT5G23510 | hypothetical protein;(source:Araport11) |
| AT1G71300 | Vps52 / Sac2 family;(source:Araport11) |
| AT3G47000 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT1G72730 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G61480 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT3G50580 | transmembrane protein;(source:Araport11) |
| AT1G80540 | envelope glycoprotein B;(source:Araport11) |
| AT5G44875 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.3e-87 P-value blast match to Q9SLM0 /314-478 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G31960 | hypothetical protein;(source:Araport11) |
| AT4G18501 | hypothetical protein;(source:Araport11) |
| AT5G19750 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT3G50200 | hypothetical protein (DUF247);(source:Araport11) |
| AT5G51180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G35170 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT4G01700 | Chitinase family protein;(source:Araport11) |
| AT2G41380 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G23520 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G56980 | Pathogen-associated molecular pattern-induced gene.Responsive to jasmonic acid and wounding. |
| AT5G38610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G11945 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to transposases;(source:TAIR10) |
| AT2G44580 | zinc ion binding protein;(source:Araport11) |
| AT2G40230 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G06570 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G25185 | Encodes a defensin-like (DEFL) family protein. |
| AT3G01380 | sulfatase and phosphatidylinositolglycan class N domain-containing protein;(source:Araport11) |
| AT1G68470 | Exostosin family protein;(source:Araport11) |
| AT1G77200 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT4G16040 | transmembrane protein;(source:Araport11) |
| AT1G18960 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT5G54050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G32160 | Phox (PX) domain-containing protein;(source:Araport11) |
| AT4G36648 | other_RNA;(source:Araport11) |
| AT3G21310 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G50380 | vacuolar protein sorting-associated protein, putative (DUF1162);(source:Araport11) |
| AT3G32195 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.8e-102 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G43832 | pseudogene of carboxyl-terminal peptidase (DUF239);(source:Araport11) |
| AT3G28670 | oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT2G36320 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT4G24750 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT3G11390 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G46915 | DUF3754 family protein, putative (DUF3754);(source:Araport11) |
| AT1G15200 | protein-protein interaction regulator family protein;(source:Araport11) |
| AT2G25800 | elongation factor Ts (DUF810);(source:Araport11) |
| AT3G12970 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT2G03821 | hypothetical protein;(source:Araport11) |
| AT1G06137 | transmembrane protein;(source:Araport11) |
| AT5G62140 | ATP-dependent Clp protease ATP-binding subunit;(source:Araport11) |
| AT4G36945 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT3G53490 | valine-tRNA ligase;(source:Araport11) |
| AT1G56120 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G43171 | B3 domain protein;(source:Araport11) |
| AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G34880 | Amidase family protein;(source:Araport11) |
| AT5G11130 | Exostosin family protein;(source:Araport11) |
| AT5G52690 | Copper transport protein family;(source:Araport11) |
| AT5G46450 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G37442 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.7e-44 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G73740 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G27771 | pseudogene of (SAUR) auxin-responsive family protein |
| AT4G27657 | hypothetical protein;(source:Araport11) |
| AT4G25900 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT5G36297 | pseudogene of aspartyl protease family protein |
| AT5G36860 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G14770.2);(source:TAIR10) |
| AT3G58910 | F-box family protein;(source:Araport11) |
| AT1G36078 | transmembrane protein;(source:Araport11) |
| AT2G20921 | hypothetical protein;(source:Araport11) |
| AT5G38260 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G60978 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
| AT4G33160 | F-box family protein;(source:Araport11) |
| AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G17150 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G03010 | RNI-like superfamily protein;(source:Araport11) |
| AT5G59650 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G42386 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.5e-116 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT5G12000 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT2G14870 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G23890 | GPI-anchored adhesin-like protein;(source:Araport11) |
| AT2G47680 | zinc finger (CCCH type) helicase family protein;(source:Araport11) |
| AT3G24005 | pseudogene of heat shock protein 60;(source:Araport11) |
| AT2G28810 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT3G49370 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT5G40590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G20298 | pseudogene of exonuclease family protein |
| AT5G47229 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G63770 | Peptidase M1 family protein;(source:Araport11) |
| AT5G54920 | polyadenylate-binding protein interacting protein;(source:Araport11) |
| AT2G35360 | ubiquitin family protein;(source:Araport11) |
| AT5G14330 | transmembrane protein;(source:Araport11) |
| AT3G07230 | wound-responsive protein-like protein;(source:Araport11) |
| AT4G37250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G61600 | DUF1262 family protein (DUF1262);(source:Araport11) |
| AT1G17230 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT3G03920 | H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein;(source:Araport11) |
| AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
| AT1G56540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G29750 | CRS1 / YhbY (CRM) domain-containing protein;(source:Araport11) |
| AT3G15970 | NUP50 (Nucleoporin 50 kDa) protein;(source:Araport11) |
| AT2G42320 | nucleolar protein gar2-like protein;(source:Araport11) |
| AT5G23903 | transmembrane protein;(source:Araport11) |
| AT2G04090 | MATE efflux family protein;(source:Araport11) |
| AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G21528 | hypothetical protein;(source:Araport11) |
| AT5G51730 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G38396 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G23148 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT4G21700 | DUF2921 family protein, putative (DUF2921);(source:Araport11) |
| AT1G27670 | transmembrane protein;(source:Araport11) |
| AT1G26773 | hypothetical protein;(source:Araport11) |
| AT5G22545 | hypothetical protein;(source:Araport11) |
| AT5G28630 | glycine-rich protein;(source:Araport11) |
| AT2G26380 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G16210 | HEAT repeat-containing protein;(source:Araport11) |
| AT4G39795 | hypothetical protein (DUF581);(source:Araport11) |
| AT5G19240 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT1G20816 | outer envelope pore-like protein;(source:Araport11) |
| AT3G17920 | Outer arm dynein light chain 1 protein;(source:Araport11) |
| AT5G64090 | hyccin;(source:Araport11) |
| AT4G07630 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam profile PF03078: ATHILA ORF-1 family;(source:TAIR10) |
| AT3G04750 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G34950 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
| AT5G48960 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11) |
| AT1G76770 | HSP20-like chaperone |
| AT3G53040 | late embryogenesis abundant protein, putative / LEA protein;(source:Araport11) |
| AT1G80530 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G12990 | transmembrane protein;(source:Araport11) |
| AT3G25130 | acidic leucine-rich nuclear phosphoprotein 32 family B protein;(source:Araport11) |
| AT5G66250 | kinectin-like protein;(source:Araport11) |
| AT1G52710 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT5G48440 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT5G49430 | WD40/YVTN repeat and Bromo-WDR9-I-like domain-containing protein;(source:Araport11) |
| AT2G02770 | 4-phosphopantetheinyl transferase domain protein;(source:Araport11) |
| AT1G26940 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G30930 | F-box family protein;(source:Araport11) |
| AT3G22250 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G22430 | RNA recognition motif XS domain protein;(source:Araport11) |
| AT5G23490 | hypothetical protein;(source:Araport11) |
| AT1G08710 | F-box protein that is induced in roots by drought stress. |
| AT4G16050 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
| AT5G50350 | hypothetical protein;(source:Araport11) |
| AT4G13130 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G15320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G28910 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT2G44930 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G62580 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT2G15220 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT5G19175 | Encodes a defensin-like (DEFL) family protein. |
| AT5G55670 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G38000 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT4G16024 | hypothetical protein;(source:Araport11) |
| AT4G37100 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G65490 | suppressor-like protein;(source:Araport11) |
| AT1G67920 | hypothetical protein;(source:Araport11) |
| AT5G11830 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT4G09770 | TRAF-like family protein;(source:Araport11) |
| AT1G56415 | Expressed protein;(source:Araport11) |
| AT5G07150 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G72131 | pseudogene of proton-dependent oligopeptide transporter |
| AT3G03405 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G22530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G10750 | FBD domain family;(source:Araport11) |
| AT3G47090 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G56260 | Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase;(source:Araport11) |
| AT2G15840 | pseudogene of hypothetical protein;(source:Araport11) |
| AT1G17910 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G24148 | hypothetical protein;(source:Araport11) |
| AT4G12150 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G54780 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT3G15920 | Phox (PX) domain-containing protein;(source:Araport11) |
| AT2G25510 | transmembrane protein;(source:Araport11) |
| AT1G06260 | Cysteine peptidase,activity detected in leaf and flower. |
| AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
| AT1G12990 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G16580 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G29780 | Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes. |
| AT4G28340 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT3G50050 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G02070 | zinc ion-binding protein;(source:Araport11) |
| AT5G67620 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT2G01010 | rRNA;(source:Araport11) |
| AT1G27330 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
| AT4G21250 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT3G61198 | other_RNA;(source:Araport11) |
| AT1G56700 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
| AT1G51200 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT3G50180 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G11940 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.0e-189 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT2G04495 | transmembrane protein;(source:Araport11) |
| AT1G22040 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G09780 | TRAF-like family protein;(source:Araport11) |
| AT5G63340 | hypothetical protein;(source:Araport11) |
| AT1G03290 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
| AT5G22490 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G16800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G36960 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G56660 | MAEBL domain protein;(source:Araport11) |
| AT1G43680 | nucleic acid-binding/zinc ion-binding protein;(source:Araport11) |
| AT5G48540 | receptor-like protein kinase-related family protein;(source:Araport11) |
| AT5G09760 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G32763 | Encodes a defensin-like (DEFL) family protein. |
| AT3G17080 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G33870 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G30650 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G10175.1);(source:TAIR10) |
| AT2G41342 | hypothetical protein;(source:Araport11) |
| AT2G25355 | PNAS-3-like protein;(source:Araport11) |
| AT3G19660 | hypothetical protein;(source:Araport11) |
| AT1G12190 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G09520 | hypothetical protein;(source:Araport11) |
| AT5G33806 | hypothetical protein;(source:Araport11) |
| AT3G25630 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.8e-20 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G29771 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G59070 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G19473 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT1G63230 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G51450 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT1G19390 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G28260 | Telomerase activating protein Est1;(source:Araport11) |
| AT5G45440 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G13000 | transmembrane protein, putative (DUF707);(source:Araport11) |
| AT1G11470 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G11080 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G28000 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G29725 | pseudogene of HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G60480 | StAR lipid transfer-like protein;(source:Araport11) |
| AT3G52870 | IQ calmodulin-binding motif family protein;(source:Araport11) |
| AT2G10537 | other_RNA;(source:Araport11) |
| AT3G29034 | transmembrane protein;(source:Araport11) |
| AT1G22800 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G34868 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.1e-131 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G56410 | hypothetical protein (DUF3133);(source:Araport11) |
| AT1G14180 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G14878 | other_RNA;(source:Araport11) |
| AT5G38540 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT2G46550 | transmembrane protein;(source:Araport11) |
| AT2G14690 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT1G53366 | hypothetical protein;(source:Araport11) |
| AT2G24510 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G29690 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G41760 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.1e-11 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
| AT1G48070 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G04115 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT4G35720 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT3G10250 | histidine-tRNA ligase;(source:Araport11) |
| AT1G45010 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT5G19970 | GRAS family transcription factor family protein;(source:Araport11) |
| AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
| AT2G01990 | XRI1-like protein;(source:Araport11) |
| AT4G24330 | hypothetical protein (DUF1682);(source:Araport11) |
| AT1G03400 | A single copy gene that encodes a protein with sequence similarity to tomato E8 (ACC oxidase, the last step in ethylene biosynthesis) involved in ethylene synthesis and fruit ripening in tomato. This gene is not induced by ethylene in siliques. The transcript is found in siliques, etiolated seedlings, leaves, stems and flowers. |
| AT4G37950 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT4G21903 | MATE efflux family protein;(source:Araport11) |
| AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G54780 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT1G36970 | transmembrane protein, putative (DUF1985);(source:Araport11) |
| AT2G27650 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT4G03824 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.5e-62 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
| AT4G16190 | Papain family cysteine protease;(source:Araport11) |
| AT3G11120 | Ribosomal protein L41 family;(source:Araport11) |
| AT3G33030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.8e-50 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT4G27660 | hypothetical protein;(source:Araport11) |
| AT2G23330 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT3G59320 | solute carrier family 35 protein (DUF914);(source:Araport11) |
| AT2G17064 | Pseudogene of AT2G17080 |
| AT5G59760 | hypothetical protein (DUF1635);(source:Araport11) |
| AT5G43100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G14210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G59680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G37670 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G58300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G04140 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT4G01925 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G27100 | Actin cross-linking protein;(source:Araport11) |
| AT1G68140 | zinc finger/BTB domain protein, putative (DUF1644);(source:Araport11) |
| AT1G09195 | Ppx-GppA phosphatase;(source:Araport11) |
| AT1G22320 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT1G76994 | hypothetical protein;(source:Araport11) |
| AT3G50130 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G27220 | Frigida-like protein;(source:Araport11) |
| AT2G10950 | BSD domain-containing protein;(source:Araport11) |
| AT1G50130 | pseudogene of ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11) |
| AT5G04235 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.2e-38 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G47740 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT3G42806 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.2e-53 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G60970 | SNARE-like superfamily protein;(source:Araport11) |
| AT2G42955 | F-box/LRR protein;(source:Araport11) |
| AT5G28253 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.2e-60 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G44730 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G50290 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
| AT5G45760 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G08230 | glycine-rich protein;(source:Araport11) |
| AT3G16750 | hypothetical protein;(source:Araport11) |
| AT3G18350 | Plant protein of unknown function (DUF639);(source:TAIR10) |
| AT2G30560 | Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. The current predicted structure is not well supported (T8, one *). The predicted proteins can be found in doi.org/10.1007/s00425-005-0174-z |
| AT1G28400 | GATA zinc finger protein;(source:Araport11) |
| AT1G14600 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G49560 | Putative methyltransferase family protein;(source:Araport11) |
| AT4G10140 | transmembrane protein;(source:Araport11) |
| AT2G40113 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT4G21902 | hypothetical protein;(source:Araport11) |
| AT5G06430 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G19010 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G30840 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT2G28750 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 27%25 identity and 1.8e-07 P-value to GP|14018103|gb|AAK52166.1|AC084831_20|AC084831 putative reverse transcriptase {Oryza sativa};(source:TAIR10) |
| AT2G28080 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G17500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G10970 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G23540 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G16565 | threonyl and alanyl tRNA synthetase second additional domain-containing protein;(source:Araport11) |
| AT4G25620 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
| AT2G44260 | DUF946 family protein (DUF946);(source:Araport11) |
| AT5G02502 | Oligosaccaryltransferase;(source:Araport11) |
| AT2G41810 | imidazolonepropionase (Protein of unknown function, DUF642);(source:Araport11) |
| AT1G61500 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G15270 | glucosyltransferase-like protein;(source:Araport11) |
| AT5G47730 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G33835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.9e-12 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G05400 | hypothetical protein;(source:Araport11) |
| AT3G59570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT1G70450 | Its expression is enriched in root hair cells (compared to non-root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in root hair cells relative to non-root hair cells. |
| AT3G53390 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G40205 | Ribosomal protein L41 family;(source:Araport11) |
| AT3G15700 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G06330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G61345 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT2G31800 | Integrin-linked protein kinase family;(source:Araport11) |
| AT3G52105 | DIS3-exonuclease-like protein;(source:Araport11) |
| AT3G09510 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT3G06868 | vitellogenin-like protein;(source:Araport11) |
| AT2G47200 | hypothetical protein;(source:Araport11) |
| AT5G48620 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT2G22160 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G19100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G05752 | hypothetical protein;(source:Araport11) |
| AT5G65340 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G61770 | J domain protein. The mRNA is cell-to-cell mobile. |
| AT5G32702 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-150 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT1G66450 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G37980 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT2G17043 | hypothetical protein;(source:Araport11) |
| AT3G30281 | Pseudogene of AT1G19260; hAT dimerisation domain-containing protein |
| AT1G13605 | Encodes a defensin-like (DEFL) family protein. |
| AT5G14230 | ankyrin;(source:Araport11) |
| AT5G25600 | putative nucleic-acid protein;(source:Araport11) |
| AT4G29270 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT3G46400 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G21680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G38230 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 8.5e-53 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
| AT5G45170 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G67455 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT5G18310 | ubiquitin hydrolase;(source:Araport11) |
| AT5G25070 | neurofilament light protein;(source:Araport11) |
| AT1G28695 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT5G05090 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G48830 | tRNA nucleotidyltransferase/polyA polymerase family protein;(source:Araport11) |
| AT2G32350 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G27660 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G19160 | transglutaminase family protein;(source:Araport11) |
| AT5G47050 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT3G22920 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G66210 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT1G02460 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G23510 | OBP32pep protein;(source:Araport11) |
| AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
| AT3G13070 | CBS domain-containing protein / transporter associated domain-containing protein;(source:Araport11) |
| AT1G53635 | hypothetical protein;(source:Araport11) |
| AT2G05910 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G59770 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.2e-49 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G25740 | RNA binding Plectin/S10 domain-containing protein;(source:Araport11) |
| AT4G01740 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G52780 | PII, uridylyltransferase (DUF2921);(source:Araport11) |
| AT4G35370 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G26445 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G35710 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT5G37250 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G03510 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT1G75200 | flavodoxin family protein / radical SAM domain-containing protein;(source:Araport11) |
| AT4G35070 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT1G33420 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT3G53270 | Small nuclear RNA activating complex (SNAPc), subunit SNAP43 protein;(source:Araport11) |
| AT5G28696 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.2e-184 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G01310 | hypothetical protein;(source:Araport11) |
| AT2G46940 | fold protein;(source:Araport11) |
| AT1G63220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G41860 | transmembrane protein;(source:Araport11) |
| AT1G32780 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT3G07300 | NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11) |
| AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
| AT1G63205 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT3G61962 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G53080 | D-galactoside/L-rhamnose binding SUEL lectin protein;(source:Araport11) |
| AT4G38550 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT1G67570 | zinc finger CONSTANS-like protein (DUF3537);(source:Araport11) |
| AT5G49680 | Conserved among eukaryotes, similar to Arabidopsis SABRE. The phenotype of the kip/sab double mutant suggests related functions for both genes, however, the KIP protein is mostly required for tip-growth. Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots. |
| AT2G37435 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT4G31660 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT2G31820 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G67000 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G38255 | hypothetical protein (DUF239);(source:Araport11) |
| AT3G03670 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G28900 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-236 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G47970 | nucleolin;(source:Araport11) |
| AT2G42510 | survival motor neuron interacting protein;(source:Araport11) |
| AT4G32970 | BRISC/BRCA1-A complex protein;(source:Araport11) |
| AT3G44150 | Expp1 protein;(source:Araport11) |
| AT2G04680 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G21352 | transmembrane protein;(source:Araport11) |
| AT3G20460 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G18255 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT5G41660 | transmembrane protein;(source:Araport11) |
| AT5G41810 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT5G23460 | hypothetical protein;(source:Araport11) |
| AT4G28088 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT5G51510 | jagunal-like protein;(source:Araport11) |
| AT2G18690 | transmembrane protein;(source:Araport11) |
| AT5G28288 | Encodes a defensin-like (DEFL) family protein. |
| AT3G45030 | Ribosomal protein S10p/S20e family protein;(source:Araport11) |
| AT5G45790 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT2G17070 | hypothetical protein (DUF241);(source:Araport11) |
| AT2G04042 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.0e-26 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G08350 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT4G22754 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT3G17350 | wall-associated receptor kinase carboxy-terminal protein;(source:Araport11) |
| AT5G37130 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT2G15300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G74780 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT3G55677 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G21395 | transmembrane protein;(source:Araport11) |
| AT1G22403 | other_RNA;(source:Araport11) |
| AT4G14610 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G06540 | hypothetical protein;(source:Araport11) |
| AT4G40011 | hypothetical protein;(source:Araport11) |
| AT2G09992 | pseudogene of disease-resistance protein |
| AT3G21390 | Encodes a mitochondrial thiamin diphosphate carrier. |
| AT3G07195 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT2G31990 | Exostosin family protein;(source:Araport11) |
| AT1G04840 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G29000 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G54445 | Encodes a defensin-like (DEFL) family protein. |
| AT4G18660 | delay of germination protein;(source:Araport11) |
| AT2G46380 | extra-large G-like protein, putative (DUF3133);(source:Araport11) |
| AT3G52535 | Natural antisense transcript overlaps with AT3G52540;(source:Araport11) |
| AT3G48510 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT2G44370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G62990 | myelin transcription factor-like protein;(source:Araport11) |
| AT2G21520 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT2G36854 | hypothetical protein;(source:Araport11) |
| AT1G53710 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT4G17280 | Auxin-responsive family protein;(source:Araport11) |
| AT1G17090 | transmembrane protein;(source:Araport11) |
| AT5G51520 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G64685 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-85 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G44910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G47655 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT3G12390 | Nascent polypeptide-associated complex (NAC), alpha subunit family protein;(source:Araport11) |
| AT5G53990 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G35340 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT1G74790 | catalytics;(source:Araport11) |
| AT5G42440 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G01180 | XH/XS domain-containing protein;(source:Araport11) |
| AT5G52410 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
| AT4G37530 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G30187 | pseudogene of no-apical-meristem-associated carboxy-terminal domain protein;(source:Araport11) |
| AT4G10680 | transcription factor IIB (TFIIB) family protein;(source:Araport11) |
| AT2G04046 | Encodes a defensin-like (DEFL) family protein. |
| AT5G28570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G12725.1);(source:TAIR10) |
| AT3G44400 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G11402 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G46620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G52120 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G68330 | membrane-associated kinase regulator;(source:Araport11) |
| AT3G19850 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G14030 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G74290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G27880 | hypothetical protein (DUF1645);(source:Araport11) |
| AT4G03380 | hypothetical protein;(source:Araport11) |
| AT4G17150 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G22060 | contains Pfam profile: PF01657 Domain of unknown function that is usually associated with protein kinase domain Pfam:PF00069, however this protein does not have the protein kinase domain |
| AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT1G59710 | actin cross-linking protein (DUF569);(source:Araport11) |
| AT5G46720 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT5G48657 | defense protein-like protein;(source:Araport11) |
| AT3G26440 | transmembrane protein, putative (DUF707);(source:Araport11) |
| AT3G21080 | ABC transporter-like protein;(source:Araport11) |
| AT1G73655 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G25460 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G00390 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT3G04854 | hypothetical protein;(source:Araport11) |
| AT3G62499 | YTH family protein;(source:Araport11) |
| AT3G07320 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G25770 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G33610 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G43980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G50540 | hypothetical protein;(source:Araport11) |
| AT3G58280 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT3G13590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G04330 | Kunitz family trypsin and protease inhibitor protein;(source:Araport11) |
| AT2G25590 | Plant Tudor-like protein;(source:Araport11) |
| AT1G21370 | transmembrane protein;(source:Araport11) |
| AT1G21010 | PADRE proteinup-regulated after infection by S. sclerotiorun. |
| AT1G20490 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G28894 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-23 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G45220 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G04200 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G60760 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G10605 | methyltransferase;(source:Araport11) |
| AT4G33310 | hypothetical protein;(source:Araport11) |
| AT3G45095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.4e-140 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G44380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G39450 | F-box family protein;(source:Araport11) |
| AT2G19290 | hypothetical protein;(source:Araport11) |
| AT2G47550 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G39540 | Gibberellin-regulated family protein;(source:Araport11) |
| AT1G53633 | hypothetical protein;(source:Araport11) |
| AT5G22390 | FANTASTIC four-like protein (DUF3049);(source:Araport11) |
| AT1G25530 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G30380 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins - Arabidopsis thaliana;(source:TAIR10) |
| AT5G62970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT5G40510 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
| AT4G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G07140 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G28790 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G35370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT3G25990 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G00005 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT5G52030 | TraB family protein;(source:Araport11) |
| AT4G16146 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
| AT1G12380 | hypothetical protein;(source:Araport11) |
| AT1G41840 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-23 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT1G60410 | A paternally expressed imprinted gene. |
| AT3G25400 | dCTP pyrophosphatase-like protein;(source:Araport11) |
| AT3G04360 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G54760 | Translation initiation factor SUI1 family protein;(source:Araport11) |
| AT3G17400 | F-box family protein;(source:Araport11) |
| AT5G12040 | Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein;(source:Araport11) |
| AT3G51330 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G31310 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT5G17960 | Encodes a member of a Cys-rich protein family known as C1-clan proteins, that contains C1_2, C1_3 and ZZ/PHD type C1 domains. Its expression is responsive to phytohormones and is affected by biotic (chitin) and different abiotic (salinity, drought, cold and UV) treatments. |
| AT2G28605 | Encodes a PsbP domain-OEC23 like protein localized in thylakoid (peripheral-lumenal side). |
| AT1G70220 | RNA-processing, Lsm domain-containing protein;(source:Araport11) |
| AT4G10170 | SNARE-like superfamily protein;(source:Araport11) |
| AT1G80280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G20350 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G07820 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT3G46730 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT3G22070 | proline-rich family protein;(source:Araport11) |
| AT3G02060 | DEAD/DEAH box helicase;(source:Araport11) |
| AT5G25860 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G53660 | Nucleotide/sugar transporter family protein |
| AT5G59210 | myosin heavy chain-like protein;(source:Araport11) |
| AT5G51490 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G00580 | COP1-interacting protein-like protein;(source:Araport11) |
| AT2G41550 | Rho termination factor;(source:Araport11) |
| AT4G02830 | hypothetical protein;(source:Araport11) |
| AT3G51340 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G42330 | hypothetical protein;(source:Araport11) |
| AT5G01660 | influenza virus NS1A-binding protein;(source:Araport11) |
| AT4G03480 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G09300 | LisH and RanBPM domains containing protein;(source:Araport11) |
| AT2G45610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G69450 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT1G16930 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G58412 | Encodes a Plant thionin family protein |
| AT1G77810 | Galactosyltransferase family protein;(source:Araport11) |
| AT3G21351 | transmembrane protein;(source:Araport11) |
| AT1G35710 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT5G51800 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G05650 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G05786 | hypothetical protein;(source:Araport11) |
| AT2G31345 | transmembrane protein;(source:Araport11) |
| AT2G22820 | hypothetical protein;(source:Araport11) |
| AT1G64680 | beta-carotene isomerase D27;(source:Araport11) |
| AT5G19875 | transmembrane protein;(source:Araport11) |
| AT5G59990 | CCT motif family protein;(source:Araport11) |
| AT3G23175 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT2G05133 | Pseudogene of AT2G37680 |
| AT2G38970 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G01800 | Ribosome recycling factor;(source:Araport11) |
| AT1G42515 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT5G45570.1);(source:TAIR10) |
| AT2G32470 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G54450 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G42290 | transcription activator-like protein;(source:Araport11) |
| AT1G51823 | hypothetical protein;(source:Araport11) |
| AT1G36070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G40250 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT1G15930 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT5G24450 | Transcription factor IIIC, subunit 5;(source:Araport11) |
| AT4G37483 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G12340 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G71070 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G15390 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT3G43355 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, temporary automated functional assignment;(source:TAIR10) |
| AT5G07380 | hypothetical protein;(source:Araport11) |
| AT2G20280 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT4G37022 | hypothetical protein;(source:Araport11) |
| AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G07190 | transmembrane protein, putative (DUF1985);(source:Araport11) |
| AT2G25910 | 3-5 exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein;(source:Araport11) |
| AT1G66534 | pseudogene of Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT2G40600 | appr-1-p processing enzyme family protein;(source:Araport11) |
| AT3G03440 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G44820 | axoneme-associated protein MST101(2) protein;(source:Araport11) |
| AT1G11145 | hypothetical protein (DUF674);(source:Araport11) |
| AT3G48660 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
| AT2G11640 | transposable_element_gene;(source:Araport11);pseudogene, replication protein A1;(source:TAIR10) |
| AT4G36660 | polyol transporter, putative (DUF1195);(source:Araport11) |
| AT1G05120 | Helicase protein with RING/U-box domain-containing protein;(source:Araport11) |
| AT3G27510 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G27852 | Natural antisense transcript overlaps with AT4G27850 and AT4G27860;(source:Araport11) |
| AT1G71910 | hypothetical protein;(source:Araport11) |
| AT1G68680 | SH3/FCH domain protein;(source:Araport11) |
| AT1G18900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G07510 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42110.1);(source:TAIR10) |
| AT5G11940 | Subtilase family protein;(source:Araport11) |
| AT5G46260 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G47150 | YDG/SRA domain-containing protein;(source:Araport11) |
| AT5G16700 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G38552 | Natural antisense transcript overlaps with AT4G38550;(source:Araport11) |
| AT2G25740 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT2G23200 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G15260 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G06002 | Natural antisense transcript overlaps with AT1G06000;(source:Araport11) |
| AT1G20795 | F-box family protein;(source:Araport11) |
| AT2G45685 | Natural antisense transcript overlaps with AT2G45680;(source:Araport11) |
| AT1G28970 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G79740 | hAT transposon superfamily;(source:Araport11) |
| AT2G33390 | hypothetical protein;(source:Araport11) |
| AT5G38275 | pseudogene of PR5-like receptor kinase;(source:Araport11) |
| AT1G49100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G25850 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G45030 | Translation elongation factor EFG/EF2 protein;(source:Araport11) |
| AT4G18940 | RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11) |
| AT1G16600 | pseudogene of camelliol C synthase 1;(source:Araport11) |
| AT5G28830 | calcium-binding EF hand family protein;(source:Araport11) |
| AT3G23880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G66340 | hypothetical protein;(source:Araport11) |
| AT5G18500 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G07900 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G25451 | Pseudogene of AT5G25440; protein kinase family protein |
| AT5G62890 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT2G05715 | pseudogene of GLU-ADT subunit B;(source:Araport11) |
| AT3G04140 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G67850 | lysine ketoglutarate reductase trans-splicing protein (DUF707);(source:Araport11) |
| AT5G01960 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G25845 | oxysterol-binding 4B-like protein;(source:Araport11) |
| AT1G48210 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G21010 | C2 domain-containing protein. Possible pseudogene of AT2G20990. |
| AT3G53235 | hypothetical protein;(source:Araport11) |
| AT1G52810 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G27520 | cryptic loci regulator;(source:Araport11) |
| AT3G07273 | hypothetical protein;(source:Araport11) |
| AT3G62220 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G10740 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G02320 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G39270 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G15053 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
| AT1G70430 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G72880 | Survival protein SurE-like phosphatase/nucleotidase;(source:Araport11) |
| AT2G04500 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G47530 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G15540 | 2-oxoglutarate-dependent dioxygenase-like protein;(source:Araport11) |
| AT1G62090 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G30335 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 2.2e-129 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT1G77530 | O-methyltransferase family protein;(source:Araport11) |
| AT5G43770 | proline-rich family protein;(source:Araport11) |
| AT2G13170 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-88 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT1G19380 | sugar, putative (DUF1195);(source:Araport11) |
| AT3G05685 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT5G21050 | hyccin;(source:Araport11) |
| AT4G40050 | signal transducer, putative (DUF3550/UPF0682);(source:Araport11) |
| AT2G17680 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT4G34150 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G18640 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G66180 | The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. The mRNA is cell-to-cell mobile. |
| AT1G26100 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
| AT1G77122 | Uncharacterized protein family UPF0090;(source:Araport11) |
| AT1G77780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G11880 | transferases, transferring hexosyl groups;(source:Araport11) |
| AT4G01170 | hypothetical protein;(source:Araport11) |
| AT1G80290 | a member of the Glycosyltransferase Family 64 (according to CAZy Database) |
| AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
| AT2G37820 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G33870 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G15640 | transmembrane protein;(source:Araport11) |
| AT1G65845 | transmembrane protein;(source:Araport11) |
| AT2G07791 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G41170 | F-box family protein;(source:Araport11) |
| AT3G57790 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G29773 | pseudogene of nuclease;(source:Araport11) |
| AT2G10330 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.7e-176 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G15040 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT2G15170 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT5G53050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G33070 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-191 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G24320 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT2G38920 | SPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-like protein;(source:Araport11) |
| AT5G28560 | hypothetical protein;(source:Araport11) |
| AT5G41612 | Natural antisense transcript overlaps with AT5G41610;(source:Araport11) |
| AT1G48640 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G56452 | FBD-like domain family protein;(source:Araport11) |
| AT1G67328 | Natural antisense transcript overlaps with AT1G67330;(source:Araport11) |
| AT5G11970 | ABC family ABC transporter, putative (DUF3511);(source:Araport11) |
| AT1G69980 | structural polyprotein;(source:Araport11) |
| AT5G01350 | UvrABC system C protein;(source:Araport11) |
| AT5G01732 | Natural antisense transcript overlaps with AT5G01730;(source:Araport11) |
| AT5G07322 | other_RNA;(source:Araport11) |
| AT3G63450 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G62410 | MIF4G domain-containing protein;(source:Araport11) |
| AT2G22510 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G22780 | Adaptor protein complex AP-2, alpha subunit;(source:Araport11) |
| AT2G32220 | Ribosomal L27e protein family;(source:Araport11) |
| AT3G19430 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
| AT1G05136 | hypothetical protein;(source:Araport11) |
| AT1G59865 | transmembrane protein;(source:Araport11) |
| AT4G18460 | D-Tyr-tRNA(Tyr) deacylase family protein;(source:Araport11) |
| AT4G04745 | hypothetical protein;(source:Araport11) |
| AT3G15650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT2G16270 | transmembrane protein;(source:Araport11) |
| AT2G40050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G58225 | hypothetical protein;(source:Araport11) |
| AT4G31985 | Ribosomal protein L39 family protein;(source:Araport11) |
| AT4G10720 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G73650 | 3-oxo-5-alpha-steroid 4-dehydrogenase (DUF1295);(source:Araport11) |
| AT5G17340 | Putative membrane lipoprotein;(source:Araport11) |
| AT1G36600 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.9e-21 P-value blast match to gb|AAG52950.1| putative envelope protein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G51920 | transmembrane protein;(source:Araport11) |
| AT1G33850 | Ribosomal protein S19 family protein;(source:Araport11) |
| AT1G05291 | GPI inositol-deacylase C, putative (DUF1218);(source:Araport11) |
| AT1G18871 | hypothetical protein;(source:Araport11) |
| AT1G23350 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G47965 | hypothetical protein;(source:Araport11) |
| AT1G44770 | elongation factor;(source:Araport11) |
| AT3G53840 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G62250 | orotidine 5-phosphate decarboxylase;(source:Araport11) |
| AT2G01050 | zinc ion binding / nucleic acid binding protein;(source:Araport11) |
| AT3G32047 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT5G38310 | hypothetical protein;(source:Araport11) |
| AT5G01130 | hypothetical protein (DUF674);(source:Araport11) |
| AT2G23360 | filament-like protein (DUF869);(source:Araport11) |
| AT5G28623 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G44570.1);(source:TAIR10) |
| AT3G15250 | TPRXL;(source:Araport11) |
| AT3G41979 | 5.8SrRNA |
| AT2G37980 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G62200 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT5G03110 | protamine P1 family protein;(source:Araport11) |
| AT2G02680 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G29179 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
| AT4G02340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G44757 | pseudogene of transmembrane protein;(source:Araport11) |
| AT3G01175 | transmembrane protein;(source:Araport11) |
| AT5G52450 | MATE efflux family protein;(source:Araport11) |
| AT2G38260 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G23840 | transmembrane protein;(source:Araport11) |
| AT5G67510 | Translation protein SH3-like family protein;(source:Araport11) |
| AT2G30650 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT4G00560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G07160 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G24065 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G48655 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G48440 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G01510 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G05390 | S-adenosyl-L-methionine-dependent methyltransferase;(source:Araport11) |
| AT1G55980 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT2G20635 | protein kinase and Mad3-BUB1-I domain-containing protein;(source:Araport11) |
| AT4G06585 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.8e-06 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G67290 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT4G14290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G18815 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT3G52920 | transcriptional activator (DUF662);(source:Araport11) |
| AT1G65850 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G01930 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G19590 | DUF538 family protein (Protein of unknown function, DUF538);(source:Araport11) |
| AT4G27360 | Dynein light chain type 1 family protein;(source:Araport11) |
| AT5G58420 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT5G08670 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
| AT4G27020 | inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11) |
| AT5G49040 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT2G13469 | pseudogene of putative nucleic-acid protein;(source:Araport11) |
| AT5G62130 | Per1-like family protein;(source:Araport11) |
| AT4G19930 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G44220 | NEP-interacting protein (DUF239);(source:Araport11) |
| AT4G03300 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G27780.1);(source:TAIR10) |
| AT5G10130 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G64640 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G37220 | Encodes a chloroplast RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT3G54270 | sucrose-6F-phosphate phosphohydrolase family protein;(source:Araport11) |
| AT1G10400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G03700 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT4G31650 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT4G18250 | receptor Serine/Threonine kinase-like protein;(source:Araport11) |
| AT2G44390 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G45238 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT4G19440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G62640 | DUF3511 domain protein (DUF3511);(source:Araport11) |
| AT5G46080 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G62780 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G77550 | tubulin-tyrosine ligase;(source:Araport11) |
| AT3G01730 | Mutants exhibit shorter root hairs under phosphate-deficient conditions. |
| AT4G05060 | PapD-like superfamily protein;(source:Araport11) |
| AT5G67050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G46840 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G73160 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G29075 | glycine-rich protein;(source:Araport11) |
| AT2G30190 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT3G49300 | proline-rich family protein;(source:Araport11) |
| AT4G24160 | Encodes a soluble lysophosphatidic acid acyltransferase with additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. Plays a pivotal role in maintaining the lipid homeostasis by regulating both phospholipid and neutral lipid levels. |
| AT4G28420 | Tyrosine transaminase family protein;(source:Araport11) |
| AT1G78250 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT4G09690 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
| AT5G40981 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G58920 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G04500 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G35540 | transmembrane protein;(source:Araport11) |
| AT3G28850 | Glutaredoxin family protein;(source:Araport11) |
| AT3G03500 | TatD related DNase;(source:Araport11) |
| AT4G24290 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT2G06822 | Pseudogene of AT2G06822 |
| AT2G11135 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G04273.1);(source:TAIR10) |
| AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT1G52100 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G56960 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
| AT5G48175 | transmembrane protein;(source:Araport11) |
| AT4G01870 | tolB protein-like protein;(source:Araport11) |
| AT5G39532 | Pseudogene of AT3G59455 |
| AT1G73860 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G21020 | pseudogene of NOD26-like intrinsic protein 3;(source:Araport11) |
| AT1G44160 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT1G15620 | transmembrane protein;(source:Araport11) |
| AT2G43180 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT3G46350 | LRR receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT2G43300 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
| AT4G14060 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G27310 | F-box family protein;(source:Araport11) |
| AT5G51580 | hypothetical protein;(source:Araport11) |
| AT3G61010 | Ferritin/ribonucleotide reductase-like family protein;(source:Araport11) |
| AT1G15450 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT2G24040 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT5G48140 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G04830 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT1G67410 | Exostosin family protein;(source:Araport11) |
| AT5G42955 | inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (DUF784);(source:Araport11) |
| AT2G38250 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G55928 | nuclear speckle splicing regulatory-like protein (DUF2040);(source:Araport11) |
| AT4G12870 | Gamma interferon responsive lysosomal thiol (GILT) reductase family protein;(source:Araport11) |
| AT5G06480 | Immunoglobulin E-set superfamily protein;(source:Araport11) |
| AT4G16155 | dihydrolipoamide dehydrogenase;(source:Araport11) |
| AT3G21450 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G27250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G57310 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT2G41470 | agamous-like MADS-box protein;(source:Araport11) |
| AT3G44970 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT5G57120 | nucleolar/coiled-body phosphoprotein;(source:Araport11) |
| AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G49390 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G05730 | Encodes a defensin-like (DEFL) family protein. The mRNA is cell-to-cell mobile. |
| AT2G21905 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
| AT5G17165 | hypothetical protein;(source:Araport11) |
| AT3G19970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G49400 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G51350 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G01670 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G61420 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G17930 | MIF4G domain-containing protein / MA3 domain-containing protein;(source:Araport11) |
| AT1G26200 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT5G34832 | pseudogene of hypothetical protein;(source:Araport11) |
| AT5G24190 | Lipase class 3-related protein;(source:Araport11) |
| AT5G57100 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT1G54820 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G57535 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G49770 | Leucine rich receptor kinase. |
| AT2G18560 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G09665 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT3G45638 | other_RNA;(source:Araport11) |
| AT2G41178 | Natural antisense transcript overlaps with AT2G41180;(source:Araport11) |
| AT5G42250 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT4G16030 | Ribosomal protein L19e family protein;(source:Araport11) |
| AT5G64460 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT1G12030 | phosphoenolpyruvate carboxylase, putative (DUF506);(source:Araport11) |
| AT3G16555 | F-box and associated interaction domains-containing protein;(source:Araport11).SON1 paralog. |
| AT2G13740 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G24644 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G60710 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT4G27270 | Quinone reductase family protein;(source:Araport11) |
| AT1G20310 | syringolide-induced protein;(source:Araport11) |
| AT2G25220 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G61610 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT5G64735 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT3G51250 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT1G18335 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G79240 | pre-tRNA tRNA-Arg (anticodon: CCG);(source:Araport11, TAIR10) |
| AT5G20260 | Exostosin family protein;(source:Araport11) |
| AT4G28800 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G56470 | pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G09735 | S1FA-like DNA-binding protein;(source:Araport11) |
| AT3G33187 | Encodes a defensin-like (DEFL) family protein. |
| AT5G66580 | PADRE protein. |
| AT4G30640 | RNI-like superfamily protein;(source:Araport11) |
| AT1G63835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-17 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT4G12750 | Homeodomain-like transcriptional regulator;(source:Araport11) |
| AT4G03965 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G55870 | ADC synthase superfamily protein;(source:Araport11) |
| AT2G29065 | GRAS family transcription factor;(source:Araport11) |
| AT1G09400 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT5G11225 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT5G24620 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT2G04070 | Expression in rosette leaves is activated by high concentration of boron. |
| AT1G22330 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G47370 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT5G60530 | Root tip expressed LEA protein involved in ribosome biogenesis. |
| AT2G02730 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
| AT4G32870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT5G44990 | Glutathione S-transferase family protein;(source:Araport11) |
| AT4G05170 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G22280 | peptidyl-prolyl cis-trans isomerase G;(source:Araport11) |
| AT1G10040 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G58520 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G70160 | zinc finger MYND domain protein;(source:Araport11) |
| AT5G54710 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G30490 | craniofacial development-like protein;(source:Araport11) |
| AT5G16170 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G20550 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G23570 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G36197 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT4G11550 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G38700 | cotton fiber protein;(source:Araport11) |
| AT1G49000 | transmembrane protein;(source:Araport11) |
| AT4G15260 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G28390 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G13965 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G59780 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT2G35470 | ribosome maturation factor;(source:Araport11) |
| AT5G41330 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
| AT2G03955 | Encodes a defensin-like (DEFL) family protein. |
| AT2G04860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G54480 | hypothetical protein (DUF630 and DUF632);(source:Araport11) |
| AT5G61370 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G07155 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.9e-17 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT1G30060 | COP1-interacting protein-like protein;(source:Araport11) |
| AT1G14260 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT4G39420 | spatacsin carboxy-terminus protein;(source:Araport11) |
| AT2G26970 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G58037 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G00955 | wall-associated receptor kinase-like protein;(source:Araport11) |
| AT1G52700 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G13940 | aminopeptidase;(source:Araport11) |
| AT1G56480 | pseudogene of Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G44205 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.5e-40 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT1G32190 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G09490 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G45730 | hypothetical protein;(source:Araport11) |
| AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G26510 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G21340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G25530 | AFG1-like ATPase family protein;(source:Araport11) |
| AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT3G04970 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G42910 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT5G28250.1);(source:TAIR10) |
| AT3G13950 | ankyrin;(source:Araport11) |
| AT4G14370 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G14010 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT3G50710 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G28510 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G35545 | Natural antisense transcript overlaps with AT1G35550 and AT1G35540;(source:Araport11) |
| AT1G60830 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G10950 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT3G50170 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G21810 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G11220 | cotton fiber, putative (DUF761);(source:Araport11) |
| AT1G12590 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT3G26950 | transmembrane protein;(source:Araport11) |
| AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G37480 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G72190 | D-isomer specific 2-hydroxyacid dehydrogenase family protein;(source:Araport11) |
| AT3G60520 | zinc ion-binding protein;(source:Araport11) |
| AT1G71350 | eukaryotic translation initiation factor SUI1 family protein;(source:Araport11) |
| AT5G44375 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT5G62865 | hypothetical protein;(source:Araport11) |
| AT3G06620 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
| AT1G55440 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G04220 | Target of miR825/825. Mutants have decreased resistance to fungal pathogens. |
| AT3G53960 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G25020 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT4G32640 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT1G55930 | CBS domain-containing protein / transporter associated domain-containing protein;(source:Araport11) |
| AT4G00500 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G07080 | Thioredoxin superfamily protein;(source:Araport11) |
| AT3G43352 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-09 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G33760 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G08050 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G51560 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G51980 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G02700 | NC domain-containing protein-like protein;(source:Araport11) |
| AT5G47980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G15110 | Pectate lyase family protein;(source:Araport11) |
| AT1G64910 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G07475 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to En/Spm-like transposon protein;(source:TAIR10) |
| AT3G10415 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT3G57400 | transmembrane protein;(source:Araport11) |
| AT5G57340 | ras guanine nucleotide exchange factor Q-like protein;(source:Araport11) |
| AT3G09960 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT4G08395 | hypothetical protein;(source:Araport11) |
| AT2G02960 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT4G06503 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.2e-53 P-value blast match to O22273 /233-373 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT3G32023 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.7e-54 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G33590 | transmembrane protein;(source:Araport11) |
| AT2G37830 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167. |
| AT2G39950 | flocculation protein;(source:Araport11) |
| AT3G27999 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G48625 | pseudogene of F-box family protein |
| AT1G03660 | Ankyrin-repeat containing protein;(source:Araport11) |
| AT5G41765 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT3G10950 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
| AT1G66880 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G53330 | encodes a member of the pentatricopeptide repeat (PPR) gene family. T-DNA insertion mutants had a complex phenotypic expression, ranging from embryo lethal to seedling lethal, to just subtle changes. |
| AT5G11242 | pseudogene of ribosomal protein |
| AT3G60730 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G45443 | hypothetical protein;(source:Araport11) |
| AT5G39370 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT3G15760 | cytochrome P450 family protein;(source:Araport11) |
| AT4G00420 | Double-stranded RNA-binding domain (DsRBD)-containing protein;(source:Araport11) |
| AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT5G08180 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT3G50640 | hypothetical protein;(source:Araport11) |
| AT2G23820 | Metal-dependent phosphohydrolase;(source:Araport11) |
| AT5G05230 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G17490 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G78780 | pathogenesis-related family protein;(source:Araport11) |
| AT3G29240 | PPR containing protein (DUF179);(source:Araport11) |
| AT1G14940 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G67310 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain;(source:Araport11) |
| AT2G35859 | Natural antisense transcript overlaps with AT2G35860;(source:Araport11) |
| AT3G21770 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G12870 | transmembrane protein;(source:Araport11) |
| AT5G40860 | transmembrane protein;(source:Araport11) |
| AT2G07704 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.8e-50 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G46325 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT1G77145 | transmembrane protein, putative (DUF506);(source:Araport11) |
| AT3G06520 | agenet domain-containing protein;(source:Araport11) |
| AT4G08691 | hypothetical protein;(source:Araport11) |
| AT3G42916 | transposable_element_gene;(source:Araport11);transposon protein -related, temporary automated functional assignment;(source:TAIR10) |
| AT4G24530 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G57480 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G10430 | TMPIT-like protein;(source:Araport11) |
| AT1G15800 | hypothetical protein;(source:Araport11) |
| AT5G58520 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G43800 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G61670 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT1G34392 | other_RNA;(source:Araport11) |
| AT3G21620 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT5G33330 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G34500 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G14780 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT3G01830 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G50805 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT4G22066 | Pseudogene of AT5G66830; F-box family protein |
| AT4G38300 | glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT2G17723 | Encodes a defensin-like (DEFL) family protein. |
| AT2G37160 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G56720 | pre-mRNA-splicing factor;(source:Araport11) |
| AT3G49610 | B3 domain protein (DUF313);(source:Araport11) |
| AT2G37780 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G26805 | B3 domain protein;(source:Araport11) |
| AT1G55535 | transmembrane protein;(source:Araport11) |
| AT3G45770 | Polyketide synthase, enoylreductase family protein;(source:Araport11) |
| AT2G29628 | hypothetical protein;(source:Araport11) |
| AT3G50650 | GRAS family transcription factor;(source:Araport11) |
| AT4G33865 | Ribosomal protein S14p/S29e family protein;(source:Araport11) |
| AT1G16500 | filamentous hemagglutinin transporter;(source:Araport11) |
| AT4G31230 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G51610 | Cation efflux family protein;(source:Araport11) |
| AT3G18840 | LOW protein: PPR containing-like protein;(source:Araport11) |
| AT5G62770 | membrane-associated kinase regulator, putative (DUF1645);(source:Araport11) |
| AT4G13760 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G36370 | hypothetical protein;(source:Araport11) |
| AT4G03505 | hypothetical protein;(source:Araport11) |
| AT5G54220 | Encodes a defensin-like (DEFL) family protein. |
| AT4G32140 | EamA-like transporter family;(source:Araport11) |
| AT1G74840 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G31520 | hypothetical protein;(source:Araport11) |
| AT2G01023 | hypothetical protein;(source:Araport11) |
| AT5G21080 | Uncharacterized protein;(source:Araport11) |
| AT1G74457 | Pseudogene of AT1G18750; AGL65; DNA binding / transcription factor |
| AT3G32455 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-24 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G03795 | Exostosin family protein;(source:Araport11) |
| AT3G27321 | Pseudogene of AT1G08985; DNA-binding protein |
| AT3G20370 | TRAF-like family protein;(source:Araport11) |
| AT1G07728 | Natural antisense transcript overlaps with AT1G07725;(source:Araport11) |
| AT5G06125 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT5G39770 | Represents a non-function pseudogene homologous to AtMSU81 (At4g30870). |
| AT1G08165 | hypothetical protein;(source:Araport11) |
| AT3G01870 | hypothetical protein (DUF946);(source:Araport11) |
| AT5G03377 | pseudogene of acylphosphatase family protein |
| AT3G07620 | glycosyltransferase;(source:Araport11) |
| AT5G14050 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G69860 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G72690 | neurofilament heavy protein;(source:Araport11) |
| AT1G48330 | SsrA-binding protein;(source:Araport11) |
| AT5G62150 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT4G22214 | Encodes a defensin-like (DEFL) family protein. |
| AT3G23190 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT3G56550 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G57760 | hypothetical protein;(source:Araport11) |
| AT5G11500 | coiled-coil protein;(source:Araport11) |
| AT2G39640 | glycosyl hydrolase family 17 protein;(source:Araport11) |
| AT5G16980 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT3G43980 | Ribosomal protein S14p/S29e family protein;(source:Araport11) |
| AT2G04580 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT4G04320 | malonyl-CoA decarboxylase family protein;(source:Araport11) |
| AT3G05425 | hypothetical protein;(source:Araport11) |
| AT1G17145 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G06640 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
| AT4G05040 | ankyrin repeat family protein;(source:Araport11) |
| AT1G23610 | hypothetical protein;(source:Araport11) |
| AT1G15885 | hypothetical protein;(source:Araport11) |
| AT4G14390 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G08275 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-99 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G72175 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232);(source:Araport11) |
| AT5G38910 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G13677 | hypothetical protein;(source:Araport11) |
| AT1G80400 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G08460 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G56030 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G29550 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.4e-126 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G70970 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G05190 | pseudogene of cytochrome P450;(source:Araport11) |
| AT3G45990 | Cofilin/tropomyosin-type actin-binding protein family;(source:Araport11) |
| AT1G09880 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT3G54740 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G20120 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G17760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G20040 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G28560 | BCS1 AAA-type ATPase;(source:Araport11) |
| AT4G21360 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G32050 | hypothetical protein;(source:Araport11) |
| AT1G49870 | myosin-2 heavy chain-like protein;(source:Araport11) |
| AT1G62870 | hypothetical protein;(source:Araport11) |
| AT1G12244 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT2G26360 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G50835 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT2G24160 | pseudogene of receptor like protein 37;(source:Araport11) |
| AT1G52330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G01370 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT2G25305 | Encodes a defensin-like (DEFL) family protein. |
| AT4G17700 | hypothetical protein;(source:Araport11) |
| AT2G19910 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT4G36500 | hypothetical protein;(source:Araport11) |
| AT3G23530 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G43146 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.9e-55 P-value blast match to Q9ZQM3 /24-192 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G05025 | Encodes a Pollen Ole e I allergen and extensin family protein [pseudogene] |
| AT5G58110 | chaperone binding / ATPase activator;(source:Araport11) |
| AT3G50040 | hypothetical protein;(source:Araport11) |
| AT5G55430 | hypothetical protein;(source:Araport11) |
| AT2G28490 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G14980 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G59765 | None;(source:Araport11) |
| AT5G34800 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins - Arabidopsis thaliana;(source:TAIR10) |
| AT4G31200 | SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11) |
| AT4G27190 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT5G38320 | hypothetical protein;(source:Araport11) |
| AT5G50890 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G09750 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G67350 | hypothetical protein;(source:Araport11) |
| AT1G14170 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT3G13210 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
| AT2G28990 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G15870 | glycosyl hydrolase family 81 protein;(source:Araport11) |
| AT3G06750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G20450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G44760 | dihydroorotate dehydrogenase (DUF3598);(source:Araport11) |
| AT1G19240 | transmembrane protein;(source:Araport11) |
| AT1G03890 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G67865 | hypothetical protein;(source:Araport11) |
| AT3G60410 | hypothetical protein (DUF1639);(source:Araport11) |
| AT1G77270 | hypothetical protein;(source:Araport11) |
| AT4G14226 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G62420 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT3G05755 | pre-tRNA tRNA-Pro (anticodon: CGG);(source:Araport11, TAIR10) |
| AT1G31274 | Pseudogene of AT5G26622; beta-galactosidase |
| AT2G31335 | hypothetical protein;(source:Araport11) |
| AT1G65550 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G01355 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT2G40260 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G38140 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 9.2e-38 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G34300 | lectin protein kinase family protein;(source:Araport11) |
| AT1G28840 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT2G37320 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G27970 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G64405 | hypothetical protein;(source:Araport11) |
| AT5G22610 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G51810 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G22415 | hypothetical protein;(source:Araport11) |
| AT3G10720 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G58420 | TRAF-like superfamily protein;(source:Araport11) |
| AT1G08210 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G55590 | RNI-like superfamily protein;(source:Araport11) |
| AT3G58240 | TRAF-like superfamily protein;(source:Araport11) |
| AT4G32510 | HCO3- transporter family;(source:Araport11) |
| AT1G19000 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G47490 | HNH endonuclease;(source:Araport11) |
| AT5G37474 | Encodes a defensin-like (DEFL) family protein. |
| AT2G01130 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G62270 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G52565 | cytochrome P450 family protein;(source:Araport11) |
| AT5G35930 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT3G29785 | Pol-like polyprotein/retrotransposon;(source:Araport11) |
| AT1G28250 | transmembrane protein;(source:Araport11) |
| AT1G24440 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G38905 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT1G07175 | alternative NAD(P)H dehydrogenase;(source:Araport11) |
| AT1G30925 | F-box/associated interaction domain protein;(source:Araport11) |
| AT2G19806 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.2e-19 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
| AT2G08986 | hypothetical protein;(source:Araport11) |
| AT4G02405 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G04985 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G78060 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G47830 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G26850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G77650 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G48420 | hypothetical protein;(source:Araport11) |
| AT5G59170 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT1G47860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G45960 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G51990 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G13080 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.7e-183 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
| AT5G34854 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-96 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G04730 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
| AT2G47720 | hypothetical protein;(source:Araport11) |
| AT4G09425 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.0e-309 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G21880 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G06400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G01570 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT3G09110 | hypothetical protein (DUF674);(source:Araport11) |
| AT4G03440 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G33118 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G22580 | Exostosin family protein;(source:Araport11) |
| AT4G21420 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.9e-06 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT5G37072 | pseudogene of Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT1G74280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G26550 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
| AT4G28440 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT2G11170 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G18480 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G32460 | hypothetical protein;(source:Araport11) |
| AT2G24370 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT2G13910 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G55646 | TPRXL;(source:Araport11) |
| AT4G32860 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT5G20790 | transmembrane protein;(source:Araport11) |
| AT3G60286 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G33550 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G51940 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
| AT3G44100 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
| AT2G22220 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT4G21720 | defensin-like protein;(source:Araport11) |
| AT5G27900 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-26 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G49340 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G13550 | hypothetical protein (DUF1262);(source:Araport11) |
| AT3G20360 | TRAF-like family protein;(source:Araport11) |
| AT5G20050 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G66490 | hypothetical protein;(source:Araport11) |
| AT5G24180 | Lipase class 3-related protein;(source:Araport11) |
| AT3G28480 | Oxoglutarate/iron-dependent oxygenase;(source:Araport11) |
| AT3G60700 | hypothetical protein (DUF1163);(source:Araport11) |
| AT5G22700 | LOW protein: F-box/FBD/LRR-like protein;(source:Araport11) |
| AT1G13485 | hypothetical protein;(source:Araport11) |
| AT1G17450 | B-block binding subunit of TFIIIC;(source:Araport11) |
| AT1G02610 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G38680 | 5-nucleotidase / magnesium ion binding protein;(source:Araport11) |
| AT4G06490 | hypothetical protein (DUF3287);(source:Araport11) |
| AT1G03010 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT2G25310 | ER membrane protein complex subunit-like protein (DUF2012);(source:Araport11) |
| AT5G53592 | FBD-like domain family protein;(source:Araport11) |
| AT1G05370 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT2G31215 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G06210 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G61810 | Glycosyl hydrolase family 17 protein;(source:Araport11) |
| AT5G44970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT5G07790 | hypothetical protein;(source:Araport11) |
| AT2G05550 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.6e-37 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G29170 | transmembrane protein (DUF872);(source:Araport11) |
| AT4G31100 | wall-associated kinase;(source:Araport11) |
| AT1G70740 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G24470 | filament-like protein (DUF869);(source:Araport11) |
| AT1G71210 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G70420 | DNA ligase-like protein, putative (DUF1645);(source:Araport11) |
| AT3G29152 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT3G17140 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G30020 | PA-domain containing subtilase family protein;(source:Araport11) |
| AT3G48020 | hypothetical protein;(source:Araport11) |
| AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G55450 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G30733 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
| AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
| AT2G12720 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.6e-66 P-value blast match to O22273 /233-373 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT3G61270 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT2G02630 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G33360 | Encodes ClpX3, a subunit of the Clp protease complex. |
| AT5G23170 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G29260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G73350 | ankyrin repeat protein;(source:Araport11) |
| AT4G32560 | paramyosin-like protein;(source:Araport11) |
| AT1G20100 | DNA ligase-like protein;(source:Araport11) |
| AT5G24230 | Lipase class 3-related protein;(source:Araport11) |
| AT2G37730 | glycosyltransferase (DUF604);(source:Araport11) |
| AT5G15000 | Encodes a ECA1 gametogenesis related family protein |
| AT5G13620 | hypothetical protein;(source:Araport11) |
| AT2G07740 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / zinc ion binding [Arabidopsis thaliana] (TAIR:AT2G01050.1);(source:TAIR10) |
| AT2G03810 | 18S pre-ribosomal assembly protein gar2-like protein;(source:Araport11) |
| AT2G02520 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G02490 | hypothetical protein;(source:Araport11) |
| AT3G25680 | SLH domain protein;(source:Araport11) |
| AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
| AT1G30750 | TPRXL;(source:Araport11) |
| AT5G54700 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G35777 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-67 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G44680 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT4G31410 | E3 ubiquitin-protein ligase, putative (DUF1644);(source:Araport11) |
| AT2G23690 | PADRE protein. |
| AT1G55100 | transposable_element_gene;(source:Araport11);pseudogene, putative ATP synthase beta subunit;(source:TAIR10) |
| AT2G42060 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G05845 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.3e-45 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT3G48630 | hypothetical protein;(source:Araport11) |
| AT3G30859 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.6e-42 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G43895 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT4G31760 | peroxidase superfamily protein;(source:Araport11) |
| AT2G07455 | transposable_element_gene;(source:Araport11);Athila retroelement ORF1 protein -related, temporary automated functional assignment;(source:TAIR10) |
| AT1G69050 | hypothetical protein;(source:Araport11) |
| AT4G26255 | other_RNA;(source:Araport11) |
| AT5G57500 | Galactosyltransferase family protein;(source:Araport11) |
| AT4G09875 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT4G38030 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT2G24165 | pseudogene of receptor like protein 30;(source:Araport11) |
| AT3G17780 | B-cell receptor-associated-like protein;(source:Araport11) |
| AT1G78330 | pseudogene of Trimeric LpxA-like enzymes superfamily protein;(source:Araport11) |
| AT5G23520 | smr (Small MutS Related) domain-containing protein;(source:Araport11) |
| AT1G49900 | C2H2 type zinc finger transcription factor family;(source:Araport11) |
| AT1G69350 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G25886 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G14770.2);(source:TAIR10) |
| AT2G37690 | phosphoribosylaminoimidazole carboxylase, putative / AIR carboxylase;(source:Araport11) |
| AT4G33550 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G12502 | Natural antisense transcript overlaps with AT3G12500;(source:Araport11) |
| AT5G12880 | proline-rich family protein;(source:Araport11) |
| AT3G13650 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT5G41300 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT1G76120 | Pseudouridine synthase family protein;(source:Araport11) |
| AT1G66710 | pseudogene of S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G47160 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G00356 | Encodes a defensin-like (DEFL) family protein. |
| AT3G62110 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G04540 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G07360 | Amidase family protein;(source:Araport11) |
| AT4G14920 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger protein;(source:Araport11) |
| AT2G37800 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
| AT1G51230 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G48860 | hypothetical protein;(source:Araport11) |
| AT3G55790 | transmembrane protein;(source:Araport11) |
| AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
| AT5G51380 | RNI-like superfamily protein;(source:Araport11) |
| AT3G45400 | exostosin family protein;(source:Araport11) |
| AT4G01780 | XH/XS domain-containing protein;(source:Araport11) |
| AT3G09060 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G03620 | ELMO/CED-12 family protein;(source:Araport11) |
| AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G23760 | Cox19-like CHCH family protein;(source:Araport11) |
| AT2G03580 | F-box family protein-like protein;(source:Araport11) |
| AT1G32172 | other_RNA;(source:Araport11) |
| AT3G15710 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
| AT4G03140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G04515 | transmembrane protein;(source:Araport11) |
| AT3G32475 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G21970 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
| AT4G11000 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G26930 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G10770 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G22980 | molybdenum cofactor sulfurase-like protein;(source:Araport11) |
| AT4G29310 | DUF1005 family protein (DUF1005);(source:Araport11) |
| AT1G66310 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G02620 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G21680 | DPP6 N-terminal domain-like protein;(source:Araport11) |
| AT5G13590 | hypothetical protein;(source:Araport11) |
| AT1G17277 | transposable_element_gene;(source:Araport11);similar to zinc ion binding [Arabidopsis thaliana] (TAIR:AT1G78355.1);(source:TAIR10) |
| AT4G15740 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G01810 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
| AT2G40020 | Nucleolar histone methyltransferase-related protein;(source:Araport11) |
| AT3G04960 | trichohyalin, putative (DUF3444);(source:Araport11) |
| AT1G30780 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G20155 | hypothetical protein;(source:Araport11) |
| AT3G43955 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G30910 | Molybdenum cofactor sulfurase family protein;(source:Araport11) |
| AT3G50340 | hypothetical protein;(source:Araport11) |
| AT2G17000 | Mechanosensitive ion channel family protein;(source:Araport11) |
| AT3G49050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G20340 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT2G04100 | MATE efflux family protein;(source:Araport11) |
| AT4G16630 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT5G23413 | pseudogene of HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
| AT4G01335 | TATA box-binding protein associated factor RNA polymerase I subunit B-like protein;(source:Araport11) |
| AT4G23680 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G01790 | TRAF-like family protein;(source:Araport11) |
| AT4G11630 | Ribosomal protein L19 family protein;(source:Araport11) |
| AT1G32160 | beta-casein (DUF760);(source:Araport11) |
| AT3G14240 | Subtilase family protein;(source:Araport11) |
| AT5G25920 | hypothetical protein;(source:Araport11) |
| AT4G06692 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.8e-160 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G48650 | pseudogene of pectinesterase;(source:Araport11) |
| AT5G27020 | hypothetical protein;(source:Araport11) |
| AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
| AT1G45760 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-37 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G11790 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
| AT5G24260 | prolyl oligopeptidase family protein;(source:Araport11) |
| AT5G57210 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G40070 | MADS-box family protein;(source:Araport11) |
| AT1G20740 | transport/golgi organization-like protein (DUF833);(source:Araport11) |
| AT4G17590 | NOL1/NOP2/sun family protein;(source:Araport11) |
| AT3G60780 | hypothetical protein (DUF1442);(source:Araport11) |
| AT5G20030 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
| AT3G24530 | AAA-type ATPase family protein / ankyrin repeat family protein;(source:Araport11) |
| AT4G29735 | transmembrane protein;(source:Araport11) |
| AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G49110 | fanconi anemia group I-like protein;(source:Araport11) |
| AT1G45242 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G05400 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G07840 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi|2443320|dbj|BAA22288.1| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10) |
| AT4G40045 | transmembrane protein;(source:Araport11) |
| AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT4G26830 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G31290 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT3G21965 | pseudogene of Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT5G45000 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G02890 | AAA-type ATPase family protein;(source:Araport11) |
| AT2G39430 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT5G02660 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11) |
| AT1G02990 | hypothetical protein;(source:Araport11) |
| AT1G19860 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G51870 | protein kinase family protein;(source:Araport11) |
| AT3G12950 | Trypsin family protein;(source:Araport11) |
| AT3G19370 | filament-like protein (DUF869);(source:Araport11) |
| AT1G13380 | sodium/hydrogen exchanger (DUF1218);(source:Araport11) |
| AT5G39800 | Mitochondrial ribosomal protein L27;(source:Araport11) |
| AT2G24880 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G52510 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G74330 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G15715 | Proteinase inhibitor I25, cystatin, conserved region;(source:Araport11) |
| AT5G40290 | HD domain-containing metal-dependent phosphohydrolase family protein;(source:Araport11) |
| AT4G35120 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G21060 | Glyceraldehyde-3-phosphate dehydrogenase-like family protein;(source:Araport11) |
| AT5G28890 | transposable_element_gene;(source:Araport11);similar to DNA binding [Arabidopsis thaliana] (TAIR:AT4G01980.1);(source:TAIR10) |
| AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G13495 | other_RNA;(source:Araport11) |
| AT1G53550 | F-box family protein;(source:Araport11) |
| AT1G03740 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G21850 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G62760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G30340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G33817 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-100 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G63840 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G02610 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G44770 | ELMO/CED-12 family protein;(source:Araport11) |
| AT3G30610 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G12685.1);(source:TAIR10) |
| AT1G50380 | Prolyl oligopeptidase family protein;(source:Araport11) |
| AT2G22460 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT5G55132 | Encodes a defensin-like (DEFL) family protein. |
| AT3G62380 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT3G56870 | hypothetical protein;(source:Araport11) |
| AT1G32890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-37 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT4G06560 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G06135 | transmembrane protein;(source:Araport11) |
| AT3G50800 | PADRE protein. |
| AT5G47300 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G27770 | DUF868 family protein (DUF868);(source:Araport11) |
| AT1G51890 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G75510 | Transcription initiation factor IIF, beta subunit;(source:Araport11) |
| AT5G14020 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT3G13525 | snoRNA;(source:Araport11) |
| AT4G04120 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.8e-19 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G29140 | hypothetical protein;(source:Araport11) |
| AT5G14360 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G12840 | GTPase Der (DUF707);(source:Araport11) |
| AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G32030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT1G15890 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT1G20480 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT4G19925 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT2G11150 | pseudogene of putative replication protein A1 |
| AT4G27790 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT5G41420 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G05500 | pseudogene of RNI-like superfamily protein;(source:Araport11) |
| AT5G24070 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G51690 | DNA helicase homolog PIF1. |
| AT2G12462 | sterile alpha motif (SAM) domain protein;(source:Araport11) |
| AT5G45510 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G48400 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G38500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G28360 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
| AT3G49130 | SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11) |
| AT5G53010 | calcium-transporting ATPase;(source:Araport11) |
| AT4G25570 | Encodes cytochrome b561. |
| AT5G67410 | transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11) |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT5G19140 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT5G40800 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT3G07030 | Alba DNA/RNA-binding protein;(source:Araport11) |
| AT5G02530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G03070 | Encodes a possible 2-oxoglutarate-dependent dioxygenase that is involved in glucosinolate biosynthesis. The gene is expressed in all ecotypes examined but the enzymatic activity has not been determined experimentally. In Col, there is one copy of this gene (aka AOP1.1) but Ler contains two copies, AOP1.1 and a tightly linked AOP1.2. |
| AT1G49050 | Encodes a member of the aspartyl protease family. Interacts with BAGP1 and BAG6 and appears to be required for cleavage of BAG6 as BAG6 is not cleaved in APCB1 mutant backgrounds. |
| AT5G53540 | Encodes a P-loop NTPase APP1. The disruption of APP1 is accompanied by a reduction in ROS level, a rise in the rate of cell division in the quiescent center (QC) and the promotion of root distal stem cell (DSC) differentiation. |
| AT4G24640 | Encodes AppB protein (AppB1). |
| AT5G43780 | sulfate adenylyltransferase, ATP sulfurylase |
| AT4G32200 | meiotic asynaptic mutant 2, homologue of ASY1 |
| AT1G24140 | Expression induced by fungal and bacterial pathogens. |
| AT4G38250 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT3G29590 | At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis. |
| AT5G08790 | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
| AT5G65990 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT4G15415 | B' regulatory subunit of PP2A (AtB'gamma) |
| AT1G01980 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT1G30720 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30730 | FAD-binding Berberine family protein;(source:Araport11) |
| AT2G34810 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20830 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). It is involved in plant immunity. Overexpressing plants are more resistant to B. cinerea. |
| AT5G44400 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26410 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26420 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30700 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G65780 | Encodes a chloroplast branched-chain amino acid aminotransferase, can complement the yeast leu/iso-leu/val auxotrophy mutant. Note that the AT5G65780.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. The mRNA is cell-to-cell mobile. |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT3G19450 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. The mRNA is cell-to-cell mobile. |
| AT5G26130 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT4G01610 | Encodes a capase involved in stress induced cell death. Activity detected in leaf and cell culture. |
| AT2G30240 | Encodes a plasma membrane localized potassium transporter. |
| AT5G56340 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G44350 | encodes a mitochrondrion targeted citrate synthase, the first enzyme of the tricarboxylic acid cycle, catalyzing the condensation of acetyl-CoA and oxaloacetate, finally yielding citrate and CoA. |
| AT5G03760 | encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root. |
| AT2G24630 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
| AT5G44050 | MATE efflux family protein;(source:Araport11) |
| AT1G22810 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression leands to delayed senescence and delayed flowering. Negatively regulates plant resistance to P. parasitica by suppressing PAMP-triggered immunity. |
| AT3G11730 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein. |
| AT5G61500 | autophagy-related (ATG) gene |
| AT5G48400 | member of Putative ligand-gated ion channel subunit family |
| AT4G24990 | geranylgeranylated protein ATGP4 |
| AT4G37900 | Protein of unknown function that contains DUF1399 domain and putative RNA binding motif. Expressed in many plant tissues and is involved in many aspects of plant growth and development as well as response to salt stress. |
| AT3G62760 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G48605 | Encodes a protein similar to yeast HAL3, which regulates the cell cycle and tolerance to salt stress through inhibition of the PPZ1 type-1 protein phosphatase. AtHAL3b mRNA levels are induced by salt stress. HAL3B presumably encodes for phosphopantothenoylcysteine decarboxylase being involved in Coenzyme A biosynthesis as indicated by functional complementation of a double mutant hal3 aaBb. |
| AT4G03520 | Encodes a redox activated co-chaperone, chloroplast localized thioredoxin, similar to prokaryotic types. |
| AT3G20040 | Hexokinase;(source:Araport11) |
| AT1G34360 | translation initiation factor 3 (IF-3) family protein;(source:Araport11) |
| AT1G28210 | DnaJ homolog AtJ1 (atj) |
| AT1G32361 | Putative RING-H2 finger protein ATL1F precursor. |
| AT5G57160 | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
| AT5G55460 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT2G01910 | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile. |
| AT4G29170 | A homolog of yeast, mouse and human mnd1delta protein. Null mutants exhibit normal vegetative and flower development; however, during prophase I, chromosomes become fragmented resulting in random distribution of the fragments between polyads. Both male and female meiosis are defective and strong accumulation of AtRAD51 was observed in the inflorescence nuclei of mutant plants. Similarly to its yeast and animal homologues, AtMnd1 might play a role in DSB repair during meiosis. |
| AT4G24970 | MORC7 is a member of a family of GHKL ATPases. It is localized in the nuceloplasm and adjacent to chromocenters. Along with MORC4, it appears to repress the expression of genes involved in defense against pathogens. |
| AT4G00480 | MYC-related protein with a basic helix-loop-helix motif at the C-terminus and a region similar to the maize B/R family at the N-terminus |
| AT2G31450 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G07620 | GTP-binding protein Obg/CgtA;(source:Araport11) |
| AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
| AT1G35537 | Encodes a defensin-like peptide with antifungal activity. |
| AT3G47380 | Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease. |
| AT5G46960 | Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease. Closely related paralog of AT5G46950 (InvINH2). |
| AT3G14300 | pectinesterase family protein;(source:Araport11) |
| AT2G43050 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
| AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT2G23310 | Encodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B. |
| AT1G08600 | The Arabidopsis ATRX harbours a N-terminal ADD domain and a C-terminal helicase domain and is devoid of the large central region involved in DAXX interaction in mammals. Arabidopsis ATRX mutant alleles are viable, but with reduced fertility. Their combination with mutants for the H3.3 chaperone HIRA impairs plant survival. ATRX loss affects cellular histone H3.3 pools and modulates the H3.1/H3.3 balance. Notably, at a genome-wide scale, loss of ATRX leads to a reduced H3.3 level at genes characterized by elevated H3.3 occupancy and high expression, including the 45S ribosomal DNA (45S rDNA) loci. Indeed, expression of specific 45S rDNA sequence variants is altered by ATRX loss (DOI:10.1105/tpc.16.00877) |
| AT5G43670 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT3G20920 | Encodes an endoplasmic reticulum localized protein with similarity to yeast Sec62p. Mutants display growth defects and significantly reduced fertility. AtSec62 does not complement the thermosensitive phenotype of yeast Sec62 mutants. |
| AT3G01720 | peptidyl serine alpha-galactosyltransferase;(source:Araport11) |
| AT1G29060 | Encodes a golgi localized QcSNARE involved in response to salt and osmotic stress. Overexpression confers increased resistance to NaCl, mannitol and LiCl. SFT12 may act by mediating vacuolar sequestration of NaCl and other ions. |
| AT5G08335 | Encodes an isoprenyl cysteine methylatransferase (ICMT) involved in the post-translational processing of proteins that have a C-terminal CaaX box. This protein appears to have higher catalytic activity and a higher transcript expression level than the other ICMT present in Arabidopsis (At5g23320). Analysis of ICMT RNAi lines suggests that this protein is involved in flower and stem development. |
| AT3G18370 | C2 domain-containing protein;(source:Araport11) |
| AT3G54860 | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis. |
| AT3G62830 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT4G12490 | Encodes a member of the AZI family of lipid transfer proteins. Contains a PRR domain that appears to be required for localization to the chloroplast. |
| AT5G24240 | Encodes PI4Kc3, localizes to the nucleus and has autophosphorylation activity, but no lipid kinase activity. Overexpression mutants display late-flowering phenotype. |
| AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G79900 | encodes a mitochondrial ornithine transporter that exports ornithine from the mitochondria to the cytosol |
| AT5G51780 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
| AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
| AT5G43650 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G71870 | Metabolite transporter involved in the anthocyanin response to anthocyanin induction conditions. Affects ABA signaling and localization. |
| AT3G57090 | Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division. |
| AT5G61140 | Encodes a predicted protein with 30% identity with MER3/RCK. Similar to yast Brr2p DEAD/DExH box ATP-dependent RNA helicase. |
| AT4G37390 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
| AT3G10800 | Encodes bZIP28, a putative membrane-tethered transcriptional factor. Up-regulated in response to heat; a bZIP28 null mutant has a heat-sensitive phenotype. bZIP28 has a similar domain structure to the mammalian ATF6 protein involved in the unfolded protein response (UPR), and shares a bZIP domain, transmembrane domain, and a canonical S1P cleavage site. The bZIP28 seems to be glycosylated in vivo. bZIP28 does not appear to be transcriptionally up-regulated by UPR-inducing tunicamycin (TM) treatment. But, the expression level of three UPR-related genes is reduced in TM-treated zip28 mutants relative to wild type seedlings. And several UPR genes are transcriptionally upregulated when an N-terminal portion of the bZIP28 protein is expressed using the 35S promoter. A myc:bZIP28 fusion protein appears to be cleaved, likely at a canonical S2 cleavage site, following a TM treatment or a DTT stress-inducing treatment, but not a salt treatment. A portion of the mGFP:bZIP28 protein present in root cells appears to translocate from the cytoplasm and ER to the nucleus following TM treatment. It is cleaved by S2P to allow translocation to the nucleus. The mRNA is cell-to-cell mobile. |
| AT5G14060 | lysine-sensitive aspartate kinase |
| AT5G57580 | Calmodulin-binding protein;(source:Araport11) |
| AT2G24300 | Calmodulin-binding protein;(source:Araport11) |
| AT1G02150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G45770 | chloroplast SRP receptor homolog, alpha subunit CPFTSY. Required for LHCP integration into isolated thylakoids. |
| AT1G56190 | One of a pair of plastid localized phosphoglycerate kinases involved in galactolipid biosynthesis. Functions redundantly with AT3g12780 (PGK1) in the chloroplast in the biosynthesis of thylakoid membrane galactolipids. Double mutants are photosynthetically incompetent, plants are albino and seedling lethal. |
| AT5G08650 | Critical for chloroplast protein synthesis under suboptimal conditions. Essential translation factor that promotes the efficiency of chloroplast protein synthesis. |
| AT2G04530 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast. |
| AT2G35660 | Encodes a member of a novel gene family with homology to known proteins involved in hydroxylation and oxidation of an aromatic ring. |
| AT4G31450 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G17970 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G52140 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G59620 | Encodes CW9. |
| AT2G40140 | zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT4G27120 | ER-resident adaptor protein. Part of complex with C53 and UFL1, the E3 ligase that mediates ufmylation. Involved in the pathway that links ribosome-associated quality control with selective autophagy at the ER. |
| AT3G05727 | Encodes a defensin-like (DEFL) family protein. Activated by OXS2 under the treatment of salt. |
| AT4G04930 | Encodes a sphingolipid delta4-desaturase, involved in sphingolipid biosynthesis. Specifically expressed in floral tissues. Knockout mutants were devoid of sphinga-4,8-dienine in floral tissues. |
| AT3G07090 | Interacts with C3H59 via its WD40 domain and C-terminal region, respectively, in the nucleus. |
| AT1G64620 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT5G02470 | core cell cycle genes |
| AT2G40340 | Encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT2G21550 | One of three DRTS genes, this is the most divergent one.THY3/DRTS3 is preferentially expressed in the shoot apex, stipules and root caps. |
| AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
| AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
| AT1G18100 | Encodes a member of the FT and TFL1 family of phosphatidylethanolamine-binding proteins. It is expressed in seeds and up-regulated in response to ABA. Loss of function mutants show decreased rate of germination in the presence of ABA. ABA dependent regulation is mediated by both ABI3 and ABI5. ABI5 promotes MFT expression, primarily in the radicle-hypocotyl transition zone and ABI3 suppresses it in the seed. |
| AT1G18070 | Translation elongation factor EF1A/initiation factor IF2gamma family protein;(source:Araport11) |
| AT5G60390 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
| AT5G11480 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G34470 | magnesium transporter, putative (DUF803);(source:Araport11) |
| AT4G23170 | Induced in response to Salicylic acid.Similar to receptor-like kinase 4 and 5. NPR1, a known positive regulator of the SA signaling pathway is responsible for the SA-dependent induction and constitutive repression of EP1 gene's basal expression. The mRNA is cell-to-cell mobile. |
| AT5G04670 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
| AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
| AT5G07580 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT1G75920 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
| AT2G32170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G13610 | Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
| AT4G35900 | bZIP protein required for positive regulation of flowering. Mutants are late flowering. FD interacts with FT to promote flowering.Expressed in the shoot apex in floral anlagen, then declines in floral primordia. |
| AT1G12160 | Encodes a flavin-containing monooxygenases involved in biosynthesis of aliphatic glucosinolates. |
| AT3G52750 | Nuclear gene that encodes a plastidial division protein (FtsZ2-2). FtsZ2-2 is involved in chloroplast morphology and internal organisation in addition to participating in chloroplast partition |
| AT5G13480 | Encodes a protein with similarity to yeast Pfs2p, an mRNA processing factor. Involved in regulation of flowering time; affects FCA mRNA processing. Homozygous mutants are late flowering, null alleles are embryo lethal. |
| AT3G12570 | FYD;(source:Araport11) |
| AT3G06580 | Encodes a protein with galactose kinase activity. The gene was shown to complement the yeast Agal1 mutant defective in the galactokinase gene GAL1. |
| AT3G06440 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. Mutants display multiple phenotypes including reduced root hair growth and reduced seed coat mucilage. |
| AT1G27120 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. |
| AT3G13040 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT1G17890 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G14960 | encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin. |
| AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
| AT3G60210 | GroES-like family protein;(source:Araport11) |
| AT1G28480 | Encodes GRX480, a member of the glutaredoxin family that regulates protein redox state. GRX480 interacts with TGA factors and suppresses JA-responsive PDF1.2 transcription. GRX480 transcription is SA-inducible and requires NPR1. Maybe involved in SA/JA cross-talk. It has also been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT4G15660 | Encodes a member of the CC-type glutaredoxin (ROXY) family. Represses transcriptional and developmental responses to nitrate. Operates downstream of cytokinins in a signal transduction pathway that negatively regulates plant primary root growth in response to nitrate.Interacts with the TGA1 and TGA4 transcription factors, which are central regulators of early transcriptional responses to nitrate in root. |
| AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
| AT1G27440 | IRX10 was identified as MUCI69 in a reverse genetic screen for MUCILAGE-RELATED genes. Mutations in this gene did not disrupt mucilage properties, likely due to the presence of the functionally redundant IRX10-L. |
| AT4G36710 | GRAS family transcription factor;(source:Araport11) |
| AT3G14130 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
| AT4G37790 | Encodes homeobox protein HAT22, member of the HD-Zip II family. The mRNA is cell-to-cell mobile. |
| AT2G22800 | Encodes homeobox protein HAT9. |
| AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
| AT3G14930 | Uroporphyrinogen decarboxylase;(source:Araport11) |
| AT3G55350 | PIF / Ping-Pong family of plant transposase;(source:Araport11) |
| AT5G26690 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G08570 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G25900 | Homocysteine S-methyltransferase family protein;(source:Araport11) |
| AT5G59250 | Encodes a chloroplast localized H+/glucose antiporter. |
| AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
| AT3G24810 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
| AT5G05300 | IDL6 peptide is induced in response to Pathogen-Associated Molecular Patterns (PAMPs). Overexpression of IDL6 results in increased susceptibility to pathogens. |
| AT5G58100 | Encodes a membrane protein involved in pollen nexine and sexine development. |
| AT1G56460 | HIT zinc finger and PAPA-1-like domain-containing protein;(source:Araport11) |
| AT2G17520 | Encodes a endoribonuclease/protein kinase IRE1-like protein that is predicted to form a type I transmembrane protein structure and contain kinase/endoribonuclease domains at their C-terminal halves. The transcript levels for several ER-stress responsive genes, including six protein disulfide isomerases (PDIs), BiP2, and AtbZIP60 are not affected in ire1-2 null mutants. The mRNA is cell-to-cell mobile. |
| AT4G22220 | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
| AT1G32130 | The C-terminal portion of this protein has high homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. Interacts with transcription factor BES1. Involved in brassinosteroid-regulated gene expression. |
| AT3G44110 | homologous to the co-chaperon DNAJ protein from E coli |
| AT1G62310 | Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3. |
| AT1G23760 | Encodes aromatic rich glycoprotein JP630. |
| AT3G08960 | Ran effector. |
| AT5G06770 | KHZ2 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ1.Double mutants with khz1 are late flowering. Overexpression leads to increased rates of leaf senescence. |
| AT1G48050 | Ku80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity. Binds double stranded DNA breaks as a heterodimer with Ku70, involved in non-homologous end joining repair. Mutants are defective in T-DNA integration. Over expression confers increased resistance to DNA damage agents and increased susceptibility to T-DNA transformation. |
| AT3G20270 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. |
| AT1G24170 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G15093 | catalytic LigB subunit of aromatic ring-opening dioxygenase family;(source:Araport11) |
| AT1G25570 | Di-glucose binding protein with Leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT1G19260 | Encodes a ceramide synthase that uses very-long- chain fatty acyl-CoA and trihydroxy LCB substrates. |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT1G30050 | tropomyosin;(source:Araport11) |
| AT2G30530 | zinc finger CCCH domain protein;(source:Araport11) |
| AT5G13240 | Global repressor of RNA polymerase III (Pol III). Maf1 repressor activity is critical for plant survival during environmental stresses, and is regulated by its phosphorylation/dephosphorylation through the activity of TOR and PP4/PP2A phosphatases. |
| AT1G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G77420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G39410 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G39420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G47630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G03630 | Pyridine nucleotide-disulfide oxidoreductase family protein;(source:Araport11) |
| AT3G21350 | RNA polymerase transcriptional regulation mediator-like protein;(source:Araport11) |
| AT1G23360 | Encodes a 2-phytyl-1,4-naphthoquinone methyltransferase that catalyzes the final step in phylloquinone (vitamin K1) biosynthesis. |
| AT1G74440 | Similar to MPH1, can complement mph1-1 salt sensitivity phenotype. |
| AT4G32060 | Encodes an EF-hand protein with homology to constituents of the mitochondrial Ca2+ uniporter machinery in mammals. MICU binds Ca2+ and localizes to the mitochondria in Arabidopsis. It is a negative regulator of mitochondrial calcium uptake. Mutants display elevated matrix calcium at steady state and modified calcium transient kinetics in vivo. |
| AT5G24020 | Encodes a Ca2+ dependent ATPase required for correct positioning of the chloroplast division apparatus. Its ATPase activity is stimulated by AtMinE1, a topological specificity factor. |
| AT1G78830 | In combination with MYB4, MAN3, and Mannose part of signaling cascade which regulates cadmium tolerance. Mannose is able to bind to the GNA-related domain of MNB1; mannose binding to the GNA-related domain of MNB1 is required for MAN3-mediated Cd tolerance. |
| AT5G26340 | Encodes a protein with high affinity, hexose-specific/H+ symporter activity. The activity of the transporter appears to be negatively regulated by phosphorylation. Importantly, microarray analysis, as well as the study of the expression of this gene in mutants involved in programmed cell death (PCD) demonstrated a tight correlation between this gene's expression and PCD. |
| AT5G06810 | transcription termination factor family protein;(source:Araport11) |
| AT1G62490 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G21150 | mTERF protein involved in mitochondrial development; required for salt tolerance. |
| AT1G61960 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G61980 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G62110 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G62120 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT3G24570 | contributes to osmotic stress tolerance |
| AT1G32640 | Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif and interacts with Jasmonate ZIM-domain proteins. MYC2 interacts with EIN3 and EIL1 to repress hook curvature and resistance to Botrytis cinera.Its transcription is induced by dehydration stress, ABA treatment and blue light via CRY1. Negative regulator of blue light-mediated photomorphogenic growth and blue and far-red-light-regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. For example it binds to and regulates the expression of NST1. Its stability is modulated by PUB10 through polyubiquitination. |
| AT4G17880 | MYC4 is bHLH transcriptional regulator. It functions as a JAZ-interacting transcription factor that acts together with MYC2 and MYC3 to activate JA-responses. It also functions in blue light mediated secondary cell wall biogenesis via regulation of NST1 expression. MYC4 directly binds to NST1 promoter and activates its expression. |
| AT5G06560 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT3G11850 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G02290 | Encodes a candidate protein kinase NAK that is similar to the oncogenes met and abl. |
| AT5G02130 | SSR1 encodes a tetratricopeptide repeat- containing protein localized in mitochondria. It is involved in root development, possibly by through effects on auxin transport. In ssr1 mutants, the expression PIN genes and trafficking of PIN2 is altered which in turn affects distribution of auxin in the roots. |
| AT4G09320 | nucleoside diphosphate kinase type 1 (NDPK1) gene, complete The mRNA is cell-to-cell mobile. |
| AT5G13950 | nuclear factor kappa-B-binding protein;(source:Araport11) |
| AT3G20610 | non-race specific disease resistance protein;(source:Araport11) |
| AT3G54200 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G50920 | Putative GTPase involved in HA - and ABA-mediated signaling pathways, particularly during defense respnses to pathogens. Has paralog NOG1-2. |
| AT1G10300 | GTPase involved in HA - and ABA-mediated signaling pathways, particularly during defense respnses to pathogens. A truncated version of NOG1-2 has been detected in Col-0, Ler-0, Rsch-4 ecotypes. Functions similarly to the paralogous gene NOG1-1. |
| AT1G02080 | Acts as scaffold protein in the CCR4-NOT complex, by interacting with various NOT proteins and CAF1. Essential protein for proper pollen development and germination capacity. |
| AT2G28540 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G32550 | Cell differentiation, Rcd1-like protein;(source:Araport11) |
| AT3G45680 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT2G38100 | Encodes a nitrate transporter that is involved in nitrogen accumulation in embryos. |
| AT5G47800 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G26490 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G41010 | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
| AT4G21710 | Encodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. |
| AT2G15430 | Non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB3 and the E. coli RNA polymerase alpha subunit. A closely related paralog, encoded by At2g15400, can substitute for At2g15430 in the context of Pol V. |
| AT3G22320 | Non-catalytic subunit common to DNA-dependent RNA polymerases I, II, III and IV; homologous to budding yeast RPB5. |
| AT3G57080 | Non-catalytic subunit unique to Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB5. |
| AT4G17300 | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
| AT3G20760 | Nse4, component of Smc5/6 DNA repair complex;(source:Araport11) |
| AT5G60980 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
| AT3G61050 | Encodes a novel transcriptional regulator, a calcium-dependent lipid-binding protein containing a C2 domain, that binds specifically to the promoter of THAS1 (thalianol synthase 1). It can bind ceramide and is involved in drought and salt tolerance. |
| AT3G51620 | PAP/OAS1 substrate-binding domain superfamily;(source:Araport11) |
| AT3G61690 | Putative TNAase |
| AT1G07640 | A member of the DOF transcription factors. Prominently expressed in the phloem of leaves and other organs. Expression is induced by wounding, MeJA and insect feeding. Upregulates glucosinolate biosynthesis. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT1G76405 | outer envelope pore 21B-like protein;(source:Araport11) |
| AT1G65080 | Structurally distinct member of Oxa1 superfamily , has tetratricopeptide repeat (TPR) domain at the C terminus. Paralog of OXA2b.Involved in maturation of mitochondrial cytochrome c. |
| AT3G48760 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT1G30690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G51670 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT5G35580 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G76360 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G24710 | Encodes an AAA+ ATPase that mediates meiotic chromosome remodeling and crossover maturation. |
| AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
| AT1G49290 | Paternally expressed gene that is localized around the sperm nuclei of pollen. PEG2 acts as a sponge for siRNA854 during endosperm development, this action is necessary to induce triploid seed abortion. |
| AT2G36560 | A paternally expressed imprinted gene. |
| AT3G27110 | PGM48 is a member of a plant specific clade of metallo-endopeptidase proteins. It is found in plastoglobules. Analysis of over-expression and loss of function phenotypes suggests PGM48 may have a role in positively regulating senescence. |
| AT4G14450 | A member of a small family of proline/serine rich proteins of unknown function. It interacts with defense related MAP kinase MPK6. It's expression is induced by PAMP elicitors. May play a role in response to pathogens. |
| AT1G68740 | Encodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT4G27320 | Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase. |
| AT4G11810 | Encodes an SPX domain protein that transports Pi into the vacuole. Overexpression of PHT5:2 leads to massive Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
| AT4G22990 | Encodes a member of the PHOSPHATE TRANSPORTER 5 family (PHT5;3). Overexpression of PHT5:3 leads to Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
| AT5G10410 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT5G65370 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT1G10900 | Phosphatidylinositol-4-phosphate 5-kinase family protein;(source:Araport11) |
| AT1G08620 | Member of family of Jumonji C (JmjC)-containing demethylases, its catalytic domain exhibits both H3K4 and H3K9 demethylation activities. Together with MMD1 promotes in male meiocytes gene expression in an H3K9me3-dependent manner and thereby contributes to meiotic chromosome condensation. |
| AT2G06925 | Encodes a secretory phospholipase A2 enzyme, which specifically hydrolyzes the sn-2 position of phospholipids. The enzyme has a preference towards linoleoyl acyl chain over palmitoyl acyl chain. It also has a slight preference for phosphatidylcholine over phosphatidylethanolamine. |
| AT1G61850 | Encodes a non-specific lipase that hydrolyzes phospholipids as well as galactolipids, at both sn-1 and sn-2 positions. Involved in basal jasmonic acid biosynthesis by releasing the precursor fatty acid from membrane lipids. Mutant plants were impacted in resistance to fungus B. cinerea. |
| AT3G17340 | Ran effector. |
| AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
| AT4G17900 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G76590 | PLATZ transcription factor family protein;(source:Araport11) |
| AT3G27400 | Encodes a pectate lyase involved in response to nematodes. |
| AT2G46890 | 3-oxo-5-alpha-steroid 4-dehydrogenase (DUF1295);(source:Araport11) |
| AT5G11560 | catalytics;(source:Araport11) |
| AT1G33612 | Encodes a receptor for the Plant Natriuretic Peptide (At2g18660, AtPNP-A). The receptor contains a functional guanylyl cyclase catalytic center embedded in the cytosolic kinase domain. This catalytic center can convert GTP into cGMP (and PPi) which enables ligand-specific downstream signalling. It is therefore consistent with the reported cGMP dependence of AtPNP-A effects (see DOI:10.1007/s11103-016-0465-8). |
| AT1G76950 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
| AT5G52800 | primase/polymerase protein |
| AT5G44582 | hypothetical protein;(source:Araport11) |
| AT5G44572 | transmembrane protein;(source:Araport11) |
| AT5G44574 | transmembrane protein;(source:Araport11) |
| AT5G44575 | hypothetical protein;(source:Araport11) |
| AT1G04080 | Encodes a U1 small nuclear ribonucleoprotein (snRNP) factor involved in alternative splicing. |
| AT5G39580 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT5G64100 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT4G21960 | Encodes AT4g21960 (AT4g21960/T8O5_170). The mRNA is cell-to-cell mobile. |
| AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G49060 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G68940 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT4G36550 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G65500 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G61550 | U-box domain-containing protein kinase family protein;(source:Araport11) |
| AT5G51270 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G18560 | Encodes PUCHI, a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. PUCHI is required for morphogenesis in the early lateral root primordium of Arabidopsis. Expressed in early floral meristem (stage 1 to 2). Required for early floral meristem growth and for bract suppression. Triple mutant with bop1 and bop2 displays a strong defect in the determination of floral meristem identity with reduced LFY expression and the lack of AP1 expression. |
| AT3G46060 | small GTP-binding protein (ara-3) The mRNA is cell-to-cell mobile. |
| AT5G49470 | Encodes a protein with similarity to RAF MAP Kinase that is expressed in most plant tissues. Based on loss of function and gain of function phenotypes, RAF10 appears to be involved in ABA response. |
| AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
| AT3G19184 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT3G06160 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT2G24700 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT5G44750 | Homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
| AT5G41170 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G71980 | RMR2 is a secretory pathway protein localized to the trans-golgi network. It belongs to a family of vacuolar sorting receptors. If forms heterodimers with RMR1. |
| AT1G74450 | Plants overexpressing At1g74450 are stunted in height and have reduced male fertility. |
| AT5G14070 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. ROXY2, together with ROXY1 (AT3G02000), controls anther development. roxy1 roxy2 double mutants are sterile and do not produce pollen. |
| AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT4G29390 | Ribosomal protein S30 family protein;(source:Araport11) |
| AT2G28620 | Mutants have radially swollen roots but do not exhibit defects in abundance or orientation of cortical microtubules, nor are microfibrils reduced. Cellulose synthesis is also unchanged with respect to wild type. There is a disruption in the normal pattern of cell wall placement. |
| AT2G25420 | WD40 domain protein which interacts with ROS1 in the base excision repair pathway through DNA methylation. |
| AT1G58520 | GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
| AT1G61930 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G09460 | transcription factor bHLH143;(source:Araport11) |
| AT1G55050 | hypothetical protein;(source:Araport11) |
| AT4G11740 | Isolated as a suppressor of a dominant mutant in the Ara4 gene that was expressed in yeast ypt1 mutant strains. A novel protein with a small region of similarity to coil-coiled domain of yeast VSP27 protein. |
| AT1G32960 | Subtilase family protein;(source:Araport11) |
| AT5G51340 | SCC4 is a tetratricopeptide repeat containing protein and a likely component of a plant cohesion loading complex along with its partner SSC2 It is expressed primarily in dividing cells. Loss of function mutants are embryo lethal, arresting by globular stage. |
| AT3G19508 | complex 1 protein, LYR family protein;(source:Araport11) |
| AT2G47860 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G27350 | Encodes a sugar-porter family protein that is induced during leaf senescence. The increase in its gene expression during leaf senescence is paralleled by an accumulation of monosaccharides. The mRNA is cell-to-cell mobile. |
| AT4G23570 | Closely related to SGT1B, may function in SCF(TIR1) mediated protein degradation. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance. AtSGT1a is induced upon pathogen infection and can function in R gene-mediated resistance. |
| AT4G11260 | Functions in plant disease resistance signaling, SCF(TIR1) mediated degradation of Aux/IAA proteins and HSP90 mediated degradation of R resistance proteins. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance. |
| AT2G28870 | cyclin-dependent kinase inhibitor SMR1-like protein;(source:Araport11) |
| AT5G59360 | hypothetical protein;(source:Araport11) |
| AT1G17600 | SOC3 is a TIR-NB-leucine-rich repeat (TNL) protein.Mutants suppress loss of chs2 phenotype of auto-activation of immunity. When the TIR domain of SOC3 interacts with CHS2 the binding results in temperature activation of cell death, the suppressors inhibit this interaction. |
| AT5G44568 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G22890 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G65486 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G65490 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G65500 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT5G46230 | ABA responsive SVB family gene. |
| AT1G30020 | SVB family gene. |
| AT4G24130 | ABA responsive SVB family gene. |
| AT3G48740 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT5G23660 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT4G10850 | Nodulin MtN3 family protein;(source:Araport11) |
| AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
| AT5G40840 | Cohesion family protein SYN2 (SYN2). Plays a role in somatic DNA double strand break damage repair. |
| AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT2G20110 | Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX5 in repressing the expression of these genes. |
| AT3G02950 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. |
| AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
| AT1G55900 | component of a translocase in the mitochondrial inner membrane |
| AT4G22300 | Formerly known as SOBER1, this locus was split in the TAIR10 annotation into AT4G22300 and AT4G22305. This locus is now known as TIPSY1 and AT4G22305 corresponds to SOBER1. |
| AT4G12650 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT5G25100 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT3G04210 | TN13 is a TIR-NBS protein involved in immune response. It co localizes with the ER and perinuclear membranes and interacts with MOS6. It also associates with the CC-NBS-LRR resistance protein RPS5 and contributes to RPS5-triggered immunity. |
| AT5G37478 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT2G17930 | Component of the SPT module of the SAGA complex. |
| AT2G47960 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT4G40000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G30660 | A truncated version of Twinkle that retains only the DNA primase domain. |
| AT1G60900 | Putative U2A65 splicing factor which functions in abscisic acid mediated flowering via regulating the precursor messenger RNA splicing of ABI5 and FLC in shoot apex. Regulates flowering time and displays a redundant role in pollen tube growth together with AtU2AF65a. |
| AT5G66690 | UGT72E2 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl aldehydes as well as sinapyl- and coniferyl alcohol. The enzyme is thought to be involved in lignin metabolism. A knockdown mutant line (72E2KD) was obtained using RNAi silencing. A twofold reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype. In comparison, both knockout and knockdown lines of UGT72E1 and UGT72E3, respectively, failed to display the same reduction in phenylpropanoid 4-O-glucosides. The mRNA is cell-to-cell mobile. |
| AT5G26310 | UGT72E3 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl alcohol as well as sinapic acid. The enzyme is thought to be involved in lignin- and phenylpropanoid metabolism. A knockdown mutant line (72E3KD) was obtained using RNAi silencing. No reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype, in contrast with the knockdown line constructed for UGT72E2 displayed a twofold reduction in the these phenylpropanoid 4-O-glucosides. Can influence the kinetics of lignin deposition by regulating monolignol flow to the cell wall as well as the potential of this compartment to incorporate monomers into the growing lignin polymer. |
| AT4G27560 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
| AT1G43620 | Encodes a UDP-glucose:sterol-glucosyltransferase. Mutants produce pale greenish-brown seeds whose dormancy was slightly reduced |
| AT4G15500 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT1G06000 | encodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols |
| AT3G61800 | ENTH/VHS protein;(source:Araport11) |
| AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT4G26710 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT1G16780 | Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves. |
| AT2G22880 | VQ motif-containing protein;(source:Araport11) |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT5G45050 | Encodes a member of the WRKY Transcription Factor (Group II-e) family. |
| AT4G12020 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002,7(7):301. Co-regulates with DSC1 basal levels of immunity to root-knot nematodes. |
| AT4G01250 | AtWRKY22 is a member of WRKY Transcription Factor; Group II-e. It is involved in regulation of dark induced leaf senescence. |
| AT4G23550 | Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile. |
| AT4G04450 | member of WRKY Transcription Factor; Group II-b. Interacts with lncRNA APOLO to trigger root hair cell expansion in response to cold. |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT4G23810 | member of WRKY Transcription Factor; Group III |
| AT4G33200 | member of Myosin-like proteins |
| AT1G08730 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
| AT4G28710 | member of Myosin-like proteins The mRNA is cell-to-cell mobile. |
| AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter;(source:Araport11) |
| AT1G51510 | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm. |
| AT3G07430 | YLMG is located in thylakoid membranes. It is involved in chloroplast division and more specifically the proper distribution of nucleoids. The function is conserved between cyanobacteria and chloroplasts.The mRNA is cell-to-cell mobile. |
| AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
| AT3G53600 | Nuclear C2H2 zinc finger protein.Expression is induced by cold, osmotic, salt, and drought stress. Over expression confers some drought tolerance whereas mutants display some drought sensitivity. |
| AT2G45120 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G46090 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT5G38600 | Proline-rich spliceosome-associated (PSP) family protein / zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT1G59590 | ZCF37 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G58340 | Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress. |
| AT4G33020 | member of Fe(II) transporter isolog family |
| AT3G57700 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57640 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G58350 | Putative serine esterase family protein;(source:Araport11) |
| AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G22260 | One of two nearly identical proteins (ZYP1b) identified by similarity to transverse filament (TF) proteins. These proteins are involved in chromosome synapsis during meiosis I and localize to the synaptonemal complex (SC). Single mutants have reduced fertility and double mutants (induced by RNAi) have severely reduced fertility. |
| AT4G35040 | Basic-region leucine zipper (bZIP19) transcription factor involved in the adaptation to zinc deficiency. Binds ZDRE motifs. |
| AT2G16770 | Basic-region leucine zipper (bZIP23) transcription factor involved in the adaptation to zinc deficiency. Binds ZDRE motifs. |
| AT1G44318 | Aldolase superfamily protein;(source:Araport11) |
| AT5G14220 | Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development. |
| AT2G20960 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT4G31430 | Encodes a plant-specific protein that physically interacts with CRWN1 and its homolog CRWN4 and localizes at the inner nuclear membrane. KAKU4 deforms the nuclear envelope in a dose-dependent manner, in association with nuclear membrane invagination and stack formation. |
| AT5G19820 | Encodes an importin that transports HYL1, a component of the microprocessor, from the cytoplasm to the nucleus to constitute functional microprocessor, thereby affecting miRNA processing. Knockdown amiR mutants significantly reduced nuclear portion of HYL1 protein and correspondingly compromised the pri-miRNA processing in the nucleus.KETCH1 may protect RPs from the 26S proteasome-mediated degradation. |
| AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
| AT4G37770 | Encodes an auxin inducible ACC synthase. |
| AT4G08040 | encodes an aminotransferase that belongs to ACC synthase gene family structurally |
| AT3G49700 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings. |
| AT4G11280 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family The mRNA is cell-to-cell mobile. |
| AT2G26420 | Encodes a phosphatidylinositol-4-phosphate 5-kinase. Exclusively expressed in roots. Essential for root hair growth. |
| AT1G76690 | Encodes one of the closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Shows activity towards 2,4,6-trinitrotoluene. Expressed predominately in root. Predicted to be a cytosolic protein. |
| AT3G08590 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
| AT3G19010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G13060 | Encodes 20S proteasome beta subunit PBE1 (PBE1). |
| AT5G53000 | PP2A-associated protein with a possible function in the chilling response |
| AT4G03415 | Encodes a myristoylated 2C-type protein phosphatase that interacts with AGB1 and is localized to the plasma membrane. |
| AT3G10540 | master regulator of AGC kinases |
| AT2G17370 | Encodes a 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) that is involved in the synthesis of sterol and triterpenoid compounds. |
| AT4G14440 | encodes a cytosolic delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT2G28630 | Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT4G34250 | Encodes KCS16, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G04530 | Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G49070 | Encodes KCS21, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G07720 | Encodes KCS3, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G68530 | Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G71160 | Encodes KCS7, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G15090 | Encodes KCS8, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). The mRNA is cell-to-cell mobile. |
| AT4G24770 | Encodes a chloroplast RNA-binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Required for editing and stability of specific chloroplast mRNAs. |
| AT1G47290 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
| AT2G26260 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
| AT2G26930 | Encodes a 4-(cytidine 5'-phospho)-2-C-methyl-D-erithritol kinase. |
| AT1G51680 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. In addition to 4-coumarate, it also converts ferulate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, ferulic acid, caffeic acid and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as substrate. |
| AT1G65060 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. mRNA levels are not induced in response to wounding or to fungal infection by P. parasitica. mRNA is expressed in flowers, to a lesser degree in mature leaves and siliques and marginally in seedling roots and bolting stems of mature plants. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, cinnamic acid and 5-OH-ferulic acid. At4CL3 was unable to use sinapic acid as substrate. |
| AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
| AT1G64190 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT3G02360 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT5G41670 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT1G13700 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT1G21710 | Encodes 8-oxoguanine-DNA glycosylase. DNA repair enzyme. |
| AT2G19490 | recA DNA recombination family protein;(source:Araport11) |
| AT5G67030 | Encodes a single copy zeaxanthin epoxidase gene that functions in first step of the biosynthesis of the abiotic stress hormone abscisic acid (ABA). Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
| AT1G52340 | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
| AT4G26080 | Involved in abscisic acid (ABA) signal transduction. Negative regulator of ABA promotion of stomatal closure. |
| AT3G24650 | Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230). |
| AT2G36270 | Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . |
| AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile. |
| AT4G11890 | Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction. |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G05805 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G79600 | Encodes a chloroplast ABC1-like kinase that regulates vitamin E metabolism. |
| AT2G40090 | member of ATH subfamily |
| AT3G23560 | Member of the multidrug and toxic compound extrusion (MATE) family, protects roots from inhibitory compounds. |
| AT3G10572 | APEM9 is required for both PTS1- and PTS2-dependent protein transport. APEM9 interacts with PEX6 in BiFC assay and mating-based Split ubiquitin system. BiFC data shows that APEM9 is required for peroxisomal localization of PEX1-PEX6 complex. These results indicate that APEM9 functions like mammalian PEX26 and yeast PEX15. |
| AT3G29575 | ABI five binding protein 3;(source:Araport11) |
| AT2G46225 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. One of four ABI-like proteins. |
| AT5G24310 | One of four ABI-like proteins. |
| AT2G45190 | Encodes a member of the YABBY family of transcriptional regulators that is involved in abaxial cell type specification in leaves and fruits. YAB1 acts in a non-cell autonomous fashion within the meristem to affect phyllotactic patterning. The non-autonomous effect on the central region of the meristem is mediated through the activity if Lateral Suppressor (LAS). |
| AT3G19290 | bZIP transcription factor with specificity for abscisic acid-responsive elements (ABRE). Mediates ABA-dependent stress responses.ABF4 acts through SnRK2 pathway and binds to ABA response elements of the promoters of NYE1 and regulates their expression to promote chlorophyll degradation. |
| AT1G67080 | Encodes a protein involved in the photoprotection of PSII. An aba4-1 mutant completely lacks neoxanthin,a component of the chromophore of the peripheral antenna system in PSII. ABA4 is required for neoxanthin biosynthesis, an intermediary step in abscisic acid biosynthesis, but no catalytic activity has been detected for the ABA4 protein. |
| AT1G45249 | Leucine zipper transcription factor that binds to the abscisic acid (ABA)?responsive element (ABRE) motif in the promoter region of ABA-inducible genes. Enhances drought tolerance in vegetative tissues. Required for normal glucose response. Localized in the nucleus. Expressed constitutively in roots, leaf vascular tissues, and hydathodes or in all tissues under stress conditions. It's phosphorylated by a ABA-activated 42-KDa kinase. Overexpression of the phosphorylated active form of AREB1 expressed many ABA-inducible genes, such as RD29B, without ABA treatment. |
| AT2G27150 | Encodes the aldehyde oxidase delta isoform catalyzing the final step in abscisic acid biosynthesis. |
| AT5G19530 | Encodes a spermine synthase. Required for internode elongation and vascular development, specifically in the mechanism that defines the boundaries between veins and nonvein regions. This mechanism may be mediated by polar auxin transport. Though ACL5 has been shown to function as a spermine synthase in E. coli, an ACL5 knockout has no effect on the endogenous levels of free and conjugated polyamines in Arabidopsis, suggesting that ACL5 may have a very specific or altogether different in vivo function. |
| AT3G61510 | Encodes a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. The gene is transcriptionally active but enzymatically inactive. The predicted amino-acid sequence of ACS1 is missing the highly conserved tripeptide, Thr-Asn-Pro (TNP), between Ile204 and Ser205. Introduction of TNP into ACS1 restores the ACS activity. |
| AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
| AT5G51290 | Encodes a ceramide kinase that plays a role in modulating cell death. |
| AT4G14400 | encodes a novel protein with putative ankyrin and transmembrane regions. It is a member of one of the largest uncharacterized gene families in higher plants. The gene is involved in resistance to Pseudomonas syringae. |
| AT1G75010 | Encodes ARC3 (Accumulation and Replication of Chloroplast 3), a chloroplast division factor functioning in the initiation of chloroplast division. ARC3 is a chimera of the prokaryotic FtsZ and part of the eukaryotic phosphatidylinositol-4-phosphate 5-kinase (PIP5K). Located on the outer surface of the chloroplast in a ring-like structure at the early stage of chloroplast division. The arc3 mutant has a small number of abnormally large chloroplasts in the cell. |
| AT4G25650 | Similar to ACD1. Leaves of antisense ACD1-like plants turn yellow in darkness like wild-type whereas antisense ACD1 plants remain dark after five days of dark treatment. |
| AT5G48230 | Encodes an acetoacetyl-CoA thiolase that generates the bulk of the acetoacetyl-CoA precursor needed for the cytosolic localized, mevalonate-derived isoprenoids biosynthetic pathway. Loss-of-function mutants are embryo lethal. |
| AT1G36160 | Encodes acetyl-CoA carboxylase. Mutant displays uncoordinated cell divisions which are enhanced by cytokinins. Mutant also has aberrant organization of the apical region in the embryo and abnormal root and shoot development and is deficient in freezing tolerance after cold acclimation. Essential for very long chain fatty acid elongation. The mRNA is cell-to-cell mobile. |
| AT1G36180 | acetyl-CoA carboxylase 2 (ACC2) The mRNA is cell-to-cell mobile. |
| AT5G36880 | Encodes a plastidic acetyl-coA synthetase. This enzyme plays a role in converting acetate to acetyl-coA in the plastids. It does not appear to be a major contributor to fatty acid biosynthesis based on mutant phenotypes. The enzyme seems to act as a monomer and may play an important role in preventing the toxic accumulation of fermentation products including acetaldehyde, acetate, and ethanol. It participates in the pyruvate dehydrogenase bypass pathway |
| AT4G26970 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. The mRNA is cell-to-cell mobile. |
| AT1G76990 | ACT domain repeat 3;(source:Araport11) |
| AT1G16880 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. The mRNA is cell-to-cell mobile. |
| AT3G46010 | Actin-depolymerizing factor (ADF) and cofilin define a family of actin-binding proteins essential for the rapid turnover of filamentous actin in vivo. |
| AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
| AT3G12110 | Encodes an actin that is expressed predominantly during reproductive development. |
| AT1G33560 | Encodes a NBS-LRR disease resistance protein that possesses N-terminal kinase subdomains. Activation tagged mutant of ADR1 showed elevated levels of SA and reactive oxygen species in addition to number of defense gene transcripts. Exhibits resistance to number of microbial pathogens. |
| AT1G74500 | Encodes a basic helix/loop/helix transcription factor that acts downstream of MP in root initiation. TMO7 protein moves to the hypophysis and to vascular cells, contributing to MP-dependent root formation. Promotes the correct definition of the hypophysis cell division plane. |
| AT3G12890 | Encodes a protein belonging to a class of CCT (CONSTANS, CONSTANS-like, TOC1) domain proteins. The protein contains a 43 amino acid-long sequence with high homology to the CCT domain but does not have any B-box or GATA-type zinc finger domains. Functions as a transcriptional activator and regulates the expression of at least a subset of sugar-inducible genes. |
| AT1G55320 | Encodes a protein with similarity to acyl activating enzymes. AAE18 is localized to the peroxisome where it may be involved in metabolism of auxin precursors to active auxins. |
| AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
| AT5G16240 | Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
| AT4G16760 | Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate. |
| AT1G62940 | encodes an acyl-CoA synthetase, has in vitro activity towards medium- to long-chain fatty acids and their hydroxylated derivatives. Expressed in the tapetum. Involved in pollen wall exine formation. Null mutants were devoid of pollen grains at anther maturity and were completely male sterile. |
| AT4G24230 | acyl-CoA-binding protein ACBP3. Localized extracellularly in transiently expressed tobacco BY-2 cells and onion epidermal cells. Binds arachidonyl-CoA with high affinity. Microarray data shows up-regulation of many biotic- and abiotic-stress-related genes in an ACBP3 OE-1 in comparison to wild type. |
| AT1G06090 | Membrane bound acyl-lipid desaturases which can perform Δ9 desaturation. |
| AT3G02630 | One of seven acyl acyl carrier proteins. Expressed primarily in developing seeds.Involved in fatty acid metabolism. Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD1 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
| AT2G42690 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G50860 | Clathrin adaptor complex small chain family protein;(source:Araport11) |
| AT4G24550 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT4G01100 | Adenine nucleotide transporter. Located in mitochondrion. Expressed in a broad range of tissues, but predominantly in root tips. Loss of function mutants exhibit reduced root growth and respiration. |
| AT4G12440 | adenine phosphoribosyl transferase 4;(source:Araport11) |
| AT2G37250 | encodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth |
| AT3G57610 | encoding adenylosuccinate synthetase (AdSS), the enzyme involved in the first step of the formation of the purine nucleotide AMP (conversion of IMP to adenylo-succinate) |
| AT4G11940 | Encodes a nuclear localized dosage sensitive paternally expressed imprinted gene. It is a member of a family of molecular chaperones called J-domain. Loss of ADM function suppresses seed abortion of triploid embryos and also partially rescues the effect of mea mutations. |
| AT1G23490 | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT2G24765 | GTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner |
| AT3G03120 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. |
| AT1G02440 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. |
| AT1G02430 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. |
| AT5G13490 | Encodes mitochondrial ADP/ATP carrier |
| AT4G33300 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. |
| AT1G22130 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL104 is expressed in pollen.It forms heterodimers with other MICK family members (AGL65 and AGL30). Involved in late stages of pollen development and pollen tube growth. |
| AT3G57230 | MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes. AGL16 can directly interact with SVP and indirectly interact with FLC. Furthermore, the accumulation of AGL16 transcripts is modulated by miR824 (AT4G24415). The flowering time effect for the miR824/AGL16 module is more obvious in the Col-FRI background than in the Col-0 background. AGL16 controls flowering via a allelic dosage effect in long-day non-vernalized conditions. |
| AT2G45660 | Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA. |
| AT1G65360 | Encodes AGL23, a Type I MADS-box gene that controls female gametophyte development and the biogenesis of organelles during embryo development. |
| AT4G24540 | Encodes a MADS-box protein involved in flowering. Regulates the expression of SOC1 and is also upregulated by SOC1. Binds with IMK3 kinase domain. Phosphorylated by IMK3; likely to be a target for IMK3 kinase domain. |
| AT5G26880 | Root Specific |
| AT1G01530 | AGAMOUS-like 28;(source:Araport11) |
| AT5G65050 | Originally published as Agamous like MADS-box protein AGL31. One of a group of MADS box genes involved in control of flowering time. Four variant sequences have been identified for this locus but have not been characterized for differences in expression pattern and/or function. |
| AT5G62165 | Encodes a MADS box transcription factor. Expressed in quiescent center. Involved in floral transition. |
| AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
| AT1G77980 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL66 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth. |
| AT3G30260 | Agamous-like transcription factor. A target of SPL10, AGL79 knockdowns show defects in leaf shape, shoot branching, and flowering time. |
| AT5G39750 | AGAMOUS-like 81;(source:Araport11) |
| AT3G66656 | AGAMOUS-like 91;(source:Araport11) |
| AT1G46408 | AGAMOUS-like 97;(source:Araport11) |
| AT5G39810 | AGAMOUS-like 98;(source:Araport11) |
| AT5G03640 | AGCVIII kinase involved in the pulse-induced first positive phototropism. |
| AT2G13810 | ALD1 is a L-lysine alpha-aminotransferase. It is part of the pipecolic acid biosynthetic pathway, where it catalyzes the biochemical conversion of lysine to epsilon-amino-alpha-ketocaproic acid (KAC) which is subject to subsequent transamination, cyclization and isomerization to form 2,3-dehydropipecolic acid. |
| AT4G37750 | ANT is required for control of cell proliferation and encodes a putative transcriptional regulator similar to AP2. Loss of function alleles have reduced fertility, abnormal ovules and abnormal lateral organs. Expressed in the chalaza, floral organ primordia, and lateral shoot organ primordia. Regulates growth and cell numbers during organogenesis. |
| AT5G10510 | Encodes an AP2-domain transcription factor involved in root stem cell identity and root development. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. Intronic sequences are required for its expression in flowers.Acts redundantly with PLT5 and 7 in lateral root pattern formation. |
| AT3G12740 | Physically interacts with ALA3, and is required for the phospholipid translocase activity of ALA3. The mRNA is cell-to-cell mobile. |
| AT1G72330 | Encodes for alanine aminotransferase ALAAT2. |
| AT1G50200 | Alanyl-tRNA synthetase;(source:Araport11) |
| AT5G01370 | Nuclear protein with a lysine-rich domain and a C-terminal serine-rich domain. Interacts with Alcatraz (ALC). ACI1 is mainly expressed in the vascular system. Involved in cell separation during fruit dehiscence. |
| AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
| AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
| AT4G34860 | Plant neutral invertase family protein;(source:Araport11) |
| AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
| AT3G25780 | Encodes allene oxide cyclase, one of the enzymes involved in jasmonic acid biosynthesis. One of four genes in Arabidopsis that encode this enzyme. mRNA expression is upregulated in senescing leaves. Note: Nomenclature for Arabidopsis allene oxide cyclase 3 (AOC3, AT3G25780) gene is based on Stenzel et al. 2003 Plant Molecular Biology 51:895-911. AOC3 (AT3G25780) is also referred to as AOC2 in He et al. 2002 Plant Physiology, 128:876-884. The mRNA is cell-to-cell mobile. |
| AT3G52720 | Encodes an alpha carbonic anhydrase (CAH1) located in the chloroplast stroma. Most chloroplast proteins are encoded by the nuclear genome and imported with the help of sorting signals that are intrinsic parts of the polypeptides. CAH1 takes an alternative route through the secretory pathway, and becomes N-glycosylated before entering the chloroplast. Glycosylation and intra-molecular disulfide bridge fromation are necessary for the correct folding, ER export, trafficking and activity of the protein. |
| AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
| AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
| AT1G76130 | alpha-amylase, putative / 1,4-alpha-D-glucan glucanohydrolase, putative, strong similarity to alpha-amylase GI:7532799 from (Malus x domestica);contains Pfam profile PF00128: Alpha amylase, catalytic domain. Predicted to be secreted based on SignalP analysis. |
| AT1G68560 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
| AT1G62020 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. Required for the acceptance of compatible pollen. |
| AT3G54720 | Encodes glutamate carboxypeptidase. Various alleles show-increased cotyledon number and rate of leaf initiation, show transformation of leaves to cotyledons, altered flowering time and photomorphogenesis and an increased level of cytokinin biosynthesis. Involved in ethylene enhanced hypocotyl elongation in the light. Strong genetic interaction between TGH and AMP1. |
| AT2G40475 | hypothetical protein;(source:Araport11) |
| AT2G37330 | Encodes an ABC transporter-like protein, without an ATPase domain, required for aluminum (Al) resistance/tolerance and may function to redistribute accumulated Al away from sensitive tissues in order to protect the growing root from the toxic effects of Al. |
| AT4G17970 | Anion transporter involved in stomatal closure. Gene has 3 splicing variants. |
| AT4G14940 | atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. |
| AT5G63850 | Amino acid transporter whose expression is downregulated by dehydration. |
| AT1G44100 | amino acid permease 5 |
| AT5G49630 | Is a high affinity amino acid transporter capable of transporting aspartate and tryptophan. May be involved in the amino acid uptake from xylem. |
| AT4G21120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. The mRNA is cell-to-cell mobile. |
| AT4G33090 | encodes an aminopeptidase, a ortholog of mouse microsomal AP (EC 3.4.11.2). |
| AT1G26130 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT3G25610 | Encodes aminophospholipid ATPase10 (ALA10), a P4-type ATPase flippase that internalizes exogenous phospholipids across the plasma membrane. |
| AT4G13510 | Encodes a plasma membrane localized ammonium transporter. Contains a cytosolic trans-activation domain essential for ammonium uptake. The mRNA is cell-to-cell mobile. |
| AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
| AT3G24300 | Encodes a plasma membrane localized ammonium transporter. |
| AT2G38290 | encodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively. |
| AT2G18290 | Encodes APC10 (anaphase promoting complex 10). Overexpression of APC10 likely mimics auxin and ethylene sensitive phenotypes. Plays an essential role in cell proliferation during leaf development. |
| AT2G39090 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
| AT5G54610 | Induced in response to Salicylic acid. Belongs to the ankyrin repeat protein family. |
| AT5G66055 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
| AT5G02620 | Encodes a member of the ankyrin repeat protein. Localized in the endoplasmic reticulum. |
| AT2G38760 | Annexins are calcium binding proteins that are localized in the cytoplasm. When cytosolic Ca2+ increases, they relocate to the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT3G63270 | A mutation in ANTAGONIST OF LHP1 1 (ALP1) suppresses the phenotype of lhp1 mutant plants. ALP1 interacts genetically with several PcG and trxG components and antagonizes PcG silencing. The interaction has a negative effect on polycomb-mediated gene repression since double mutant combinations of clf alp1 or lhp1 alp1 show supression of the clf and lhp1 single mutant phenotypes. ALP1 domestication probably occured at the root of angiosperm diversification coincident with mutation of conserved residues important for endonuclease activity. |
| AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT4G13540 | ADR is a peroxisome localized, myristoylated protein. It is expressed in flowers and plays a role in suppressing ROS accumulation in anthers. Overexpression results in reduced ROS, lower levels of NST1 and NST2 and, consequently alterations in lignification of the anther endothecium resulting in male sterility. |
| AT5G61160 | anthocyanin 5-aromatic acyltransferase 1;(source:Araport11) |
| AT4G00730 | Encodes a homeodomain protein of the HD-GLABRA2 group. Involved in the accumulation of anthocyanin and in root development. Loss of function mutants have increased cell wall polysaccharide content. |
| AT2G21120 | Encodes a putative magnesium transporter that was identified through a forward genetic screen, directly isolating antiviral RNAi-defective (avi) mutant using a Cucumber Mosaic Virus (CMV) mutant. Compared to Wildtype Col-0, avi2 mutant showed severe disease symptom after viral infection and viral accumulation was significantly increased while viral siRNAs and virus-activated endogenous siRNAs (vasiRNAs) were reduced in avi2 mutant. Detailed genetic study indicated that AVI2 modulated RNAi-mediated antiviral immunity by regulating the biogenesis of secondary viral siRNAs and vasiRNAs in Arabidopsis. |
| AT4G13040 | Encodes a member of the AP2/EREBP transcription factor family that has only one AP2 domain. It is a positive regulator of disease defense that functions upstream of SA accumulation. |
| AT3G54340 | Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies petal and stamen identities. Associates with PISTILLATA. |
| AT5G10760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G78860 | curculin-like (mannose-binding) lectin family protein, low similarity to Ser/Thr protein kinase (Zea mays) GI:2598067; contains Pfam profile PF01453: Lectin (probable mannose binding) but not the protein kinase domain of the Z. mays protein |
| AT3G03860 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile. |
| AT5G01310 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT4G04610 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile. |
| AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT3G04080 | Encodes an Golgi-localized integral membrane enzyme with nucleoside diphosphate activity that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.With respect to substrate specificity, APY1 shows the following preferences UTP>IDP>GDP. |
| AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
| AT4G38220 | Peptidase M20/M25/M40 family protein;(source:Araport11) |
| AT1G52930 | Encodes one of two Arabidopsis orthologs of yeast BRX1, a protein involved in maturation of the large ribosomal subunit. The proteins are mainly localized in nucleolus. Mutant plants are affected in pre-rRNA processing. |
| AT1G62700 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
| AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
| AT5G06750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G51300 | Encodes a nuclear localized splicing factor homolog that is involved in alternative splicing of some mRNAs. |
| AT2G28130 | NSE5 subunit of the SMC5/6 complex. |
| AT1G72200 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G43420 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G15975 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46495 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G74410 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09110 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34990 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G47560 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G18930 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G07040 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35910 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G06490 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46494 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G53110 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G78440 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. |
| AT1G17860 | Member of Kunitz trypsin inhibitor (KTI) family involved in plant defense response against spider mites. |
| AT5G15550 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G22500 | Gene encodes a putative C3HC4-type RING zinc finger factor. it is induced in response to light and ascorbate stimulus. |
| AT1G49230 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35000 | ATL9 is an E3 ligase-like protein that is induced by chitin oligomers and contributes to fungal resistance.It differs from other members of the ATL family in that it has a PEST domain. It is a short lived protein that is subject to proteosome mediated degradation. It is expressed in many aerial tissues in a pattern that varies with developmental stage. |
| AT5G44930 | Encodes a putative arabinosyltransferase that is associated with arabinan biosynthesis and is not redundant with ARAD1. The two glycosyltransferases may function in complexes held together by disulfide bridges. |
| AT4G37450 | AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers and is active in the regulation of the selection and survival of megaspores. |
| AT3G01700 | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP11 function results in decreased fertility due to defects in pollen tube growth. |
| AT5G11740 | Encodes arabinogalactan protein (AGP15). The mRNA is cell-to-cell mobile. |
| AT5G53250 | arabinogalactan protein 22;(source:Araport11) |
| AT2G33790 | pollen Ole e 1 allergen protein containing 14.6% proline residues, similar to arabinogalactan protein (Daucus carota) GI:11322245, SP:Q03211 Pistil-specific extensin-like protein precursor (PELP) {Nicotiana tabacum}; contains Pfam profile PF01190: Pollen proteins Ole e I family |
| AT5G10430 | Encodes arabinogalactan-protein (AGP4) that is expressed in female reproductive tissues. It is involved in promoting degeneration of the persistent synergid after fertilization. In mutant ovules, the persistent synergid does not degrade resulting in polytuby. |
| AT1G35230 | Encodes arabinogalactan-protein (AGP5). The mRNA is cell-to-cell mobile. |
| AT5G14380 | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP6 function results in decreased fertility due to defects in pollen tube growth. |
| AT5G36925 | hypothetical protein;(source:Araport11) |
| AT5G61980 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD1 belongs to the class 1, together with AGD2, AGD3 and AGD4. Not expressed in hypocotyls and cotyledons. |
| AT4G05330 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT1G60860 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD2 belongs to the class 1, together with AGD1, AGD3, and AGD4. |
| AT1G10870 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD4 belongs to the Class 1, together with AGD1, AGD2, and AGD3. |
| AT3G53710 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT4G17890 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT5G46750 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. The mRNA is cell-to-cell mobile. |
| AT4G08900 | Encodes an arginase, likely to be involved in polyamine biosynthesis in pollen. |
| AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
| AT3G61860 | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT5G52040 | Encodes an arginine/serine-rich splicing factor. Transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS41 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis. |
| AT2G27040 | AGO4 is a member of a class of PAZ/PIWI domain containing proteins involved in siRNA mediated gene silencing.Loss of function mutations have reduced site specific CpNpG and CpHpH methylation, abnormal ovule/megagametophyte develoment and increased susceptibility to bacterial pathogens including Tobacco rattle virus. |
| AT2G32940 | Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing. |
| AT5G08730 | IBR domain-containing protein;(source:Araport11) |
| AT1G65430 | IBR domain-containing protein;(source:Araport11) |
| AT2G31770 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G01950 | Encodes a member of the armadillo/beta-catenin repeat kinesin motor family. Mutants have twisted roots due to abnormal cell file rotation; the phenotype is dependent on microtubules. |
| AT3G26600 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
| AT3G02890 | PHD protein which cooperates with PAIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT2G47760 | Encodes an α-1,3-mannosyltransferase. Plants with mutations in the ALG3 protein have abnormal gylcoslation profiles. They also exhibit abnormal responses to MAMPs possibly because the glycan properties of FL22 are affected. |
| AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
| AT2G22250 | Encodes a prokaryotic-type plastidic aspartate aminotransferase with glutamate/aspartate-prephenate aminotransferase (PAT) activity. |
| AT3G18490 | Encodes ASPG1 (ASPARTIC PROTEASE IN GUARD CELL 1). Functions in drought avoidance through abscisic acid (ABA) signalling in guard cells. |
| AT1G11910 | Encodes an aspartic proteinase that forms a heterodimer and is stable over a broad pH range (ph 3-8). |
| AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
| AT3G61310 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT3G04590 | AHL proteins contain two conserved structural units, the AT-hook motif and DUF296 domain. |
| AT2G35270 | Direct target of AGAMOUS. Regulates patterning and differentiation of reproductive organs. |
| AT4G22810 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT4G35390 | AT-hook protein of GA feedback 1;(source:Araport11) |
| AT4G25320 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT5G51590 | Member of the 29 AT-hook family TFs involved in the development of root xylem. |
| AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT2G45850 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G14465 | AT-hook protein. Overexpression results in early flowering in short and long days. |
| AT1G48980 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G36090 | oxidoreductase, 2OG-Fe(II) oxygenase family protein;(source:Araport11) |
| AT2G45490 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. The protein is concentrated in nuclear dots arranged around the nucleolus and the nuclear periphery in early prophase cells. |
| AT5G40820 | Encodes a Arabidopsis ortholog of the ATR protein kinase that is involved in a wide range of responses to DNA damage and plays a central role in cell-cycle regulation. Dominant loss of function alleles identified as suppressors of ALS also exhibit increased tolerance to aluminum. This may be due to the inhibition of terminal differentiation of the root apex upon exposure to Al. |
| AT3G48190 | Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
| AT3G17100 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT1G09250 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G45980 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1. |
| AT4G00355 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. |
| AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
| AT1G09795 | ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis |
| AT1G71960 | Encodes a plasma membrane localized ABC transporter involved in abscisic acid transport and responses. |
| AT2G41700 | ATP-binding cassette A1;(source:Araport11) |
| AT3G47730 | member of ATH subfamily |
| AT3G47780 | member of ATH subfamily The mRNA is cell-to-cell mobile. |
| AT2G36910 | Belongs to the family of ATP-binding cassette (ABC) transporters. Also known as AtMDR1.Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AT3G28860. PGP1 mediates cellular efflux of IAA and interacts with PIN genes that may confer an accelerated vectoral component to PGP-mediated transport. The non-polar localization of PGP1 at root and shoot apices, where IAA gradient-driven transport is impaired, may be required to confer directionality to auxin transport in those tissues. The mRNA is cell-to-cell mobile. |
| AT1G02520 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. The mRNA is cell-to-cell mobile. |
| AT1G02530 | P-glycoprotein 12;(source:Araport11) |
| AT3G28345 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT3G28380 | P-glycoprotein 17;(source:Araport11) |
| AT3G28390 | P-glycoprotein 18;(source:Araport11) |
| AT3G55320 | P-glycoprotein 20;(source:Araport11) |
| AT4G28630 | Half-molecule ABC transporter ATM1. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
| AT4G28620 | Half-molecule ABC transporter ATM2. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
| AT1G70610 | member of TAP subfamily |
| AT5G39040 | Encodes a member of TAP subfamily of ABC transporters that is located in the vacuole. Mutants are hypersensitive to aluminum and the gene product may be important for intracellular movement of some substrate, possibly chelated Al, as part of a mechanism of aluminum sequestration. |
| AT2G47000 | Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. |
| AT1G30420 | member of MRP subfamily |
| AT2G34660 | encodes a multidrug resistance-associated protein that is MgATP-energized glutathione S-conjugate pump. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. The mRNA is cell-to-cell mobile. |
| AT3G13080 | encodes an ATP-dependent MRP-like ABC transporter able to transport glutathione-conjugates as well as chlorophyll catabolites. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT4G30300 | member of NAP subfamily |
| AT5G60790 | Member of GCN subfamily; essential for translation inhibition under cold stress through interacting with GCN2 to phosphorylate eukaryotic translation initiation factor 2. GCN1 regulated gens are involved in flower development, seed dormancy and seed development, response to osmotic stress, amino acid biosynthesis, photosynthesis, cell wall organization, protein transport and localization, lipid biosynthesis, transcription, macroautophagy, proteolysis and cell death. |
| AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT1G17840 | Encodes a plasma membrane-localized ATP-binding cassette transporter, that is required for cutin transport to the extracellular matrix. The mRNA is cell-to-cell mobile. |
| AT1G51500 | Encodes an ABC transporter involved in cuticular wax biosynthesis. Lines carrying recessive mutations in this locus have weakly glaucous stem surface, and relative elevated secondary alcohols and ketones. |
| AT3G55090 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT3G25620 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
| AT3G16340 | Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis. |
| AT2G37280 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT2G36380 | pleiotropic drug resistance 6;(source:Araport11) |
| AT3G53480 | Negative regulator of auxin polar transport inhibitors. ABCG37 regulates auxin distribution and homeostasis in roots by excluding IBA from the root apex, but does not act directly in basipetal transport. ABCG37 and ABCG36 act redundantly at outermost root plasma membranes and, transport IBA out of the cells. Also involved in root transmembrane secretion of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
| AT4G15215 | pleiotropic drug resistance 13;(source:Araport11) |
| AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
| AT3G21580 | cobalt ion transmembrane transporter;(source:Araport11) |
| AT1G67940 | member of NAP subfamily The mRNA is cell-to-cell mobile. |
| AT1G10670 | One of the three genes encoding subunit A of the trimeric protein ATP Citrate Lyase. Antisense ACLA-1 plants cause a reduction in cytosolic acetyl-CoA metabolism and have upregulation of stress-related genes and down-regulation of primary metabolism and growth genes, suggesting the mutation restricts normal growth and developmental processes and puts the plant into a state of stress. |
| AT1G09430 | Encodes subunit A of the heteromeric enzyme ATP citrate lyase (ACL). In animals, ACL is encoded by a single gene; ACL in Arabidopsis is composed of two polypeptides, ACLA (encoded by 3 genes) and ACLB (encoded by 2 genes). The holoenzyme has an A(4)B(4)stoichiometry. Expression of both ACLA and ACLB but not of either of the subunits alone results in ACL activity. |
| AT3G22150 | Involved in RNA editing of plastid atpF and mitochondrial nad5. |
| AT5G61440 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. The mRNA is cell-to-cell mobile. |
| AT3G63380 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT4G29900 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
| AT3G21180 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
| AT1G27770 | Encodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor. |
| AT3G57330 | Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA4. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate) |
| AT1G13210 | Autoinhibited Ca2+/ATPase II. ALA11 acts redundantly with ALA3, ALA4, ALA5, ALA9, ALA10 in root and shoot development as well as PIN trafficking and polarity . |
| AT3G62770 | Required for autophagosome formation during nutrient deprivation and senescence, promotes pexophagy during seedling development. |
| AT3G19190 | Encodes autophagy-related 2 (ATG2). The mRNA is cell-to-cell mobile. |
| AT3G06420 | Autophagy protein. |
| AT5G66930 | meiotically up-regulated protein;(source:Araport11) |
| AT4G36520 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G30280 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G49980 | auxin F-box protein 5;(source:Araport11) |
| AT5G43700 | Auxin inducible protein similar to transcription factors. |
| AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
| AT1G05180 | Encodes a subunit of the RUB1 activating enzyme that regulates the protein degradation activity of Skp1-Cullin-Fbox complexes, primarily, but not exclusively, affecting auxin responses. Acts alongside AS1 to exclude BP expression from leaves. Promotes degradation of the cytokinin response repressor ARR5. Affects expression of key DNA repair and meiotic genes, signifcant role in DNA repair. |
| AT1G54990 | auxin response mutant (AXR4) The mRNA is cell-to-cell mobile. |
| AT1G35240 | auxin response factor 20;(source:Araport11) |
| AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
| AT3G26810 | Auxin F box protein, the dominant auxin receptor in roots. |
| AT3G07390 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. The mRNA is cell-to-cell mobile. |
| AT2G04160 | isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein similar to subtilisin-like serine protease which is believed to be active outside the plant cell. |
| AT2G34680 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. |
| AT3G59900 | Encodes ARGOS (Auxin-Regulated Gene Involved in Organ Size). Inducible by auxin. Involved in lateral organ size control. Transgenic plants expressing sense or antisense ARGOS cDNA display enlarged or reduced aerial organs, respectively. The alteration in organ size is attributable mainly to changes in cell number and the duration of organ growth. |
| AT5G13160 | Mutant is defective in perception of Pseudomonas syringae avirulence gene avrPphB. Encodes a putative serine-threonine kinase. |
| AT5G50300 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
| AT4G12470 | Encodes AZI1 (AZELAIC ACID INDUCED 1). Involved in the priming of salicylic acid induction and systemic immunity triggered by pathogen or azelaic acid. Targeting if AZI1 to chloroplasts is increased during SAR induction and that localization requires the PRR domain.It is involved in the uptake and movement of the azelaic acid signal. AZI1 uses a previously undescribed variant of the signal anchor proteins mechanism to target plastids. AZI1 uses a bipartite N-terminal signature: a non-cleavable TMD that anchors the protein to membranes, followed by a proline rich region with features that are shared with bona fide chloroplastic transit peptides. flg22 MAMP treatment strongly induces AZI1/EARLI1 protein levels and increases their relative enrichment in the plastid fraction. |
| AT5G54470 | B-box type zinc finger family protein;(source:Araport11) |
| AT3G21890 | B-box type zinc finger family protein;(source:Araport11) |
| AT5G48380 | Encodes a BAK1-interacting receptor-like kinase named BIR1. Negatively regulates multiple plant resistance signaling pathways, one of which is the SOBIR1(AT2G31880)-dependent pathway. |
| AT3G45260 | BIB is a member of the BIRD family of zinc finger proteins that includes JKD. BIB functions redundantly with JKD to retain SHR in the nucleus and thereby restrict SHR movement in root tissues. |
| AT4G15370 | Encodes an oxidosqualene cyclase that primarily produces the tetracyclic triterpene baruol in vitro and when expressed in yeast. It can also make 22 other minor triterpenoid products with varying numbers of rings. |
| AT1G06170 | Encodes a bHLH transcription factor that together with bHLH010 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. Recognizes the TCATGTGC box to activate the expression of target genes, including ATA20, EXL4, and MEE48. |
| AT3G56980 | Encodes a member of the basic helix-loop-helix transcription factor protein. |
| AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G18160 | Encodes a b-ZIP transcription factor. |
| AT2G21230 | bZIP30 is a transcriptional activator that is involved in regulation of growth and development of reproductive organs. It interacts with a number of developmental regulators including WUS, HEC1, KNAT1/BP, KNAT2, JAB, BEL1, and NGA1. |
| AT3G30530 | basic leucine-zipper 42;(source:Araport11) |
| AT1G13600 | basic leucine-zipper 58;(source:Araport11) |
| AT1G06070 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT2G35550 | basic pentacysteine 7;(source:Araport11) |
| AT3G09000 | Encodes a microtubule-associated protein. Plays a minor role in cortical microtubule organization during leaf development. |
| AT2G17770 | Encodes a paralog of bZIP transcription factor FD. This protein interacts with FD and FT. |
| AT3G62420 | Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene. |
| AT2G35530 | Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members. |
| AT5G47120 | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. The mRNA is cell-to-cell mobile. |
| AT1G68180 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G01980 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G60920 | beige/BEACH domain protein;(source:Araport11) |
| AT1G77890 | One of a pair of paralogs (the other is AT4G08540)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex but is not essential for PI3P biosynthesis. |
| AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
| AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
| AT4G36780 | BES1/BZR1 homolog 2;(source:Araport11) |
| AT1G70410 | Encodes a putative beta-carbonic anhydrase betaCA4. Together with betaCA1 (At3g01500) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. |
| AT3G13750 | beta-galactosidase, glycosyl hydrolase family 35 The mRNA is cell-to-cell mobile. |
| AT1G45191 | beta-glucosidase related protein, similar to beta-glucosidase GI:3820531 from (Pinus contorta); contains Pfam profile: PF00232 Glycosyl hydrolase family 1 |
| AT5G16580 | beta glucosidase 2;(source:Araport11) |
| AT5G28510 | beta glucosidase 24;(source:Araport11) |
| AT3G60120 | beta glucosidase 27;(source:Araport11) |
| AT5G24540 | beta glucosidase 31;(source:Araport11) |
| AT1G62710 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins. |
| AT3G57240 | encodes a member of glycosyl hydrolase family 17 |
| AT5G20330 | beta-1,3-glucanase 4;(source:Araport11) |
| AT3G52060 | Encodes a plasmodesmal glycosyltransferase-like protein. Mutation results in defects in seed germination and delayed plant growth. |
| AT4G00490 | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. It forms a tetramer whose activity requires K+ and exhibits sigmoidal kinetics Mutants of BAM2 have no visible phenotype. |
| AT2G32290 | beta-amylase 6;(source:Araport11) |
| AT2G45880 | Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays. |
| AT1G55120 | Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. |
| AT4G26140 | putative beta-galactosidase |
| AT1G77410 | beta-galactosidase 16;(source:Araport11) |
| AT1G72990 | beta-galactosidase 17;(source:Araport11) |
| AT3G52840 | beta-galactosidase 2;(source:Araport11) |
| AT5G56870 | beta-galactosidase 4;(source:Araport11) |
| AT1G45130 | beta-galactosidase 5;(source:Araport11) |
| AT5G39990 | Encodes GlcAT14A, a beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan. The protein was localized to the Golgi apparatus when transiently expressed in Nicotiana benthamiana. Plays a role in cell elongation during seedling growth. |
| AT3G55260 | Encodes a protein with β-hexosaminidase activity (the enzyme is active with p-nitrophenyl-β-N-acetylglucosaminide as substrate but displayed only a minor activity toward p-nitrophenyl-β-N-acetylgalactosaminide). The enzyme displays no distinct preference for a specific terminal GlcNAc residue and indeed cleaved the asialoagalactodabsylglycopeptide GnGn to a mixture of products. |
| AT1G24470 | Encodes one of the two Arabidopsis homologues to YBR159w encoding a S. cerevisiae beta-ketoacyl reductase (KCR), which catalyzes the first reduction during VLCFA (very long chain fatty acids, >18 carbon) elongation: KCR1 (At1g67730), KCR2 (At1g24470). Complementation of the yeast ybr159Delta mutant demonstrated that the two KCR proteins are divergent and that only AtKCR1 can restore heterologous elongase activity similar to the native yeast KCR gene. |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT5G09730 | Encodes a protein similar to a beta-xylosidase located in the extracellular matrix. It is able to degrade terminal arabinosyl residues and likely participates in the in-vivo hydrolysis of arabinan. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT2G01170 | Encodes a bidirectional amino acid transporter that can transport ala, arg, glu and lys, GABA but not pro with both export and import activity. Its expression is localized in the vascular tissues suggesting a function in amino acids export from the phloem into sink tissue. |
| AT3G02260 | Calossin-like protein required for polar auxin transport. Involved in regulating sugar response and C/N balance. |
| AT1G69160 | suppressor;(source:Araport11) |
| AT1G13670 | hypothetical protein;(source:Araport11) |
| AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
| AT4G38200 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
| AT3G60860 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. The mRNA is cell-to-cell mobile. |
| AT4G22840 | Sodium Bile acid symporter family;(source:Araport11) |
| AT5G04430 | Gene model AT5G04430.1 produces active protein. (BTS1S). Binds to ToMV genomic RNA and prevents viral multiplication. |
| AT3G57130 | Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus. |
| AT2G30330 | Putative homolog of mammalian BLOC-1 Subunit 1. Protein - protein interaction with BLOS2 and also with SNX1.Located in endomembrane system and hypothesized to be involved in endomembrane transport. |
| AT4G18950 | BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening. |
| AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
| AT1G14580 | C2H2-like zinc finger protein;(source:Araport11) |
| AT5G11250 | Encodes an atypical TIR-NBS-LRR protein that is involved in stress responses. Loss of function alleles overproduce stress hormones JA,SA, ABA, and ET. |
| AT5G53400 | Encodes BOBBER1 (BOB1), a non-canonical small heat shock protein required for both development and thermotolerance. BOB1 is cytoplasmic at basal temperatures but forms heat shock granules containing canonical small heat shock proteins at high temperatures. The mRNA is cell-to-cell mobile. |
| AT3G61190 | Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis. |
| AT2G45760 | encodes a protein that is similar to BONZAI1-binding protein BAP1. |
| AT5G07300 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. |
| AT3G19540 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
| AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT5G32450 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT4G31910 | Encodes an acyltransferase that can modify brassinosteroids (BRs) by acylation and may modulate endogenous BR levels. |
| AT2G46020 | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D. |
| AT1G55510 | branched-chain alpha-keto acid decarboxylase E1 beta |
| AT2G42160 | Encodes a RING domain containing protein BRIZ1. BRIZ1 (At2g42160) and BRIZ2 (At2g26000) proteins form a heteromeric E3 ligase complex required for seed germination and post-germination growth. |
| AT4G15400 | Encodes BIA1, a member of the BAHD acyltransferase family. Plays a role in controlling brassinosteroids levels, particularly in the root and hypocotyl in darkness. |
| AT5G47950 | BIA2 is a putative HXXXD-type BAHD acyltransferase. Overexpression results in a BR deficient phenotype and is dependent on a functional HXXXD motif. BIA2 may function in BR homeostasis by regulating the pool of bioactive BR. |
| AT4G35230 | Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT5G01060 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT5G46570 | Encodes BR-signaling kinase 2 (BSK2), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G00710 | Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT5G59010 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT1G63500 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT1G54180 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT1G03445 | encodes a serine?threonine protein phosphatase with an N-terminal Kelch-repeat domain, which is nuclear localized and expressed preferentially in elongating cells. Genetic evidence suggest that this gene plays a redundant role (along with other members of the same gene family) in modulating growth in response to brassinosteroid. |
| AT4G03080 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
| AT2G45400 | involved in the regulation of brassinosteroid metabolic pathway |
| AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
| AT5G14270 | Bromodomain protein that functions as a negative regulator of sugar and ABA signaling. |
| AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT5G62040 | BFT is a member of The FLOWERING LOCUS T (FT)/TERMINAL FLOWER 1 (TFL1) gene family that encodes regulators involved in control of flower development. |
| AT1G03457 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G18290 | Encodes BRUTUS (BTS), a putative E3 ligase protein with metal ion binding and DNA binding domains, which negatively regulates the response to iron deficiency. The mRNA is cell-to-cell mobile. |
| AT1G18910 | E3 ubiquitin ligase that functions redundantly in the root with BTSL1 to negatively regulate iron uptake. |
| AT2G40400 | Encodes a chloroplast localized protein of unknown function that is involved in regulation of chloroplast development. |
| AT3G48360 | Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones. |
| AT4G37610 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT5G19000 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT2G21480 | BUSP2 plays a smaller role than BUSP1 in pollen tube growth. bups1/2 double mutants have reduced feritlity due to premature rupture of pollen tubes before they reach the ovule but single busp2 mutants are fertile. BUSP2 interacts with RALF4/19 peptide ligands and ANX1/2 receptors. BUPS/ANX signaling may regulate and promote pollen tube growth. |
| AT5G18930 | S-adenosylmethionine decarboxylase family member. |
| AT1G18740 | DUF793 domain containing protein. Expression is induced by cold. Loss of function mutations are more sensitive to freezing and have reduced levels of CBFs. May act by preventing degradation of CBFs. |
| AT1G29290 | Group II CEP family member; binds to vascular tissue independently of CEPR1 or CRA2. |
| AT3G50610 | DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11) |
| AT1G70810 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G56170 | Encodes a calcium-dependent nuclease with similarity to staphylococcal nuclease. |
| AT4G01840 | Encodes AtTPK5, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK5 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
| AT5G49480 | AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. The mRNA is cell-to-cell mobile. |
| AT1G64980 | Encodes a putative nucleotide-diphospho-sugar transferase required for pollen germination and tube growth. |
| AT5G44070 | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. The mRNA is cell-to-cell mobile. |
| AT4G26220 | Encodes a caffeoyl-coenzyme A O-methyltransferase (CCoAOMT)-like protein with a strong preference for methylating the para position of flavanones and dihydroflavonols, whereas flavones and flavonols are methylated in the meta-position. |
| AT4G34050 | Methyltransferase in the lignin biosynthetic pathway. |
| AT4G17615 | Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation. |
| AT4G26560 | Encodes calcineurin B-like protein 7 (CBL7).Interacts with and modulates the activity of the PM ATPase AHA2. |
| AT5G47100 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo. |
| AT4G37640 | Encodes a calmodulin-regulated Ca(2+)-pump located in the endoplasmic reticulum. Belongs to plant 2B ATPase's with an N-terminal autoinhibitor. |
| AT2G17290 | Encodes calcium dependent protein kinase 6 (CPK6), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK6 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. The protein kinase CPK6 is shown in biochemical assays to be directly activated by elevations in calcium concentrations in the physiological range (Laanements et al., 2013 PlantPhys.; PMID: 23766366). These data correlate with the in vivo function of CPK6 in Ca2+ and ABA activation of S-type anion channels (Mori et al., 2006 PLoS Biol.; PMID: 17032064) and the ability of CPK6 to mediate ABA activation of SLAC1 (Brandt et al., 2012 PNAS; PMID: 22689970). The mRNA is cell-to-cell mobile. |
| AT1G18890 | encodes a calcium-dependent protein kinase whose gene expression is induced by dehydration and high salt. Kinase activity could not be detected in vitro. |
| AT5G12180 | member of Calcium Dependent Protein Kinase |
| AT4G04720 | member of Calcium Dependent Protein Kinase |
| AT4G04710 | member of Calcium Dependent Protein Kinase |
| AT4G04740 | member of Calcium Dependent Protein Kinase |
| AT4G04700 | member of Calcium Dependent Protein Kinase |
| AT1G76040 | member of Calcium Dependent Protein Kinase |
| AT4G04695 | member of Calcium Dependent Protein Kinase. Involved in response to salicylic acid. |
| AT3G57530 | Calcium-dependent Protein Kinase. ABA signaling component that regulates the ABA-responsive gene expression via ABF4. AtCPK32 has autophosphorylation activity and can phosphorylate ABF4 in vitro |
| AT1G05570 | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
| AT1G06490 | Encodes Callose Synthase 7 (CalS7), a phloem-specific callose synthase responsible for callose deposition in developing sieve elements during phloem formation and in mature phloem induced by wounding. |
| AT3G16030 | lectin protein kinase family protein;(source:Araport11) |
| AT2G41010 | Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress. |
| AT2G41110 | Encodes a touch-inducible calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. The mRNA is cell-to-cell mobile. |
| AT3G56800 | encodes a calmodulin |
| AT5G21274 | Encodes a calmodulin isoform. Expressed in leaves. |
| AT3G51920 | encodes a divergent member of calmodulin, which is an EF-hand family of Ca2+-binding proteins. This gene is expressed in leaves, flowers and siliques. The gene functionally complements yeast calmodulin 1 (CAM1) but only when selected against the plasmid harboring wild-type yeast sequences. Also the protein does not form formed a complex with a basic amphiphilic helical peptide in the presence of Ca2+ in vitro. Authors suggest that this gene may represent a Ca2+-binding sensor protein that interacts with a more limited set of target proteins than do more conventional CaM isoforms. Mutations in this gene alter plant responses to abiotic stress and abscisic acid. |
| AT3G25600 | Calmodulin like protein. Paralog of CML15. |
| AT5G44460 | Calcium sensor. |
| AT4G35987 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G35310 | calmodulin-domain protein kinase CDPK isoform 5 (CPK5) |
| AT3G20410 | calmodulin-domain protein kinase CDPK isoform 9 (CPK9) |
| AT3G10660 | predicted to encode calcium-dependent protein kinase and is localized to the ER. Protein is myristoylated in a cell-free extract. Changing the proposed myristoylated site, G residue in the amino terminal, to A prevented the meristoylation . The G to A mutation decreased AtCPK2 membrane association by approximately 50%. |
| AT1G09210 | Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress. |
| AT3G56690 | encodes a protein similar to ATPases and binds to calmodulin in vitro. This is a single-copy gene and is expressed in all tissues examined. |
| AT5G26920 | Encodes a calmodulin-binding protein CBP60g (calmodulin binding protein 60-like.g). The calmodulin-binding domain is located near the N-terminus; calmodulin binding is dependent on Ca(2+). Inducible by both bacterial pathogen and MAMP (microbe-associated molecular pattern) treatments. Bacterial growth is enhanced in cbp60g mutants. cbp60g mutants also show defects in salicylic acid (SA) accumulation and SA signaling. |
| AT1G78955 | Encodes a cyclase that generates predominantly a monocyclic triterpene alcohol. The product is 97% camelliol, 2% achilleol A and 0.2% beta-amyrin. Achilleol is an isomer of camelliol C with a 4-methylenecyclohexanol ring system. |
| AT1G04260 | Encodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors. |
| AT4G34580 | Encodes COW1 (can of worms1), a phosphatidylinositol transfer protein essential for root hair tip growth. The N-terminus of the COW1 protein is 32% identical to an essential phosphatidylinositol transfer protein (PITP), the yeast Sec14 protein (sec14p) while the C-terminus is 34.5% identical to a late nodulin of Lotus japonicus, Nlj16. Expression of COW1 complements the growth defect associated with Sec14p dysfunction in yeast. GFP fused to the COW1 protein specifically accumulates at the site of root hair outgrowth. |
| AT3G59090 | tobamovirus multiplication protein;(source:Araport11) |
| AT5G02630 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT5G27210 | Protein of unknown function, transmembrane-40;(source:Araport11) |
| AT2G46410 | Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF. |
| AT3G27740 | Encodes carbamoyl phosphate synthetase (CPS) small subunit (carA), also named as VEN6. Heterologous expression of the Arabidopsis VEN3 and VEN6 genes in a CPS-deficient Escherichia coli strain fully restored bacterial growth in minimal medium, demonstrating the enzymatic activity of the VEN3 and VEN6 proteins. |
| AT1G29900 | Encodes carbamoyl phosphate synthetase (CPS) large subunit (CARB), also named as VEN3. Heterologous expression of the Arabidopsis VEN3 and VEN6 genes in a CPS-deficient Escherichia coli strain fully restored bacterial growth in minimal medium, demonstrating the enzymatic activity of the VEN3 and VEN6 proteins. |
| AT5G27420 | Encodes CNI1 (Carbon/Nitrogen Insensitive1) (also named as ATL31), a RING type ubiquitin ligase that functions in the Carbon/Nitrogen response for growth phase transition in Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
| AT3G01500 | Encodes a putative beta-carbonic anhydrase betaCA1. Together with betaCA4 (At1g70410) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. Activated by OXS2 under the treatment of salt. |
| AT5G62180 | Carboxyesterase that binds stringolactones. |
| AT5G01270 | Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses. |
| AT3G63520 | Encodes a protein with 9-cis-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including β-carotene, lutein, zeaxanthin, and all-trans-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-cis-double or allenic bonds. The mRNA is cell-to-cell mobile. |
| AT4G26100 | Encodes a member of the casein kinase 1 protein family that is expressed in punctate particles at the cell periphery suggesting possible plasmodesmatal localization (member of CKL-B group). |
| AT5G57015 | Member of CKL gene family (member of CKL-B group). |
| AT4G28860 | Member of CKL gene family (CKL-A group) |
| AT4G28540 | Member of CKL gene family (CKL-C group). |
| AT3G60250 | Regulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis |
| AT1G04440 | Member of CKL gene family (CKL-C group). |
| AT4G14670 | This locus was originally annotated as encoding ClpB2 (also referred to as Hsp92.7), which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. However, according to Lee et al. (2007, Plant Journal, 49:115-127), there is no evidence for expression of an appropriate-sized mRNA from this locus. Re-annotation of the genome indicates that this locus potentially encodes a 68.8-kDa protein, containing only the N-terminal two thirds of the originally predicted open reading frame. This locus contains a 626-bp deletion in WS ecotype compared with the Col ecotype, which eliminates residues 1-86 of the predicted protein. |
| AT2G25140 | Encodes ClpB4, which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. Targeted to the mitochondrion, also referred to as ClpB-m. Transcripts of ClpB4 accumulate dramatically at high temperatures, suggesting that it may be involved in response to heat stress. |
| AT4G20390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G16300 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G39530 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G39518 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G37200 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G35600 | Encodes a receptor-like cytoplasmic kinase that acts as a spatial inhibitor of cell separation. Analysis of the cDNA previously described in Meiners et al., 1991 revealed mistakes in the predicted open reading frame. The mRNA is cell-to-cell mobile. |
| AT1G73875 | Deadenylase. |
| AT4G35090 | Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. Note that in Queval et al. (2007) Plant Journal, 52(4):640, SALK_057998 is named as cat2-1, SALK_076998 is named as cat2-2; in Bueso et al. (2007) Plant Journal, 52(6):1052, SALK_076998 is named as cat2-1. TAIR has adopted the nomenclature consistent with that in Bueso et al. (2007) after consultation with the authors: SALK_076998 (cat2-1), SALK_057998 (cat2-2). |
| AT1G54115 | Involved in cation (Na and K) homeostasis. |
| AT5G01490 | Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress. |
| AT1G55730 | member of Low affinity calcium antiporter CAX2 family |
| AT5G22910 | member of Putative Na+/H+ antiporter family |
| AT1G64170 | member of Putative Na+/H+ antiporter family |
| AT4G23700 | member of Putative Na+/H+ antiporter family |
| AT3G53720 | member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells. |
| AT1G08140 | member of Putative Na+/H+ antiporter family |
| AT5G36940 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
| AT5G04770 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. Expressed in sink tissues. Induced during infestation of roots by the plant parasitic root-knot nematode, Meloidogyne incognita. Localized in the plasma membrane. |
| AT3G10600 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
| AT1G17120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
| AT2G38270 | Encodes protein homologous to CXIP1. CXIP1 is a PICOT domain containing protein interacts with CAX1, a high capacity calcium transporter. However, CXP2 does not interact with CAX1 and only moderately activates another calcium transporter CAX4. |
| AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
| AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
| AT2G34180 | Encodes CBL-interacting protein kinase 13 (CIPK13). |
| AT5G01810 | Encodes a CBL-interacting serine/threonine protein kinase, also has similarities to SOS2 kinase. |
| AT1G29230 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.20), which has also been reported as a member of the CBL-interacting protein kinases (CIPK18). |
| AT5G57630 | CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress. |
| AT2G38490 | member of AtCIPKs |
| AT2G33590 | Encodes a protein with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. The expression pattern of AtCRL1 indicates that CRL1 has a role in embryogenesis and seed germination. AtCRL1 is induced by ABA, drought and heat, and is highly expressed in seeds. The mRNA is cell-to-cell mobile. |
| AT3G26740 | transcripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT5G22250 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT1G27890 | Deadenylase. |
| AT1G61470 | Deadenylase. |
| AT3G44240 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G62430 | Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis. |
| AT3G50530 | CDPK-related kinase |
| AT1G50180 | Host immune receptor which recognizes the conserved effectors AvrE and HopAA1. |
| AT2G36190 | cwINV4 appears to function as a cell wall-localized invertase (that can catalyze the hydrolysis of sucrose into fructose and glucose) based on the phenotype of cwinv4 mutants. cwINV4 transcripts are expressed at high levels in lateral and median nectaries and this enzyme plays an important role in nectar production. Also expressed in ovary placenta and appears to play a role linking sugar sensing to ovule intitiation. |
| AT3G13784 | cell wall invertase 5;(source:Araport11) |
| AT1G22880 | cellulase 5;(source:Araport11) |
| AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
| AT2G25540 | cellulose synthase |
| AT5G09870 | Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose.Mutants are defective in seed coat mucilage.Involved in the regulation of mucilage composition and/or mucilage synthesis. |
| AT1G44120 | CELLULOSE SYNTHASE INTERACTIVE 2;(source:Araport11) |
| AT5G16190 | encodes a gene similar to cellulose synthase |
| AT3G56000 | encodes a gene similar to cellulose synthase |
| AT4G38190 | encodes a gene similar to cellulose synthase |
| AT4G24010 | encodes a protein similar to cellulose synthase |
| AT4G23990 | encodes a protein similar to cellulose synthase |
| AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture. |
| AT1G23480 | encodes a gene similar to cellulose synthase |
| AT3G03050 | encodes a cellulose synthase like protein. mutations initiate root hairs that rupture at their tip soon after initiation. is required for the synthesis of a noncellulosic wall polysaccharide. |
| AT2G33420 | hypothetical protein (DUF810);(source:Araport11) |
| AT3G07330 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
| AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
| AT1G34750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G22820 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT4G14723 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT5G26360 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
| AT5G16070 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
| AT3G62080 | Encodes a charged multi-vesicular body protein (CHMP7) homolog, that is an ESCRT-III-related protein and functions in the endosomal sorting pathway in humans. The Brassica homolog has been shown to be involved in plant growth and leaf senescence. |
| AT2G30380 | MYB family transcription factor;(source:Araport11) |
| AT3G21630 | LysM receptor-like kinase, based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity. Involved in the perception and transduction of the chitin oligosaccharide elicitor. Located in the plasma membrane. CERK1 phosphorylates LIK1, a LLR-RLK that is involved in innate immunity, |
| AT5G24090 | Chitinase A (class III) expressed exclusively under environmental stress conditions. Shown be a plant lysozyme involved in plant immunity. |
| AT2G43570 | chitinase;(source:Araport11) |
| AT5G26240 | Anion channel protein family member. Involved in negative regulation of pattern triggered immunity. |
| AT1G55620 | Encodes a chloride channel protein that has been localized to the chloroplast and golgi apparatus. Complements yeast gef1 mutant and therefor may function to acidify the golgi lumen. |
| AT1G29930 | Subunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center. The mRNA is cell-to-cell mobile. |
| AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
| AT2G47390 | Prolyl oligopeptidase family protein;(source:Araport11) |
| AT1G35680 | Encodes a chloroplast ribosomal protein L21 that is required for chloroplast development and embryogenesis. The mRNA is cell-to-cell mobile. |
| AT1G10500 | Involved in chloroplast Fe-S cluster assembly. Located in the chloroplast stroma. Expressed preferentially in green tissues. |
| AT5G66650 | Chloroplast localized mitochondrial calcium uniporter. |
| AT2G45350 | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-E subfamily) with 11 pentatricopeptide (PPR) repeats. The protein is involved in RNA editing of the initiation codon of ndhD in the chloroplast. |
| AT4G21445 | CRR9 gene encodes a novel stromal protein without any known functional domains or motifs. It is highly conserved in cyanobacteria and land plants but not in green algae. |
| AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile. |
| AT1G69370 | Encodes chorismate mutase 3 (CM3). |
| AT1G05490 | Involved in gene silencing. Locus-specific regulator of 24nt-siRNA expression, works together with CLSY1-4 as the master regulators of essentially all Pol-IV-dependent 24nt-siRNAs. |
| AT5G18620 | Encodes a member of the A. thaliana imitation switch (AtISWI) subfamily of chromatin remodeling factors. Double mutation in CHR17 and CHR11 results in the loss of the evenly spaced nucleosome pattern in gene bodies, but does not affect nucleosome density. |
| AT1G80740 | ecotype Kl-0 chromomethylase (CMT1). A plant line expressing an RNAi construct directed against DMT4 has reduced agrobacterium-mediated tumor formation. |
| AT5G40090 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT3G23690 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G80820 | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
| AT1G15950 | Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. The mRNA is cell-to-cell mobile. |
| AT4G37970 | cinnamyl alcohol dehydrogenase 6;(source:Araport11) |
| AT4G19810 | ChiC encodes a Class V chitinase that is a part of glycoside hydrolase family 18 based on CAZy groupings. It appears to primarily act as an exochitinase in vitro where it predominantly cleaves a chitobiose (GlcNAc)2 residue from the non-reducing end of a chitin oligosaccharide. However, it shows some minor endochitinase activity in vitro, as well. A putative 24 amino-acid signal peptide may direct this protein to the secretory system and it has been detected in cell wall apoplastic fluid. RT-PCR experiments demonstrate that ChiC transcript levels are increased in response to abscisisc acid, jasmonic acid, and NaCl stress. Microarray results also suggest that transcript levels rise in response to osmotic stress, two fungal pathogens, a bacterial pathogen, and the elicitor flagellin. The mRNA is cell-to-cell mobile. |
| AT1G68110 | An ENTH (Epsin NH2 terminal homology)/ANTH/VHS superfamily protein with adenylate cyclase activity and a role in clathrin assembly and endocytosis. |
| AT4G32285 | Putative clathrin assembly protein, component of TPLATE complex that functions in clathrin-mediated endocytosis. |
| AT2G20760 | Clathrin light chain protein;(source:Araport11) |
| AT2G40060 | Encodes a clathrin that is localized to the cortical division zone and the cell plate and colocalizes with TPLATE during cell plate anchoring. The mRNA is cell-to-cell mobile. |
| AT3G51890 | Clathrin light chain protein;(source:Araport11) |
| AT1G75820 | Putative receptor kinase with an extracellular leucine-rich domain. Controls shoot and floral meristem size, and contributes to establish and maintain floral meristem identity. Negatively regulated by KAPP (kinase-associated protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain. |
| AT5G65480 | CCL1 is induced by WUS and binds to the kinase domains of BAM1 and CLV1. Localizes to lipid rich plasma membrane rafts. Likely to be involved in WUS/CLV signaling pathway. |
| AT4G38060 | hypothetical protein;(source:Araport11) |
| AT1G73165 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo. |
| AT1G49005 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
| AT1G68795 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G63245 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo. |
| AT1G70895 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT3G25905 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT5G12990 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT2G31085 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo. |
| AT4G15560 | Encodes a protein with 1-deoxyxylulose 5-phosphate synthase activity involved in the MEP pathway. It is essential for chloroplast development in Arabidopsis |
| AT5G45390 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
| AT5G50920 | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC (Translocon at the Inner envelope membrane of Chloroplasts) translocation machinery. Association of Hsp93 with the inner envelope membrane through its N domain is important for the functions of Hsp93 in vivo. |
| AT5G55130 | putative molybdopterin synthase sulphurylase (cnx5) |
| AT3G02210 | COBRA-like protein 1 precursor;(source:Araport11) |
| AT5G60950 | COBRA-like protein 5 precursor;(source:Araport11) |
| AT1G29160 | Encodes a DOF transcription factor involved in seed coat development. Regulates PRX2 and PRX25, involved in seed longevity. |
| AT4G33980 | Acts with COR27 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT1G16670 | Encodes a cold-activated plasma membrane protein cold-responsive protein kinase that phosphorylates 14-3-3 proteins. The phosphorylated 14-3-3 proteins shuttle from the cytosol to the nucleus, where they interact with and destabilize the key cold-responsive C-repeat-binding factor (CBF) proteins, modulate CBF stability and the response to cold stress. |
| AT1G45688 | CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
| AT5G42860 | CC2 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
| AT4G01290 | Protein with evolutionarily conserved eIF4E-binding motif in its N-terminal domain that can form mRNA cap?binding complexes and has the potential for regulating gene expression as a translation factor associated plant-specific cell cycle regulator. |
| AT2G25240 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death. |
| AT4G24840 | oligomeric golgi complex subunit-like protein;(source:Araport11) |
| AT5G57660 | CONSTANS-like 5;(source:Araport11) |
| AT3G21290 | Nuclear-localized intrinsically disordered protein involved in promoting miRNA activity. |
| AT5G05170 | Encodes a cellulose synthase isomer. CESA3 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA3, along with CESA1 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The xylem cells in primary root have reduced cell expansion and higher than normal lignification. |
| AT2G32950 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light. The mRNA is cell-to-cell mobile. |
| AT4G00930 | Encodes COP1-interacting protein CIP4.1. |
| AT4G27430 | Positive regulator of light-regulated genes. Novel nuclear protein which requires light for its high level expression. The mRNA is cell-to-cell mobile. |
| AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile. |
| AT1G22920 | AJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Encodes a subunit of the COP9 complex that is involved in protein deneddylation. Plants with mutations in CSN5A and CSN5B have a de-etiolated phenotype. Required for the recovery of AUX/IAA repressor levels following recurrent heat stress to regulate auxin homeostasis. |
| AT5G56280 | one of two genes encoding subunit 6 of COP9 signalosome complex. Protein contains a MPR1p and PAD1p N-terminal (MPN) domain at the N-terminal region and belongs to the Mov34 superfamily. Mutant and antisense expression result in a number of developmental defects and in ubiquitin/proteasome-mediated protein degradation. |
| AT1G71230 | Encodes a subunit of the COP9 complex, similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Involved in protein deneddylation. Double mutants with CSN5A are constitutively photomorphogenic (de-etiolated) and have abnormal auxin responses. |
| AT1G31710 | Copper amine oxidase family protein;(source:Araport11) |
| AT3G43670 | Copper amine oxidase family protein;(source:Araport11) |
| AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
| AT1G28680 | Catalyses trans-cis isomerization and lactonization in the biosynthesis of coumarins in roots. |
| AT3G59420 | Encodes a membrane localized protein with similarity to receptor kinases which is involved in epidermal cell differentiation. Flowers of mutants have disorganized ovule integument growth and abnormal sepal margins. In the roots, mutants initiate more lateral roots but fewer laterals actually emerge due to defects in lateral root formation. Mutants also display disorganized columella. The root phenotypes can be traced to abnormalities in asymmetric divisions in the pericycle and root apex. Conflicting data regarding the role of the kinase domain- which may or may not be required for function. Complementation studies indicate that the C-terminal domain is also not required for signaling function. May be regulated by protein turnover which is mediated by endocytic processes. ACR4 phosphorylates the PROTEIN PHOSPHATASE 2A-3 (PP2A-3) catalytic subunit of the PP2A phosphatase holoenzyme and PP2A |
| AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
| AT2G39180 | CRINKLY4 related 2;(source:Araport11) |
| AT5G47850 | CRINKLY4 related 4;(source:Araport11) |
| AT3G28630 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
| AT5G19380 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. |
| AT4G24460 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. |
| AT1G03880 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G48560 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G07340 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G26260 | Encodes CIB5 (cryptochrome-interacting basic-helix-loop-helix). Related to CIB1 (AT4G34530). CIB5 interacts with CRY2 and forms heterodimer with CIB1 in vitro. Regulates flowering time redundantly with CIB1. |
| AT5G11440 | Interacts with PAB (poly A binding protein) in yeast two hybrid experiments. Contains PAM2 motif, a PABC interacting domain. |
| AT4G02120 | Cytidine triphosphate synthase. |
| AT1G71200 | bHLH160 transcription factor. Induced by copper deficiency and seems to mediate copper uptake along with SPL7. Alternative splicing variant in response to MeJa treatment has potential novel function where it can dimerize but not bind DNA, resulting in a function opposite of the primary isoform. |
| AT1G76420 | Identified in an enhancer trap line; member of the NAC family of proteins. Expressed at the boundary between the shoot meristem and lateral organs and the polar nuclei in the embryo sac. Together with CUC2-DA1-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. Regulates axillary meristem initiation by directly binding to the DA1 promoter. |
| AT4G39830 | role in the degradation of ascorbate to (mono)dehydroascorbate |
| AT4G30140 | Member of the GDSL lipase/esterase family of proteins that functions as cutinase. Expressed in pollen and at the zone of lateral root emergence. |
| AT4G34180 | Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development. |
| AT1G19780 | Encodes a member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
| AT2G46430 | Encodes a cyclic nucleotide gated channel, downstream component of the signaling pathways leading to hypersensitive response (HR) resistance. |
| AT4G30560 | member of Cyclic nucleotide gated channel family. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
| AT3G17700 | cyclic nucleotide-binding transporter 1, member of a family of cyclic nucleotide gated channels. The mRNA is cell-to-cell mobile. |
| AT2G46440 | Member of Cyclic nucleotide gated channel family. Positive regulator of resistance against avirulent fungal pathogen. The mRNA is cell-to-cell mobile. |
| AT2G24610 | member of Cyclic nucleotide gated channel family |
| AT4G30360 | member of Cyclic nucleotide gated channel family |
| AT1G17330 | cGMP-activated phosphodiesterase responsible for UVA induced decrease in cGMP. |
| AT1G44110 | Cyclin A1;(source:Araport11) |
| AT1G15570 | A2-type cyclin. Negatively regulates endocycles and acts as a key regulator of ploidy levels in Arabidopsis endoreduplication. Interacts physically with CDKA;1. Expressed preferentially in trichomes and young developing tissues. |
| AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
| AT2G22490 | encodes a D-type cyclin whose transcription level is regulated by sucrose but not phytohormones or nitrate. Protein physically interacts with CDC2A. CycD2 kinase activity is regulated by sequestration of CycD2 protein in a form inaccessible to immunoprecipitation and probably not complexed to CDC2A. |
| AT4G34160 | encodes a cyclin D-type protein involved in the switch from cell proliferation to the final stages of differentiation. The gene is transcriptionally regulated by cytokinin and brassinosteroid. Protein interacts with cyclin-dependent kinase inhibitor ICK1. |
| AT5G67260 | Encode CYCD3;2, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs and mediating cytokinin effects in apical growth and development. With PPD and NINJA, it plays a crucial role in leaf morphogenesis. |
| AT3G50070 | Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development. |
| AT5G65420 | Encodes a D-type cyclin CYCD4;1 that physically interacts with CDC2A and is expressed during vascular tissue development, embryogenesis, and formation of lateral root primordia. Its expression is upregulated early during germination.Involved in stomatal cell lineage proliferation in the hypocotyl. |
| AT5G10440 | Encodes a cyclin involved in cell proliferation during stomatal cell lineage development. |
| AT4G03270 | Cyclin D6, involved in cortex/endodermis asymmetric stem cell division. |
| AT2G01905 | cyclin J18 (cycJ18) |
| AT1G67580 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G69570 | CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572).CDF5 transcript accumulation delays flowering. CDF5 links circadian oscillation and photoperiodism. |
| AT2G07050 | Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol. |
| AT3G01480 | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. The mRNA is cell-to-cell mobile. |
| AT3G44600 | Cyclophilin71 is a WD40 domain cyclophilin, which functions in gene repression, organogenesis and meristem development. CYP71 physically interacts with histone H3. |
| AT5G50375 | Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2 |
| AT5G64660 | CYS, MET, PRO, and GLY protein 2;(source:Araport11) |
| AT3G12490 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). |
| AT4G11320 | Papain family cysteine protease;(source:Araport11) |
| AT3G61440 | Encodes a cysteine synthase isomer CysC1. The isomer is however less effective in cysteine biosynthesis. It is involved in beta-cyanoalanine biosynthesis, an intermediate of cyanide detoxification pathway. The mRNA is cell-to-cell mobile. |
| AT4G23180 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) The mRNA is cell-to-cell mobile. |
| AT4G23190 | Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria, Ralstonia solanacearum. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23210 | Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. |
| AT4G23220 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23230 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23270 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G23310 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23320 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G05200 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G38830 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G21230 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G21400 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G21410 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT1G70530 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11470 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11480 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11530 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G04490 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04500 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04510 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23130 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23140 | Arabidopsis thaliana receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23160 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT1G70520 | Encodes a cysteine-rich receptor-like protein kinase located to the plasma membrane. Involved in regulating microbe-associated molecular pattern-triggered ROS production and stress induced callose deposition at the plasmodesmata in roots. Required for MAMP-triggered responses and resistance to Pseudomonas syringae pv. tomato 118 DC3000 . |
| AT4G22340 | cytidinediphosphate diacylglycerol synthase 2;(source:Araport11) |
| AT1G26340 | encodes a member of the cytochromes b5 family of proteins that localizes to the outer envelope of the chloroplast. The C-terminal portion of the protein appears to be capable of inserting into a plant microsomal membrane in vitro. |
| AT2G46650 | member of Cytochromes b5 The mRNA is cell-to-cell mobile. |
| AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
| AT1G02410 | Encodes a member of the cytochrome c oxidase 11 protein family. It is an integral mitochondrial protein and likely plays an important role as a mitochondrial chaperone in COX complex assembly, affecting plant growth and pollen germination. |
| AT1G11680 | putative obtusifoliol 14-alpha demethylase involved in sterol biosynthesis. The mRNA is cell-to-cell mobile. |
| AT2G24180 | Encodes a cytochrome P450 monooxygenase that converts indole-3-acetonitrile to indole-3-aldehyde / indole-3-carboxylic acid and cyanide. The mRNA is cell-to-cell mobile. |
| AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
| AT1G58260 | member of CYP79C subfamily of cytochrome p450s. Encodes a putative xylan endohydrolase. similar to some closely linked pseudogenes. |
| AT5G04330 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT4G15393 | a member of the cytochrome P450 gene family. molecular function unknown. |
| AT4G15398 | cytochrome P450 pseudogene |
| AT2G45510 | member of CYP704A |
| AT4G15330 | cytochrome P450, family 705, subfamily A, polypeptide 1;(source:Araport11) |
| AT5G42580 | a member of the cytochrome P450 family |
| AT2G14100 | a member of the cytochrome P450 family |
| AT3G20080 | cytochrome P450, family 705, subfamily A, polypeptide 15;(source:Araport11) |
| AT3G20090 | cytochrome P450, family 705, subfamily A, polypeptide 18;(source:Araport11) |
| AT4G15350 | member of CYP705A |
| AT3G20110 | member of CYP705A |
| AT3G20130 | Encodes a member of the CYP705A family of cytochrome P450 enzymes. Mutants show altered gravitropic responses. |
| AT1G28430 | member of CYP705A |
| AT1G50560 | member of CYP705A |
| AT1G50520 | member of CYP705A The mRNA is cell-to-cell mobile. |
| AT3G20935 | cytochrome P450, family 705, subfamily A, polypeptide 28;(source:Araport11) |
| AT3G20960 | cytochrome P450, family 705, subfamily A, polypeptide 33;(source:Araport11) |
| AT5G47990 | Encodes an endomembrane system-expressed member of the CYP705A family of cytochrome P450 enzymes. It appears to catalyze the addition of a double bond to thalian-diol at carbon 15. Reduced levels of THAD expression lead to a build up of thalian-diol in root extracts. thad1-1 mutants also have longer roots than wild type seedlings and show altered gravitropic responses. |
| AT2G05180 | member of CYP705A |
| AT2G27000 | member of CYP705A |
| AT2G27010 | member of CYP705A |
| AT5G44620 | member of CYP706A |
| AT4G12330 | member of CYP706A |
| AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
| AT5G48000 | Encodes a member of the CYP708A family of cytochrome P450 enzymes. THAH appears to add a hydroxyl group to the triterpene thalianol. thah1 mutants have an elevated accumulation of thalianol. thah1-1 mutants have longer roots than wild type plants. Thalian-diol and desaturated thalian-diol are lost from the root extracts of thah1-1 mutants. Overexpression of the sequence from At5g48000.1 rescues the thah1-1 mutant phenotype (Field 2008); it is unknown whether the shorter sequences associated with other gene models would provide functional complementation. |
| AT1G13110 | member of CYP71B The mRNA is cell-to-cell mobile. |
| AT3G26160 | putative cytochrome P450 |
| AT1G13080 | cytochrome P450 monooxygenase |
| AT3G26190 | putative cytochrome P450 |
| AT3G26210 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G26230 | putative cytochrome P450 |
| AT3G26290 | putative cytochrome P450 |
| AT1G13070 | putative cytochrome P450 |
| AT3G26220 | cytochrome P450 monooxygenase |
| AT3G53305 | putative cytochrome P450 |
| AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
| AT2G28850 | member of CYP710A |
| AT2G28860 | member of CYP710A |
| AT5G24900 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT3G14610 | putative cytochrome P450 |
| AT3G14620 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT1G75130 | member of CYP721A |
| AT1G19630 | cytochrome P450, family 722, subfamily A, polypeptide 1;(source:Araport11) |
| AT1G67110 | cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11) |
| AT3G52970 | member of CYP76G |
| AT2G46660 | Encodes a member of CYP78A cytochrome P450 monooxygenase protein family that is required in the sporophytic tissue of the mother plant to promote seed growth. |
| AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
| AT5G36220 | member of CYP81D family of cytochrome p450s. This gene was originally called CYP91A1, but was later renamed to CYP81D1. |
| AT4G37340 | member of CYP81D |
| AT4G37320 | member of CYP81D |
| AT2G23190 | member of CYP81D |
| AT4G37370 | member of CYP81D |
| AT4G37400 | member of CYP81F |
| AT5G10600 | member of CYP81K |
| AT4G31940 | The gene encodes a cytochrome P450 enzyme, CYP82C. It is involved in the early Fe deficiency response.CYP82C4 hydroxylates fraxetin to generate sideretin (5-hydroxyfraxetin). Fraxetin and sideretin are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.The mRNA is cell-to-cell mobile. |
| AT2G25160 | cytochrome P450, family 82, subfamily F, polypeptide 1;(source:Araport11) |
| AT3G25180 | Encodes a cytochrome P450 monooxygenase (CYP82G1) that catalyzes the production of two volatile homoterpenes, TMTT and DMNT, although it is only likely to produce TMTT in planta. TMTT can be involved in attracting predatory insects to protect Arabidopsis plants from herbivorous pests. Homoterpene synthesis is also stimulated by fungal elicitors which increase the transcript levels of CYP82G1. |
| AT4G13770 | Encodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis. |
| AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
| AT4G00360 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems. |
| AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
| AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
| AT3G26125 | encodes a protein with cytochrome P450 domain |
| AT1G64940 | member of CYP89A |
| AT2G23180 | member of CYP96A |
| AT1G65340 | member of CYP96A |
| AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11) |
| AT2G21910 | member of CYP96A |
| AT1G31800 | Encodes a protein with β-ring carotenoid hydroxylase activity. The mRNA is cell-to-cell mobile. |
| AT2G39770 | Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. This enzyme provides GDP-mannose, which is used for cell wall carbohydrate biosynthesis and protein glycosylation as well as for ascorbate (vitamin C) biosynthesis. Mutations in this gene confer hypersensitivity to NH4+. |
| AT2G19500 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT5G56970 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on N6-(2-isopentenyl)adenine 9-riboside. |
| AT4G29740 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
| AT3G63440 | This gene used to be called AtCKX7. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT3G25890 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. The mRNA is cell-to-cell mobile. |
| AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT2G46310 | CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT3G44326 | Cytokinin induced F-Box protein. Forms a unique F-Box family with AT2G27310 and AT2G36090. It is primarily expressed in the root. |
| AT1G35580 | CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9. |
| AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
| AT1G04270 | Encodes cytosolic ribosomal protein S15. |
| AT1G04410 | predicted to encode a cytosolic malate dehydrogenase. |
| AT3G17090 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G55050 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G51370 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G61410 | Arabidopsis thaliana ribulose-5-phosphate-3-epimerase mRNA |
| AT1G78420 | Activates the latent peptidases DA1, DAR1 and DAR2 by mono-ubiquitination at multiple sites. Subsequently, these activated peptidases destabilize various positive regulators of growth. |
| AT2G39830 | Essential for early phloem development and function, and for root system development.DAR2 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. |
| AT5G66640 | DA1-related protein 3;(source:Araport11) |
| AT5G66620 | DA1-related protein 6;(source:Araport11) |
| AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
| AT4G18550 | DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. |
| AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
| AT3G60140 | Encodes a protein similar to beta-glucosidase and is a member of glycoside hydrolase family 1. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
| AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT4G31160 | Encodes a DCAF/DWD protein capable of interacting with DDB1 and associating with CUL4, likely as part of a nuclear ubiquitin ligase complex. DCAF1 appears to be required for plant embryogenesis and to affect several other developmental processes including leaf, shoot, and flower development. |
| AT2G38050 | Similar to mammalian steroid-5-alpha-reductase. Involved in the brassinolide biosynthetic pathway. |
| AT1G26110 | Encodes Decapping 5, required for mRNA decapping, P-body formation and translational repression during postembryonic development. |
| AT1G17400 | Protein of unknown function. Similar to LAZY1, a gene required or gravitropic response in shoots and roots. Involved in determining lateral root branch angle. |
| AT4G33400 | Together with DEM2 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
| AT3G19240 | Together with DEM1 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
| AT3G09090 | Encodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development. |
| AT5G10250 | Encodes a protein with an N-terminal BTB/POZ domain and a C-terminal NPH3 family domain. dot3 mutants have defects in shoot and primary root growth and produce an aberrant parallel venation pattern in juvenile leaves. |
| AT4G11393 | Encodes a defensin-like (DEFL) family protein. |
| AT5G45380 | urea-proton symporter DEGRADATION OF UREA 3 (DUR3);(source:Araport11) |
| AT2G21490 | dehydrin LEA;(source:Araport11) |
| AT5G16710 | DHAR3 protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.Encodes 30-40% of extractable leaf GSH-dependent DHAR activity. Single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions.Makes a minor contribution to glutathione oxidation in response to increased intracellular hydrogen peroxide (catalase deficiency) (PMID:28381499). |
| AT5G67570 | Encodes a pentratricopeptide repeat containing protein that is targeted to the chloroplast. Mutants have pale young leave and reduced accumulation of plastid encoded transcripts suggesting a role for DG1 in regulation of plastid gene expression. |
| AT1G64750 | Involved in the maintenance of genome integrity through homologous recombination. This function of DSS1 is performed through its interaction with the BRCA2 protein. |
| AT1G48760 | Encodes the putative delta subunit of the AP(adaptor protein)-3 complex and plays a role in vacuolar function. |
| AT2G39800 | encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner. |
| AT5G04560 | Encodes a DNA glycosylase DEMETER (DME). Responsible for endosperm maternal-allele-specific hypomethylation at the MEDEA (MEA) gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele. |
| AT3G10010 | Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks. |
| AT4G21810 | DERLIN-2.1;(source:Araport11) |
| AT1G11500 | DUF1218 family member. |
| AT3G23550 | MATE efflux family protein;(source:Araport11) |
| AT5G52050 | MATE efflux family protein;(source:Araport11) |
| AT5G38030 | MATE transporter involved in auxin homeostasis in roots. |
| AT3G51520 | Encodes a functional acyl-CoA:diacylglycerol acyltransferase with different acyl-CoA substrate preferences and shows higher DAG to TAG conversion rate than AtDGAT1. It increases both C18:2 and C18:3 polyunsaturated fatty acids at the expense of C16:0. |
| AT5G57690 | Involved in nitric oxide-dependent pollen tube guidance and fertilization. |
| AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
| AT1G01040 | Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs. The mRNA is cell-to-cell mobile. |
| AT3G03300 | Encodes a Dicer-like protein that functions in the antiviral silencing response in turnip-crinkle virus-infected plants but not in TMV or CMV-strain-Y-infected plants. Involved in the production of ta-siRNAs. Partially antagonizes the production of miRNAs by DCL1. Substitutes for DCL4 to produce viral siRNA when DCL4 is missing or inhibited. Able to produce siRNAs but not miRNAs. |
| AT5G20320 | Encodes an RNase III-like enzyme that catalyzes processing of trans-acting small interfering RNA precursors in a distinct small RNA biogenesis pathway. The protein is also involved in the production of 21-nt primary siRNAs from both inverted-repeat constructs and endogenous sequences, as well as the RDR6-dependent 21-nt secondary siRNAs involved in long-range cell-to-cell signaling. It binds DRB4, a ds-RNA binding protein. |
| AT3G60880 | Encodes a dihydropicolinate synthase involved in lysine biosynthesis. The enzyme is allosterically inhibited by lysine. It is predicted to localize to the cholorplast. |
| AT5G42800 | dihydroflavonol reductase. Catalyzes the conversion of dihydroquercetin to leucocyanidin in the biosynthesis of anthocyanins. Not expressed in roots (qRT-PCR). The mRNA is cell-to-cell mobile. |
| AT4G34570 | Encodes a bifunctional dihydrofolate reductase - thymidylate synthase gene. This is unique in Arabidopsis and protozoa. Other organisms have independent genes for this function. |
| AT3G23940 | Encodes a member of the dihydroxyacid dehydrates family of proteins that encode enzymes involved in branched chain amino acid biosynthesis. Loss of function mutations have significantly reduced transmission and fertility due to defects in male and female gametophyte development and embryo lethality. Mutants have increased sensitivity to abiotic stressors which may be partially compensated by addition of amino acids to the growth medium. |
| AT1G51360 | Involved in defense against fungal pathogens and located in cytosol. |
| AT4G23690 | Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
| AT1G30825 | Involved in trichome maturation. mutant displays enlarged trichomes |
| AT5G58900 | R-R-type MYB protein |
| AT5G04130 | Encodes a protein that when expressed together with GYRA generates an active supercoiling DNA gyrase enzyme that shares similar properties to its bacterial counterpart, including sensitivity to gyrase-specific antibiotics. |
| AT3G13310 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G08130 | Encodes the Arabidopsis DNA ligase 1 that provides the major DNA ligase activity in cells and plays a key role in both DNA replication and excision repair pathways. In addition, it is an important component of the active DNA demethylation machinery and is indispensable for cell viability. AtLIG1 expresses one major and two minor mRNA transcripts differing only in the length of the 5' untranslated leader sequences preceding a common ORF. Translation from the first in-frame start codon produces an AtLIG1 isoform that is targeted exclusively to the mitochondria. Translation initiation from the second in-frame start codon produces an AtLIG1 isoform targeted only to the nucleus. |
| AT1G67630 | DNA polymerase alpha 2;(source:Araport11) |
| AT1G10520 | Encodes a homolog of the mammalian DNA polymerase lambda that is involved in the repair of UV-B induced DNA damage. |
| AT4G21040 | Dof-type zinc finger domain-containing protein;(source:Araport11) |
| AT4G21080 | Dof-type zinc finger domain-containing protein;(source:Araport11) |
| AT3G04880 | encodes a novel protein involved in DNA repair from UV damage. Isolated by functional complementation of E. coli UV-sensitive mutants (UVR genes). |
| AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
| AT3G19810 | BTB/POZ domain protein, putative (DUF177);(source:Araport11) |
| AT3G19800 | Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence. |
| AT2G47230 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. |
| AT5G23780 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT5G14620 | A putative DNA methyltransferase with rearranged catalytic domains; similar to mammalian DNMT3 methyltransferases; contains UBA domains. The 3'-end proximal part of the gene coding region is highly methylated at both adenine and cytosine residues. |
| AT4G12010 | Leucine-rich repeat domain (NLR) receptor. Dominant negative alleles suppress catma3 autoimmunity. Co-regulates with WRKY19 basal levels of immunity to root-knot nematodes. |
| AT5G18370 | Leucine-rich repeat domain (NLR) receptor. Dominant negative alleles suppress catma3 autoimmunity. |
| AT1G05800 | Encodes a galactolipase. Located in the chloroplast. Involved in the initial step of jasmonic acid biosynthesis. Expressed in vegetative tissues and is necessary for the biosynthesis of basal-level JAs in vegetative tissues. |
| AT4G25670 | stress response NST1-like protein;(source:Araport11) |
| AT4G22470 | Encodes a hybrid proline-rich protein that contains two tandem PRD-8CMs (proline-rich domain-eight cysteine motif) that is involved in systemic acquired resistance. |
| AT1G45190 | downregulated in DIF1 18;(source:Araport11) |
| AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
| AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
| AT3G01330 | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. |
| AT1G59660 | Encodes a protein with similarity to mammalian nucleoporin Nup98.Its expression is upregulated in mutants that are NUP deficient. Nucleoportin which redundantly inhibits flowering together with Nup98a through multiple pathways including clock, photoperiod, and age pathways. Gates flowering in a CONSTANS (CO)-independent mode and bypasses the CO checkpoint in photoperiodic signaling and integrated signals from multiple pathways to directly target FLOWERING LOCUS T (FT) for flowering control. |
| AT1G06770 | Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. The DRIP1-GFP fusion protein is nuclear-localized. DRIP1 seems to be involved in regulating stress-related transcriptional changes and drought tolerance. |
| AT2G31470 | Encodes a F-Box protein DOR (Drought tolerance Repressor) functionally as an inhibitory factor for abscisic acid-induced stomatal closure under drought stress. |
| AT4G15910 | encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The transcript level is also affected by changes of endogenous or exogenous abscisic acid level. It appears to be a member of plant-specific gene family that includes late embryo-abundant and zinc- IAA-induced proteins in other plants. The mRNA is cell-to-cell mobile. |
| AT5G41070 | Encodes a double-stranded RNA binding protein. |
| AT4G17505 | carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11) |
| AT5G03390 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G67040 | F-box protein, putative (DUF295);(source:Araport11) |
| AT4G16080 | hypothetical protein (DUF295);(source:Araport11) |
| AT4G25920 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G55270 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G53230 | hypothetical protein (DUF295);(source:Araport11) |
| AT3G21520 | Encodes a protein is directly or indirectly involved in membrane fission during breakdown of the ER and the tonoplast during leaf senescence and in membrane fusion during vacuole biogenesis in roots. The mRNA is cell-to-cell mobile. |
| AT4G24310 | transmembrane protein, putative (DUF679);(source:Araport11) |
| AT3G02430 | transmembrane protein, putative (DUF679);(source:Araport11) |
| AT3G60460 | Encodes an R2R3 myb transcription factor that is required for male gamete formation, specifically for entry of the generative cell into mitosis. Specifically expressed in the male germline. |
| AT3G19820 | Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to campesterol. Brassinosteroids affect cellular elongation. Mutants have dwarf phenotype. DWF1 is a Ca2+-dependent calmodulin-binding protein. |
| AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
| AT1G50430 | Mutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype. EXO70 interactor and presumed negative secretion regulator. |
| AT4G03400 | Encodes a GH3-related gene involved in red light-specific hypocotyl elongation. Analysis of sense and antisense transgenic plants suggests that DFL2 is located downstream of red light signal transduction and determines the degree of hypocotyl elongation. |
| AT1G03055 | Encodes the ortholog of rice D27. It is plastid-localized and is required for the inhibition of secondary bud outgrowth and operates on a nonmobile precursor upstream of MAX1 in the SL biosynthesis pathway. |
| AT1G76260 | DWD (DDB1-binding WD40 protein) hypersensitive to ABA 2;(source:Araport11) |
| AT1G61210 | DWA3 encodes a DWD(DDB1 binding WD40) protein. Invitro analyses suggest its involvement in the negative regulation of ABA responses.One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT1G60500 | Dynamin related protein 4C;(source:Araport11) |
| AT5G42080 | Encodes a dynamin-like protein related to phragmoplastin. Mutations in this gene, in combination with mutation in ADL1E, result in defects in embryogenesis, cell plate formation and trichome branching. Also controls vascular patterning in combination with VAN3 and GNOM. DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosis. |
| AT1G29710 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G05640 | EGR1 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress.EGR1 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT2G40550 | Encodes a nuclear localized target of E2Fa-DPa, transcription factors controlling cell cycle progression. Required for sister chromatid cohesion and DNA repair. |
| AT2G36010 | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. |
| AT4G12480 | Encodes a putative lipid transfer protein, vernalization-responsive and cold-induced. It is involved in priming the SAR and ISR responses, specifically in propagating the cell-to-cell mobile signal. The kinases MPK3 (AT3G45640) and MPK6 (AT2G43790) promote the accumulation of AZI1/EARLI1 at plastids during defense priming induction. The kinases MPK3 (AT3G45640) and MPK6 (AT2G43790) promote the accumulation of AZI1/EARLI1 at plastids during defense priming induction. |
| AT2G40080 | Encodes a novel nuclear 111 amino-acid phytochrome-regulated component of a negative feedback loop involving the circadian clock central oscillator components CCA1 and LHY. ELF4 is necessary for light-induced expression of both CCA1 and LHY, and conversely, CCA1 and LHY act negatively on light-induced ELF4 expression. ELF4 promotes clock accuracy and is required for sustained rhythms in the absence of daily light/dark cycles. It is involved in the phyB-mediated constant red light induced seedling de-etiolation process and may function to coregulate the expression of a subset of phyB-regulated genes. |
| AT5G16260 | Encodes a RNA binding protein ELF9 (EARLY FLOWERING9). Loss of ELF9 function in the Wassilewskija ecotype causes early flowering in short days. ELF9 reduces SOC1 (SUPPRESSOR OF OVEREXPRESSION OF CO1) transcript levels, possibly via nonsense-mediated mRNA decay. The mRNA is cell-to-cell mobile. |
| AT5G19700 | Encodes a MATE transporter involved in leaf senescence and iron homeostasis. |
| AT2G25060 | early nodulin-like protein 14;(source:Araport11) |
| AT4G28365 | early nodulin-like protein 3;(source:Araport11) |
| AT4G32490 | early nodulin-like protein 4;(source:Araport11) |
| AT3G20570 | early nodulin-like protein 9;(source:Araport11) |
| AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
| AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
| AT5G57800 | encodes a transmembrane protein with similarity to the sterol desaturase family at the N-terminus and to the short-chain dehydrogenase/reductase family at the C-terminus. Mutant analyses indicate this protein is involved in cuticle membrane and wax biosynthesis. The mRNA is cell-to-cell mobile. |
| AT3G60500 | Encodes a 3'-5' exoribonuclease, positively regulates CER3 transcription, involved in cuticular wax biosynthesis. |
| AT4G34100 | Encodes a putative E3 ubiquitin ligase that is involved in cuticular wax biosynthesis and regulates 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) activity. HMGR catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. Lines carrying a recessive mutation in this locus have reduced chain-length distribution, weakly glaucous stem surface, and has reduced fertility in early flowers, non-spreading floret, downward cupped leaves, leaf waxes nearly pure C24 and C26 acid. |
| AT1G80350 | encodes a p60 katanin protein that is expressed throughout the plant. Required for the specification of cell fates from early in development (in the meristem) through differentiation and for normal postmitotic organization of cortical microtubules into transverse arrays in root epidermis cells. Mutants display cytoskeletal defects. |
| AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation. |
| AT5G20480 | Encodes a predicted leucine-rich repeat receptor kinase (LRR-RLK). Functions as the receptor for bacterial PAMP (pathogen associated molecular patterns) EF-Tu. |
| AT4G39340 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT4G24800 | MA3 domain-containing protein;(source:Araport11) |
| AT4G16355 | Produces a long non-coding RNA that enhances resistance against Pseudomonas syringe pv. tomato DC3000. It directly interacts with Mediator subunit 19a and enhances the expression of innate immune response genes, like PR1. |
| AT2G29950 | Member of a small family of proteins containing DUF1313 domain. Involved in flowering time. |
| AT1G72630 | ELF4-like 2;(source:Araport11) |
| AT1G17455 | ELF4-like 4;(source:Araport11) |
| AT5G64890 | elicitor peptide 2 precursor;(source:Araport11) |
| AT5G64905 | elicitor peptide 3 precursor;(source:Araport11) |
| AT5G09978 | elicitor peptide 7 precursor;(source:Araport11) |
| AT1G75000 | ELO family protein. |
| AT5G11260 | Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels. |
| AT5G50280 | Responsible for chloroplast gene expression and group II intron splicing of several genes. Associated with the expression of ribosomal genes and accumulation of chloroplast ri bosomes. Critically important for early chloroplast development in cotyledon. |
| AT4G26300 | Arginyl-tRNA synthetase, class Ic;(source:Araport11) |
| AT5G26742 | DEAD box RNA helicase (RH3);(source:Araport11) |
| AT4G23250 | cysteine-rich receptor-like protein kinase 17;(source:Araport11) |
| AT1G56200 | Encodes a chloroplast localized protein that is essential for chloroplast development. |
| AT5G49930 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT1G06150 | Encodes a LHW-like protein with 79% amino acid identity to LHW. |
| AT2G37920 | copper ion transmembrane transporter;(source:Araport11) |
| AT1G58210 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the plasma membrane. |
| AT3G07060 | NHL domain-containing protein;(source:Araport11) |
| AT5G24400 | Encodes a protein with 6-phosphoglucunolactonase activity that localizes to the chloroplasts and the peroxisome. However, mutant phenotypes observed in pgl3 mutant plants can be complemented with a chloroplast-targeted version of the protein. PGL3 likely functions in the oxidative branch of the pentose phosphate pathway. pgl3 mutant phenotypes suggest that it is important in pathogen defense and maintenance of cellular redox homeostasis. |
| AT5G16715 | protein EMBRYO DEFECTIVE 2247;(source:Araport11) |
| AT4G21130 | similar to man and yeast U3-55K genes, involved in processing of pre-ribosomal RNA. |
| AT2G25660 | Translocon at the inner-envelope membrane of chloroplasts which binds to the outer-membrane channel TOC75. |
| AT4G39620 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G20440 | Encodes BE1, a putative glycoside hydrolase. Involved in organogenesis and somatic embryogenesis by regulating carbohydrate metabolism. Mutation in BE1 has pleotrophic effect on the whole plant development. |
| AT5G02250 | Encodes a exoribonuclease involved in rRNA processing in mitochondria and chloroplasts.Loss of function mutations are pale green and require supplementation with sucrose for germination and early development. Plants are pale green due to defects in chloroplast biogenesis. |
| AT5G55940 | Uncharacterized protein family (UPF0172);(source:Araport11) |
| AT4G14590 | embryo defective 2739;(source:Araport11) |
| AT5G63420 | Encodes a member of the metallo-beta-lactamase protein family that plays a vital role in embryo morphogenesis and apical-basal pattern formation by regulating chloroplast development. In bacteria, RNase J plays an important role in rRNA maturation and in the 5′ stability of mRNA. |
| AT4G33990 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G45000 | Encodes a nucleoporin, a component of the nuclear pore complex, that appears to be a major negative regulator of auxin signalling. Loss of function mutants are embryo lethal. |
| AT5G05560 | Encodes a subunit of the Arabidopsis thaliana E3 ubiquitin ligase complex that plays a synergistic role with APC4 both in female gametogenesis and in embryogenesis. |
| AT5G15540 | Encodes Adherin SCC2. Essential for viability. Required for normal seed development. Plays a role in the establishment of sister-chromatid cohesion and chromosome organization during meiosis. |
| AT4G27010 | ribosome 60S biogenesis amino-terminal protein;(source:Araport11) |
| AT2G39080 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G03870 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT5G40480 | embryo defective 3012;(source:Araport11) |
| AT2G36000 | Encodes an mTERF protein localized in the chloroplast stroma. |
| AT4G00620 | Amino acid dehydrogenase family protein;(source:Araport11) |
| AT5G14320 | Ribosomal protein S13/S18 family;(source:Araport11) |
| AT5G51200 | Originally identified as EDS4, enhanced disease sensitive phenotype and subsequently cloned and identified as NUCLEOPORIN205. Affects circadian clock and downstream genes including those involved in defense response. |
| AT2G30200 | Malonyl-ACP expressed in developing seeds. Loss of function mutants are embryo lethal and over expression in seeds leads to increased seed oil content. |
| AT2G01860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G01960 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
| AT1G55420 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G34920 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G18080 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
| AT1G70540 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G34860 | DnaJ-like zinc finger domain-containing protein which regulates the assembly of photosystem I (PSI) and seed development. |
| AT3G10000 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G13890 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT4G33050 | Encodes a calmodulin-binding protein involved in stomatal movement. |
| AT2G48140 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G00310 | Putative membrane lipoprotein;(source:Araport11) |
| AT5G51230 | Polycomb group protein with zinc finger domain involved in negative regulation of reproductive development. Forms a complex with FIE, CLF, and MSI1. This complex modulates the expression of target genes including AG, PI and AP3. |
| AT5G64360 | EIP9 interacts with EMF1 to regulate flowering. It functions partially redundantly with SDJ2 and SDJ3 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
| AT1G71220 | Encodes UDP-glucose:glycoprotein glucosyltransferase. Non-receptor component required for EFR-mediated immunity. Mutants show de-repressed anthocyanin accumulation in the presence of elf18, and EFR accumulation and signalling. |
| AT2G44440 | Emsy N Terminus (ENT) domain-containing protein;(source:Araport11) |
| AT5G67270 | encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
| AT5G05460 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
| AT1G68290 | Encodes an endonuclease ENDO2. ENDO2 purified from transgenic Arabidopsis digests RNA, ssDNA, and dsDNA, with a substrate preference for ssDNA and RNA. ENDO2 produced and purified from Nicotiana benthamiana expression showed no demonstrable endonuclease activity, either towards single stranded DNA or mismatches, in vitro. |
| AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
| AT2G38960 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO2 is mainly present in the Ox2 redox state. |
| AT1G29330 | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
| AT3G25040 | Encodes ERD2b. a homolog of the yeast endoplasmic reticulum retention receptor ERD2. Mutations in ERD2b compromise EFR but not FLS2 signaling. The mRNA is cell-to-cell mobile. |
| AT3G09030 | EAP3 is a cytolsolic BTB/POZ-domain protein involved in trafficking of PEN3. |
| AT1G10130 | Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis. |
| AT1G70800 | Encodes a novel NPH3/phototropin binding factor with a calcium binding domain that negatively affects hypocotyl bending under blue light conditions in Arabidopsis thaliana and may regulate phototropism. |
| AT5G05190 | hypothetical protein (DUF3133);(source:Araport11) |
| AT3G48090 | Component of R gene-mediated disease resistance in Arabidopsis thaliana with homology to eukaryotic lipases. |
| AT4G39030 | Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient. |
| AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
| AT1G11300 | The annotation for At1g11300 in TAIR10 is incorrect. This locus has been split into two At1g11300 (symbol: EGM1) and At1g11305 (symbol: EGM2) (Olivier Loudet, personal communication, 2013-04-03). See Comment field for revised annotation. |
| AT1G32490 | Encodes a homolog of the yeast PRP2 protein, one of four related DEAH RNA helicases identified as essential cofactors for RNA splicing. Involved in ABI4-regulated ABA signaling under high glucose condition in early seedling growth. |
| AT4G31820 | A member of the NPY family genes (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Encodes a protein with similarity to NHP3. Contains BTB/POZ domain. Promoter region has canonical auxin response element binding site and Wus binding site. Co-localizes to the late endosome with PID. Regulates cotyledon development through control of PIN1 polarity in concert with PID. Also involved in sepal and gynoecia development. |
| AT5G10810 | enhancer of rudimentary homolog ATER |
| AT3G13437 | Brassicaceae specific gene. Overexpression results in Verticillium wilt resistance. |
| AT2G20875 | Encodes a secretory peptide EPF1 involved in stomatal development. EPF1 is related to EPF2 which controls asymmetric cell divisions during stomatal devlopment. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT1G34245 | Encodes a secretory peptide EPF2 expressed in proliferating cells of the stomatal lineage, known as meristemoids, and in guard mother cells, the progenitors of stomata. Controls asymmetric cell divisions during stomatal development. EPF2 is related to EPF1, also involved in stomatal development. Its transcript levels change after inducing MUTE expression in a mute background. EPF2 binds to the ER receptor triggering MAPK activation that in turn inhibits stomatal development. EPF2 competes with STOMAGEN for binding to receptor protein kinases ER, and TMM. |
| AT3G13898 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT3G20290 | Encodes AtEHD1, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD2, At4g05520). |
| AT4G05520 | Encodes AtEHD2, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD1, At3g20290). |
| AT5G11710 | EPSIN1 plays an important role in the vacuolar trafficking of soluble proteins at the trans-Golgi network via its interaction with gamma-ADR, VTI11, VSR1, and clathrin. Associated with actin filaments and with the Golgi complex. Expressed in most tissues. The mRNA is cell-to-cell mobile. |
| AT1G70330 | encodes an adenosine transporter that catalyze a proton-dependent adenosine transport. The mRNA is cell-to-cell mobile. |
| AT4G00900 | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. |
| AT1G03800 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-10). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT3G55990 | Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). The mRNA is cell-to-cell mobile. |
| AT2G25820 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT5G09410 | calmodulin-binding protein, similar to another ethylene-upregulated calmodulin-binding protein ER1 GI:11612392 from (Nicotiana tabacum) |
| AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile. |
| AT5G57090 | Encodes an auxin efflux carrier that is similar to bacterial membrane transporters. Root-specific role in the transport of auxin. Acts downstream of CTR1 and ethylene biosynthesis, in the same pathway as EIN2 and AUX1, and independent from EIN3 and EIN5/AIN1 pathway. In the root, the protein localizes apically in epidermal and lateral root cap cells and predominantly basally in cortical cells. Functions may be regulated by phosphorylation status. EIR1 expression is induced by brassinolide treatment in the brassinosteroid-insensitive br1 mutant. Gravistimulation results in asymmetric PIN2 distribution, with more protein degraded at the upper side of the gravistimulated root. Membrane sterol composition is essential for the acquisition of PIN2 polarity. Its expression is downregulated at hypoxic conditions. RAP2.12 overexpression inhibits this downregulation. |
| AT3G23240 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ERF1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. EREBP like protein that binds GCC box of ethylene regulated promoters such as basic chitinases. Constitutive expression of ERF1 phenocopies ethylene over production. Involved in ethylene signaling cascade,downstream of EIN2 and EIN3. |
| AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
| AT5G07310 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Cytokinin production induced by jasmonate represses adventitious rooting. |
| AT3G20310 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-7). The protein contains one AP2 domain. Phosphorylated by PKS3 in vitro. Involved in ABA-mediated responses. Acts as a repressor of GCC box?mediated transcription together with AtSin3 and HDA19. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT2G40940 | Ethylene receptor, subfamily 1. Has histidine kinase activity. |
| AT4G17490 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress. Involved in regulating root architecture and the response to cold stress. |
| AT1G05010 | Encodes 1-aminocyclopropane-1-carboxylate oxidase |
| AT3G20770 | Encodes EIN3 (ethylene-insensitive3), a nuclear transcription factor that initiates downstream transcriptional cascades for ethylene responses. EIN3 interacts with MYC2, MYC3 and MYC4 to inhibit jasmonate-induced expression of wound-responsive genes and herbivory-inducible genes, and plant defense against generalist herbivores. |
| AT1G73730 | Encodes a putative transcription factor involved in ethylene and sulfate starvation signalling. Isolated DNA binding domain has been shown to bind DNA in vitro. |
| AT1G04370 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT2G44940 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT4G16750 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT4G02680 | Encodes a paralog of ETO1, which is a negative regulator of ACS5 (a key enzyme in ethylene biosynthesis pathway). EOL1 also interacts with and inhibits the activity of ACS5. |
| AT2G33860 | ettin (ett) mutations have pleiotropic effects on Arabidopsis flower development, causing increases in perianth organ number, decreases in stamen number and anther formation, and apical-basal patterning defects in the gynoecium. The ETTIN gene encodes a protein with homology to DNA binding proteins which bind to auxin response elements. ETT transcript is expressed throughout stage 1 floral meristems and subsequently resolves to a complex pattern within petal, stamen and carpel primordia. ETT probably functions to impart regional identity in floral meristems that affects perianth organ number spacing, stamen formation, and regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of the gynoecium, consistent with the proposal that ETT is involved in prepatterning apical and basal boundaries in the gynoecium primordium. It is a target of the ta-siRNA tasiR-ARF. ETT is also a target of AP2; integrateing the functions of AGAMOUS and APETALA2 in floral meristem determinacy. Positive regulation of drought stress response genes. |
| AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
| AT1G13020 | Encodes eIF4B2, eukaryotic initiation factor 4B2. |
| AT3G26400 | member of eIF4B - eukaryotic initiation factor 4B The mRNA is cell-to-cell mobile. |
| AT3G54150 | Encodes a DNA methyltransferase required for pollen exine formation and male fertility via the regulation of callose wall and primexine formation. |
| AT1G10180 | LOW protein: exocyst complex component-like protein;(source:Araport11) |
| AT5G58430 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. Targeted by AvrPtoB to manipulate the defense molecule secretion machinery. |
| AT1G07000 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G13150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and, together with EXO70C2, is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane. |
| AT5G13990 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane and is not found to colocalize with or interact with core exocyst subunits. |
| AT3G29400 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G61010 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G50380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT4G31540 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G55150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT2G39380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT2G28640 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G09440 | EXORDIUM like 4;(source:Araport11) |
| AT1G54490 | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. The mRNA is cell-to-cell mobile. |
| AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT3G03220 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT4G01630 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G39280 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G28950 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G20750 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT4G28250 | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT3G45960 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G17020 | Encodes a member of the exportin protein family (XPO1A) which functions as receptors for nuclear export. Binds to a variety of proteins having leucine rich export signals.Along with XPO1B involved with development of the male and female gametophytes. Sensitive to heat and oxidative stress. |
| AT5G35190 | proline-rich extensin-like family protein;(source:Araport11) |
| AT1G23720 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT3G28550 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT4G08370 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT4G08380 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT1G21310 | Encodes extensin 3. |
| AT1G70990 | Short extensin family protein required during the first phase of dark-grown hypocotyl elongation, regulates the moment and extent of the growth acceleration by modulating cell wall extensibility. |
| AT1G76930 | Encodes an Arabidopsis extensin gene that belongs to cell-wall hydroxyproline-rich glycoproteins. The cross-link of extensins enforces cell wall strength. Transgenic plants overexpressing this gene show an increase in stem thickness. |
| AT3G57630 | Encodes a glycoprotein glycosyl transferase ExAD. Knockout mutants show truncated root hair phenotype. |
| AT4G34390 | extra-large GTP-binding protein 2;(source:Araport11) |
| AT1G21760 | This gene is predicted to encode an F-box protein that is evolutionarily conserved between Arabidopsis and other eukaryotes including S.cerevisiae and humans. It may play a role in regulating translation under conditions of temperature stress. FBP7 transcript levels are increased at high and low temperatures. The mRNA is cell-to-cell mobile. |
| AT3G07870 | FBX92 is an F-box containing protein. Overexpression produces plants with smaller leaves while reduced expression is correlated with increased leaf size and increased rates of cell proliferation. |
| AT4G05010 | F-box family protein;(source:Araport11) |
| AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT2G17036 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT2G24255 | LOW protein: F-box/kelch-repeat protein;(source:Araport11) |
| AT4G35733 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G24040 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT2G05970 | F-box protein (DUF295);(source:Araport11) |
| AT2G24080 | F-box protein (DUF295);(source:Araport11) |
| AT4G14165 | F-box family protein-like protein;(source:Araport11) |
| AT4G17565 | F-box protein (DUF295);(source:Araport11) |
| AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
| AT5G38270 | F-box family protein;(source:Araport11) |
| AT2G04810 | F-box only protein (DUF295);(source:Araport11) |
| AT1G15910 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). |
| AT3G12550 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). |
| AT1G13790 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). |
| AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
| AT1G35530 | Encodes FANCM, a highly conserved helicase that functions as a major factor limiting meiotic crossover formation. It is not directly involved in the repair of DNA lesions but suppresses spontaneous somatic homologous recombination via a RecQ helicase (At-RECQ4A)-independent pathway. |
| AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT2G37678 | Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus. |
| AT4G15090 | Encodes a nuclear localized protein involved in far red light response signaling. Loss of function mutants are defective in far red light responses. For example:prevents leaf senescence under high ratio of red/far-red light conditions.Interacts with homologous gene FHY3. |
| AT4G19990 | FAR1-related sequence 1;(source:Araport11) |
| AT1G76320 | FAR1-related sequence 4;(source:Araport11) |
| AT3G59470 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. FRF1 has been shown to bind the RB-box in vitro. The RB-box contributes to restricting SHOOTMERISTEMLESS expression to the shoot apical meristem. |
| AT3G44860 | Encodes a farnesoic acid carboxyl-O-methyltransferase. The mRNA is cell-to-cell mobile. |
| AT3G44870 | Encodes a protein with 93% identity to a farnesoic acid methyl transferase. SABATH family methyltransferase. |
| AT4G33360 | Encodes an NAD+-dependent dehydrogenase that oxidizes farnesol more efficiently than other prenyl alcohol substrates. |
| AT5G47770 | Encodes a protein with farnesyl diphosphate synthase activity. |
| AT2G36305 | Encodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast. |
| AT5G63910 | Encodes a farnesylcysteine lyase (EC 1.8.3.5) involved in a salvage /detoxification pathway of farnesylcysteine (FC) residues that are liberated during the degradation of prenylated proteins. Because FC is a competitive inhibitor of prenylcysteine methyltransferases involved in the down-regulation of ABA signaling, fcly mutants with elevated FC levels are hypersensitive to ABA. The protein also appears to be glycosylated when translated in vitro in the presence of microsomal membranes and it likely requires FAD for enzymatic activity. |
| AT5G64630 | Chromatin Assembly Factor-1 (CAF-1) p60 subunit. Involved in organization of the shoot and root apical meristems. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. |
| AT1G33390 | Over-expression of this gene results in stem fasciation. The predicted amino acid sequence reveals the presence of two domains (DEXH-box or DEAD-box helicase and DUF1065 domain) and fragments of two more domains (HrpA domain and HA2 domain). |
| AT5G44130 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G52370 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G18580 | fass mutants have aberrant cell shapes due to defects in arrangement of cortical microtubules. Encodes a protein highly conserved in higher plants and similar in its C-terminal part to B' regulatory subunits of type 2A protein phosphatases. Interacts with an Arabidopsis type A subunit of PP2A in the yeast two-hybrid system. |
| AT3G11170 | Chloroplastic enzyme responsible for the synthesis of 16:3 and 18:3 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene expression is induced by wounding in shoot and root. The wound-response in shoot is independent of jasmonic acid mediated pathway whereas the root response is mediated by jasmonic acid. The mRNA is cell-to-cell mobile. |
| AT2G38550 | Mediates fatty acid transport from plastid. |
| AT3G20510 | Encodes a member of the Tmemb_14 family that is predicted to be localized to the membranes of the secretory pathway. The mRNA is cell-to-cell mobile. |
| AT5G22500 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. |
| AT3G44550 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. The mRNA is cell-to-cell mobile. |
| AT3G44560 | fatty acid reductase 8;(source:Araport11) |
| AT5G63560 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G13985 | FBD-associated F-box protein;(source:Araport11) |
| AT1G57790 | F-box family protein;(source:Araport11) |
| AT1G47400 | Involved in regulation of iron deficiency response genes. Overexpression results in hyperaccumulation of Fe and Mn. |
| AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
| AT3G51550 | Encodes a synergid-expressed, plasma-membrane localized receptor-like kinase that accumulates asymetrically in the synergid membrnane at the filiform apparatus and mediates male-female gametophyte interactions during pollen tube reception. Also involved in powdery mildew infection. Mutants show faster root elongation under dim light, the protein is required for intracellular accumulation of AHA2 under dim-light growth conditions. Positively regulates flowering by modulating the transcript accumulation and mRNA alternative splicing of certain flowering-related genes, including FLOWERING LOCUS C (FLC) and its homolog MADS AFFECTING FLOWERING (MAF). However, the RALF1 ligand negatively regulates flowering compared with FER. |
| AT2G27510 | ferredoxin 3;(source:Araport11) |
| AT3G08040 | Encodes a member of the MATE (multidrug and toxin efflux family), expressed in roots but not shoots. Mutants accumulate excess iron, manganese and zinc, and express root Fe(III) chelatase activity even under iron sufficiency conditions. FRD3 is likely to function in root xylem loading of an iron chelator or other factor necessary for efficient iron uptake out of the xylem or apoplastic space and into leaf cells. |
| AT1G01590 | Encodes a ferric-chelate reductase that is expressed at extremely low levels in Fe deficiency-induced seedlings. |
| AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
| AT5G23990 | Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and flowers, but not cotyledons. |
| AT5G50160 | Encodes a ferric chelate reductase that is expressed in shoots and flowers. |
| AT3G27120 | Encodes a conserved AAA-ATPase that acts as a negative regulator of meiotic CO formation. |
| AT4G26700 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
| AT4G22910 | FIZZY-related 2;(source:Araport11) |
| AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
| AT1G62560 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT5G54500 | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
| AT5G28470 | Encodes a member of the nitrate/peptide NTR/PTR family of transporters is required for accumulation and transport of pollen-specific flavonol 3-O-sophorosides, characterized by a glycosidic β-1,2-linkage, to the pollen surface of Arabidopsis. |
| AT5G63595 | flavonol synthase 4;(source:Araport11) |
| AT2G19190 | Encodes a receptor-like protein kinase that is involved in early defense signaling. Expression of this gene is strongly induced during leaf senescence. It is a target of the transcription factor AtWRKY6. |
| AT3G12145 | A novel leucine-rich repeat protein. Interacts directly with MADS domain transcription factor. |
| AT1G43800 | Δ9 stearoyl-ACP desaturase which together with FAB2, AAD1, and AAD5 redundantly participates in oil storage during the maturation phase. |
| AT5G25260 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot2 complexes are found in microdomains and may be involved in plant-pathogen interactions, water transport and intracellular trafficking. |
| AT5G25250 | Encodes a protein that is involved in a membrane microdomain-dependent, but clathrin-independent, endocytic pathway required for optimal seedling development. The mRNA is cell-to-cell mobile. |
| AT1G35460 | Encodes a bHLH transcription factor involved in CFL1-mediated regulation of cuticle development. Overexpression leads to abnormal cuticle development. |
| AT1G51140 | Encodes a basic helix-loop-helix-type transcription factor involved in photoperiodism flowering. Binds to the E-box cis-element in the CONSTANS (CO) promoter to regulate flowering. Interacts with CFL1 and along with CFLAP2 negatively regulates cuticle development. Binds to the potassium channel gene KAT1 as a dimer. The DNA-binding capacity is inhibited in response to ABA through phosphorylation-dependent monomerization. |
| AT4G25530 | Encodes a homeodomain-containing transcription factor that controls flowering. FWA is silenced in wild type plants and reverse of the imprinted silencing causes a late flowering phenotype. FWA gene contains two tandem repeats around the transcription start site that are necessary and sufficient for silencing via DNA methylation. |
| AT2G20650 | Encodes a putative RING E3 ubiquitin ligase based on its 84.5% amino acid identity with FLY1, which possesses this activity in vitro. It is predicted to be localized to the endomembrane system based on protein topology.The mucilage of fly2 mutant seeds hydrated in water resembles wild type seed mucilage. |
| AT5G66380 | Encodes a folate transporter that is located in the chloroplast envelope and is able to mediate exogenous folate uptake when expressed in E. coli. However, this is not the sole folate transporter for chloroplasts as null mutants of this gene have no discernible phenotype when grown under folate-sufficient conditions and contained wild-type levels of folates in leaves. |
| AT4G27760 | Encodes an oxidoreductase required for vegetative shoot apex development. Mutants display disruptions in leaf positioning and meristem maintenance. |
| AT3G07540 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
| AT3G05470 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
| AT1G70140 | Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton. |
| AT5G07770 | Actin-binding FH2 protein;(source:Araport11) |
| AT5G07780 | Encodes a class II formin that nucleates actin assembly, binds to the barbed-end of actin filaments and antagonizes the effect of FH1 on actin dynamics. The mRNA is cell-to-cell mobile. |
| AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
| AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
| AT4G33240 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
| AT3G48480 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
| AT4G17060 | Encodes one of the FRI interacting proteins: FRIGIDA INTERACTING PROTEIN 1 (FIP1)/At2g06005, FIP2/ At4g17060. FRI (At4G00650) is a major determinant of natural variation in Arabidopsis flowering time. |
| AT5G51830 | Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development. |
| AT2G31390 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
| AT2G36460 | Aldolase superfamily protein;(source:Araport11) |
| AT2G29080 | encodes an FtsH protease that is localized to the mitochondrion |
| AT1G49710 | Encodes a protein with core α1,3-fucosyltransferase activity. |
| AT2G15390 | Encodes an alpha-(1,2)-fucosyltransferase. |
| AT3G16700 | Fumarylacetoacetate hydrolase homolog. |
| AT4G24740 | a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins. |
| AT3G61140 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Component of the nuclear-localized COP9 complex. Mutants display striking purple coloration due to anthocyanin accumulation in their cotyledons, first become defective during embryogenesis and exhibit limited seedling development. |
| AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
| AT4G36730 | member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box |
| AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
| AT5G10450 | Encodes a member of the 14-3-3 gene family that is a lambda isoform (14-3-3λ). Interacts with APX3 (ascorbate peroxidase) and AKR2 , suggesting a role in mediating oxidative metabolism in stress response. This protein was shown to colocalize and interact with SERK1 by which it is phosphorylated. This protein is also reported to interact with the phosphorylated form of the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Interacts with JAZ10.4 which lacks the Jas motif. It is also phosphorylated by CRPK1 as part of the response to cold and translocates to the nucleus after phosphorylation. |
| AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The mRNA is cell-to-cell mobile. |
| AT5G27320 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. |
| AT5G23790 | Predicted to encode a galactinol synthase. |
| AT4G26250 | Predicted to encode a galactinol synthase. |
| AT5G14470 | GHMP kinase family protein;(source:Araport11) |
| AT3G53950 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT5G19580 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT2G32740 | galactosyltransferase 13;(source:Araport11) |
| AT1G06780 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
| AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT5G62270 | Ribosomal protein L20;(source:Araport11). Required for proper mitochondrial cristae formation. Expressed throughout plant. Mutants are defective in late stages of megagametogenesis. Pollen tube defective. Gametophytic lethality is probably due to mitochondrial disfunction. |
| AT5G48030 | encodes a mitochondrially targeted DNAJ protein involved in female gametophyte development. |
| AT2G36830 | Encodes a tonoplast intrinsic protein, which functions as water channel. It has also been shown to be able to facilitate the transport of urea and hydrogen peroxide. Highly expressed in vascular tissues of the root, stem, cauline leaves and flowers but not in the apical meristems. The mRNA is cell-to-cell mobile. |
| AT1G78680 | The Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT4G39640 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in vascular tissues (predominantly phloem) of leaves and is involved in the degradation of glutathione. The encoded enzyme also mitigates oxidative stress by metabolizing GSSG (oxidized form of GSH - glutathione) in the apoplast. |
| AT5G24280 | Encodes GMI1, a structural-maintenance-of-chromosomes-hinge domain-containing protein. Involved in somatic homologous recombination. |
| AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
| AT1G75750 | GA-responsive GAST1 protein homolog regulated by BR and GA antagonistically. Possibly involved in cell elongation based on expression data The mRNA is cell-to-cell mobile. |
| AT3G02885 | GASA5, is involved in the regulation of seedling thermotolerance. |
| AT3G24050 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT1G08000 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G28340 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G47140 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G66320 | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
| AT3G51080 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G15740 | Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ. |
| AT5G42640 | Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ. |
| AT2G20570 | Encodes GLK1, Golden2-like 1, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK2, Golden2-like 2, is encoded by At5g44190. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. GLK1 is also a member of the GARP transcription factor family. |
| AT2G06025 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT4G28030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G73250 | encodes a bifunctional 3, 5-epimerase-4-reductase in L-fucose synthesis and converts GDP-D-mannose to GDP-L-fucose in vitro along with MUR1 (GDP-D-mannose 4,6-dehydratase). It is expressed in all tissues examined, but most abundantly in roots and flowers. |
| AT5G66280 | GDP-D-mannose 4,6-dehydratase |
| AT1G53990 | Contains lipase signature motif and GDSL domain. The mRNA is cell-to-cell mobile. |
| AT5G60550 | Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. |
| AT1G22300 | Encodes a 14-3-3 protein. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Might act as a stabilization factor to mediate the oligomerization of REM on the plasma membrane. |
| AT3G02520 | Encodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν). |
| AT2G18640 | Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
| AT4G38460 | Encodes a type II small subunit of the heteromeric geranyl(geranyl) diphosphate synthase that is localized to the chloroplast, expressed in petals and sepals and is involved in monoterpene biosynthesis. The mRNA is cell-to-cell mobile. |
| AT1G09560 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. The mRNA is cell-to-cell mobile. |
| AT5G39100 | germin-like protein (GLP6) |
| AT3G05930 | germin-like protein (GLP8) |
| AT1G02335 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. |
| AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
| AT1G14920 | Similar to a putative transcription factor and transcriptional coactivators. Repressor of GA responses and involved in gibberellic acid mediated signaling. Member of the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. GAI may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. |
| AT3G47190 | Encodes a class III gibberellin 2-oxidase that oxidizes GA12 to GA110. |
| AT1G47990 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities. |
| AT3G17203 | a pseudogene initially named GA2ox5 and thought to be a member of the gibberellin 2-oxidase enzyme family. It was later shown to have a large DNA insert in the putative gene model. |
| AT5G07200 | encodes a gibberellin 20-oxidase. |
| AT1G80340 | Encodes a protein with gibberellin 3 β-hydroxylase activity. The protein was heterologously expressed in E. coli and shown to catalyze the hydroxylation of both GA9 and GA20. |
| AT4G21690 | gibberellin 3-oxidase 3;(source:Araport11) |
| AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
| AT1G30540 | Actin-like ATPase superfamily protein;(source:Araport11) |
| AT2G41760 | Controls the expression of specific defence-response genes, activates the synthesis pathway for the phytoalexin camalexin and influences basal resistance to Pseudomonas syringae pv tomato (Pst). |
| AT1G65440 | Related to yeast Spt6 protein, which functions as part of a protein complex in transcription initiation and also plays a role in chromatin structure / assembly. It encodes a putative WG/GW-repeat protein involved in the regulation of apical-basal polarity of embryo |
| AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
| AT5G40760 | Encodes a cytosolic glucose-6-phosphate dehydrogenase that is insensitive to reduction by DTT and whose mRNA is expressed ubiquitously. The mRNA is cell-to-cell mobile. |
| AT1G67490 | Encodes an alpha-glucosidase I enzyme that catalyzes the first step in N-linked glycan processing. Localized to the endoplasmic reticulum (ER). |
| AT5G25980 | Myrosinase (thioglucoside glucohydrolase) gene involved in glucosinoloate metabolism. The mRNA is cell-to-cell mobile. |
| AT2G25450 | Encodes a 2-oxoacid-dependent dioxygenase involved in the production of 2-hydroxybut-3-enyl glucosinolate. |
| AT1G70090 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT5G61250 | Belongs to the plant glycoside hydrolase family 79. Encodes a protein with several posttranslational modification sites including O-β-GlcNAc attachment sites and serine-, threonine- and tyrosine-phosphorylation sites, suggesting that this protein is extensively modified posttranslationally. The protein is predicted (WoLF PSORT program) to be secreted. |
| AT1G33800 | Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile. |
| AT5G17330 | Encodes one of two isoforms of glutamate decarboxylase. The mRNA is cell-to-cell mobile. |
| AT1G65960 | glutamate decarboxylase (GAD2) The mRNA is cell-to-cell mobile. |
| AT2G02010 | glutamate decarboxylase 4;(source:Araport11) |
| AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
| AT5G48410 | member of Putative ligand-gated ion channel subunit family |
| AT2G17260 | Encodes a glutamate receptor. Involved in calcium-programmed stomatal closure. |
| AT5G27100 | member of Putative ligand-gated ion channel subunit family |
| AT2G24720 | member of Putative ligand-gated ion channel subunit family |
| AT2G24710 | member of Putative ligand-gated ion channel subunit family |
| AT5G11210 | member of Putative ligand-gated ion channel subunit family |
| AT5G11180 | member of Putative ligand-gated ion channel subunit family |
| AT1G42540 | member of Putative ligand-gated ion channel subunit family |
| AT2G32400 | Glr5 |
| AT2G41220 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile. |
| AT3G48730 | glutamate-1-semialdehyde 2,1-aminomutase 2;(source:Araport11) |
| AT5G63570 | Encodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced. The mRNA is cell-to-cell mobile. |
| AT1G23310 | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway. |
| AT5G24920 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
| AT5G37600 | encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
| AT5G35630 | chloroplastic glutamine synthetase The mRNA is cell-to-cell mobile. |
| AT3G63080 | Encodes glutathione peroxidase. |
| AT1G63460 | Encodes GPX8 (glutathione peroxidase 8). Involved in the suppression of oxidative damages in nucleus and cytosol. The mRNA is cell-to-cell mobile. |
| AT1G02920 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT4G02520 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT2G29450 | Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002) |
| AT1G69930 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G17190 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT3G43800 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
| AT1G53680 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29440 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G41220 | Encodes glutathione transferase belonging to the theta class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G12900 | glyceraldehyde 3-phosphate dehydrogenase A subunit 2;(source:Araport11) |
| AT1G42970 | Encodes chloroplast localized glyceraldehyde-3-phosphate dehydrogenase that can use both NADH and NADPH to reduce 1,3-diphosphate glycerate. It forms A2B2 heterotetramers with GapA forms of the GADPH enzyme. These complexes are active in the light under reducing conditions, but show reduced NADPH-dependent activity in response to oxidized thioredoxins and increased NAD(H)/NADP(H) ratios due to the formation of inactive A8B8 hexadecamers. The mRNA is cell-to-cell mobile. |
| AT1G16300 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT5G60620 | Glycerol-3-phosphate acyltransferase localized to the ER. Similar to mammalian cells involved in storage oil formation. ER-localized GPAT enzyme responsible for plant membrane lipid and oil biosynthesis. |
| AT1G06520 | sn-glycerol-3-phosphate 2-O-acyltransferase. Expressed in flower buds and siliques. Homozygous mutant plants are male sterile. |
| AT1G02390 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT4G01950 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
| AT5G06090 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT5G43300 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT1G74210 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT5G45350 | proline-rich family protein;(source:Araport11) |
| AT5G07530 | encodes a glycine-rich protein that has oleosin domain and is expressed specifically during flower stages 10 to 12. Protein is found on mature pollen coat. |
| AT2G22660 | Encodes a member of a family of DUF1399 domain containing proteins. GRDP1 is involved in germination and response to ABA. Loss of function mutants have reduced germination in the presence of osmotic stressors. |
| AT5G07510 | encodes a glycine-rich protein that is expressed in low abundance in stems and leaves, and very low abundance in flowers. |
| AT1G70710 | endo-1,4-beta-glucanase. Involved in cell elongation. |
| AT2G44550 | glycosyl hydrolase 9B10;(source:Araport11) |
| AT4G38990 | glycosyl hydrolase 9B16;(source:Araport11) |
| AT4G39000 | glycosyl hydrolase 9B17;(source:Araport11) |
| AT1G23210 | glycosyl hydrolase 9B6;(source:Araport11) |
| AT4G11050 | glycosyl hydrolase 9C3;(source:Araport11) |
| AT2G44290 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G22580 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G12360 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G70250 | Encodes a Protease inhibitor/seed storage/LTP family protein. |
| AT1G36150 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G08670 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G22600 | Glycosylphosphatidylinositol (GPI)-anchored LTPg protein, downregulated in syncytia induced by the beet cyst nematode Heterodera schachtii and root knot nematode Meloidogyne incognita. Infection with bacteria (Pseudomonas syringae) and fungi (Botrytis cinerea) leads to the induction of the gene in leaves. |
| AT4G37690 | Unlike its close paralog MUCI10 (At2g22900), GT6 is not required for the biosynthesis of seed coat mucilage. GT6 is preferentially expressed in sub-epidermal cell layers of the seed coat. |
| AT1G67290 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT1G64185 | Vicinal oxygen chelate (VOC) superfamily member. |
| AT3G17420 | Serine/threonine protein kinase-like protein expressed in etiolated cotyledons and found in glyoxysomes. |
| AT5G19980 | Encodes a Golgi-localized nucleotide-sugar transporter. |
| AT1G18190 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC2 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (508?668 aa) portion of the protein. |
| AT5G58960 | Mutant plants display impaired light-regulation of the hypocotyl randomization response. |
| AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
| AT1G53130 | Encodes GRIM REAPER (GRI), involved in the regulation of cell death induced by extracellular ROS (reactive oxygen species). Secreted into the extracellular space. |
| AT3G61570 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC3 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (161 aa) portion of the protein. |
| AT2G36400 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower. |
| AT4G34460 | Encodes the heterotrimeric G-protein beta subunit and is involved in organ shape. A significant fraction of the protein is found in the ER. Mutants carrying null alleles express similar fruit phenotypes, as seen in er plants, but differ from er in that the stem is only slightly shorter than that in the wild type, the pedicel is slightly longer than that in the wild type, and the leaves are rounder than those in er mutants. Gene is expressed in all tissues examined, with highest expression level found in siliques. It is involved in resistance to Plectosphaerella cucumerina. The predicted protein has two DWD motifs. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. It seems to be involved in the calcium-mediated response to extracellular ATP. |
| AT5G64300 | encodes GTP cyclohydrolase II that can functionally complement E. coli mutant deficient in this gene. It also has 3,4-dihydroxy-2-butanone-4-phosphate synthase activity which makes it a bifunctional enzyme involved in the formation of the pyrimidine and of the carbohydrate from GTP and ribulose-5-phosphate, respectively The mRNA is cell-to-cell mobile. |
| AT2G44100 | GDP dissociation inhibitor involved in vesicular membrane traffic |
| AT1G03830 | Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Pseudo-GTPase which sequesters catalytically active GBPL3 under basal conditions but is displaced by GBPL3 LLPS when it enters the nucleus following immune cues to drive the formation of unique membraneless organelles. |
| AT5G46070 | Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Within membraneless organelles termed GBPL defence-activated condensates (GDACs), directly binds defence-gene promoters and recruited specifc transcriptional coactivators of the Mediator complex and RNA polymerase II machinery to massively reprogram host gene expression for disease resistance. |
| AT3G53630 | hypothetical protein;(source:Araport11) |
| AT2G18960 | Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA. The mRNA is cell-to-cell mobile. |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
| AT2G24520 | plasma membrane H+-ATPase;(source:Araport11) |
| AT4G28490 | Member of Receptor kinase-like protein family. Controls the separation step of floral organ abscission. The mRNA is cell-to-cell mobile. |
| AT1G28440 | HAESA-like 1;(source:Araport11) |
| AT5G65710 | Encodes a protein controlling the separation step of floral organ abscission.Necessary for pathogen-triggered leaf abscission. |
| AT3G60630 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT4G21150 | ribophorin II (RPN2) family protein;(source:Araport11) |
| AT5G56250 | hapless 8;(source:Araport11) |
| AT2G36450 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic overexpression of HRD increases the density of the root network and improves water and salt stress tolerance in Arabidopsis. Overexpression of HRD in rice causes an increase in plant biomass and drought resistance. |
| AT5G10010 | myosin-H heavy protein;(source:Araport11) |
| AT5G16820 | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. |
| AT4G18880 | Encodes a member of Heat Stress Transcription Factor(Hsf) family that is a substrate of the MPK3/MPK6 signaling and regulates stress responses. |
| AT3G51910 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
| AT1G46264 | Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions. |
| AT2G41690 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G17210 | Encodes a heat stable protein with antimicrobial and antifungal activity. |
| AT4G29770 | Target of trans acting-siR480/255. Testing. |
| AT1G06330 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G06130 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G23000 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G30110 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT1G69720 | Encodes a member (HO3) of the heme oxygenase family. |
| AT1G58300 | Encodes a member (HO4) of the heme oxygenase family. |
| AT2G39740 | Encodes HESO1 (HEN1 suppressor 1), a terminal nucleotidyl transferase that uridylates miRNAs and siRNAs at 3′ end. HESO1-mediated 3′ uridylation destabilizes small RNAs in hen1. |
| AT3G46290 | Encodes HERCULES1 (HERK1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT4G29130 | Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment. |
| AT1G47840 | Encodes a putative hexokinase. |
| AT4G13420 | Encodes a protein of the KUP/HAK/KT potassium channel class that is upregulated in the roots by K levels. |
| AT3G45060 | member of High affinity nitrate transporter family |
| AT5G14570 | Encodes ATNRT2.7, a nitrate transporter that controls nitrate content in seeds. Expression is detected in reproductive organs and peaks in seeds. Localized to the vacuolar membrane. |
| AT3G09650 | RNA binding protein involved in the processing of chloroplast psbB-psbT-psbH-petB-petD transcript unit. |
| AT4G37200 | Encodes thioredoxin-like protein with disulfide reductase activity that is involved in the biogenesis of the plastid cytochrome b6f complex. Protein is located in the thylakoid membrane with the C-terminal hydrophilic portion, containing the thioredoxin like domain, extending into the thylakoid lumen. |
| AT4G35250 | HCF244 is a member of the atypical short-chain dehydrogenase/reductase superfamily, a modified group, which has lost enzyme activity.HCF244 interacts with unknown partners in a 200-400 kD membrane associated complex. |
| AT3G17040 | It is a RNA tetratricopeptide repeat-containing protein required for normal processing of transcripts from the polycistronic chloroplast psbB-psbT-psbH-petB-petD operon coding for proteins of the photosystem II and cytochrome b6/f complexes. Localizes to the chloroplast membrane. Involved in regulating plastidial gene expression and biogenesis. It binds in the psbT?psbH intercistronic region and blocks the progression of 5′ → 3′ exoribonucleases, which defines the 5′ end of processed psbH transcripts and also stabilizes the downstream RNA segment. In addition, HCF107 binding remodels the structure of the psbH 5′ UTR in a way that can account for its ability to enhance psbH translation. |
| AT1G20693 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile. |
| AT2G17560 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT4G35570 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Cannot be phosphorylated by CK2alpha. |
| AT1G60995 | ER localized protein involved in regulation of sterol metabolism. Regulates the accumulation of HMGR1 and HMGR2. HISE1 shares 50% amino acid sequence similarity (50% positive substitution) with the mouse ER membrane protein membralin (NP_001346561.1; PMID:31712757) |
| AT4G10310 | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
| AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
| AT5G62630 | hipl2 protein precursor;(source:Araport11) |
| AT4G26900 | encodes a glutamine amidotransferase and cyclase, catalyzes the fifth and sixth steps of the histidine biosynthetic pathway |
| AT3G56490 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT2G17820 | Encodes a member of the histidine kinase family. |
| AT5G10720 | member of Histidine Kinase |
| AT1G61270 | Involved in transport of 1-Aminocyclopropane-1-carboxylic acid (ACC). |
| AT1G03430 | Encodes AHP5, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT3G29350 | Encodes AHP2, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function in His-to-Asp phosphorelay signal transduction and as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT5G63890 | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |
| AT5G10400 | Histone superfamily protein;(source:Araport11) |
| AT3G27360 | Histone superfamily protein;(source:Araport11) |
| AT1G16710 | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides. |
| AT1G55970 | HAC4 is most likely to be an expressed pseudogene that lacks HAT function. there is a single nucleotide deletion in both the HAC4 genomic and cDNA sequences relative to its homologs. The resulting frameshift within the open reading frame causes a stop codon to occur within the predicted acetyltransferase catalytic domain. |
| AT3G12980 | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC5 acetylation of the H3 or H4 peptides, suggesting that HAC5 can acetylate any of several lysines present in the peptides. Di-acetylation of both lysines 9 and 14 on the H3 peptide significantly reduces the level of incorporated radioactive acetylation catalyzed by HAC5, indicating that HAC5 may acetylate either lysine 9 or lysine 14. The mRNA is cell-to-cell mobile. |
| AT3G54610 | Encodes a histone acetyltransferase that plays a role in the determination of the embryonic root-shoot axis. It is also required to regulate the floral meristem activity by modulating the extent of expression of WUS and AG. In addition, it is involved in stem cuticular wax accumulation by modulating CER3 expression via H3K9/14 acetylation. In other eukaryotes, this protein is recruited to specific promoters by DNA binding transcription factors and is thought to promote transcription by acetylating the N-terminal tail of histone H3. The enzyme has indeed been shown to catalyse primarily the acetylation of H3 histone with only traces of H4 and H2A/B being acetylated. Non-acetylated H3 peptide or an H3 peptide that had been previously acetylated on K9 both serve as excellent substrates for HAG1-catalyzed acetylation. However, prior acetylation of H3 lysine 14 blocks radioactive acetylation of the peptide by HAG1. HAG1 is specific for histone H3 lysine 14. |
| AT3G18520 | Encodes a protein with similarity to histone deacetylases. The histone deacetylase domain of HDA15 (HDA15HD) assembles as tetrameric forms with each monomer composed of 12 alpha-helices and 9 beta-sheets (DOI: 10.1104/pp.20.00604).Plants expressing RNAi directed against this gene show a moderate resistance to agrobacterium-mediated root transformation. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. |
| AT3G44680 | Encodes HDA9 (a RPD3-like histone deacetylase). Functions in promoting the onset of leaf senescence.The hda9 mutant shows enhanced H3K9 acetylation levels,based on immunodetection using H3K9ac antibodies. Negatively controls gene expression in concert with interacting proteins POWERDRESS (PWR), HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 15 (HOS15), WRKY53, ELONGATED HYPOCOTYL 5 (HY5), ABA INSENSITIVE 4 (ABI4) and EARLY FLOWERING 3 (ELF3). Involved in mutual negative feedback regulation with WRKY53. Mutations lead to a mild early flowering phenotype under SD. |
| AT5G61070 | Encodes a protein with similarity to histone deacetylases, a class of chromatin remodeling factors which act on H3/H4 histones. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. Expressed in roots where it appears to regulate the expression of epidermal cell fate genes controlling hair cell differentiation. |
| AT5G02560 | Encodes HTA12, a histone H2A protein. |
| AT3G59960 | histone-lysine N-methyltransferase ASHH4;(source:Araport11) |
| AT2G20000 | Required for cell division and cell differentiation in meristems. Encodes a homolog of the CDC27 subunit of the anaphase-promoting complex (APC). Unlike other CDC27 homologs in Arabidopsis, its transcription is cell cycle regulated. Strong hbt mutants give rise to seedlings that lack an anatomically recognizable quiescent center and differentiated columella root cap cells, the cell types derived from the wild-type hypophysis. Furthermore, they have no mitotically active root meristem and lack a differentiated lateral root cap. |
| AT3G01470 | Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33). |
| AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
| AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile. |
| AT2G18350 | homeobox protein 24;(source:Araport11) |
| AT5G65410 | Encodes ZFHD2, a member of the zinc finger homeodomain transcriptional factor family.Gain of function of ATHB25 (35S and UBQ10 proomoters) and double loss of function of ATHB25 and ATHB22 increases and decreases, respectively, seed longevity. This phenotype is maternal and related to seed coat alterations. Gain of function increases expression of GA3OX2 and GA4 and GA1 levels. Together with REM7 induces the expression of genes controlling shoot stem characteristics by ectopic expression in roots. |
| AT5G60480 | homeobox protein 26;(source:Araport11) |
| AT5G15210 | Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family. |
| AT1G14687 | homeobox protein 32;(source:Araport11) |
| AT5G46880 | homeobox-7;(source:Araport11) |
| AT2G01430 | ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes. |
| AT1G70920 | homeobox-leucine zipper protein 18;(source:Araport11) |
| AT3G60390 | Encodes homeobox protein HAT3. |
| AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
| AT1G34650 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT1G05230 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Mutants have trichomes that appear glass-like under a dissecting microscope as compared to the wild-type trichomes. The mutations do not affect trichome growth or branch number. |
| AT3G11945 | Encodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. |
| AT1G79050 | recA DNA recombination family protein;(source:Araport11) |
| AT3G54420 | encodes an EP3 chitinase that is expressed during somatic embryogenesis in 'nursing' cells surrounding the embryos but not in embryos themselves. The gene is also expressed in mature pollen and growing pollen tubes until they enter the receptive synergid, but not in endosperm and integuments as in carrot. Post-embryonically, expression is found in hydathodes, stipules, root epidermis and emerging root hairs. |
| AT4G25540 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH3 heterodimers bound 'insertion-deletion' DNA with three nucleotides (+AAG) or one nucleotide (+T) looped out much better than they bound DNA with a base/base mispair (T/G). |
| AT3G44530 | Encodes a nuclear localized WD-repeat containing protein involved in negative regulation of knox gene expression via epigenetic mechanism of chromatin re-organization. It is a part of the HISTONE REGULATOR complex that deposits histones in a DNA synthesis-independent manner and affects both nucleosome occupancy and the maintenance of transcriptional silencing. Interacts physically and genetically with AS1. Expressed in meristem and leaf primordia. Homozygous mutants are embryo lethal. Phenotype of cosuppressed lines is variable but show effects on leaf development similar to as1/as2. |
| AT5G50930 | Encodes a protein with similarity to mammalian MHF1 that acts in the same pathway as FANCM to restrain class II meiotic crossing over, and acts with FANCM during meiosis and to repair cross-links. It also assumes an opposing role from FANCM in homologous recombination and only FANCM is essential for replicative repair in the absence of the endonuclease MUS81. |
| AT1G56110 | NOP56-like protein |
| AT3G19210 | Encodes RAD54, a member of the SWI2/SNF2 family of DNA-stimulated ATPases. Functions in DNA repair via homologous recombination. |
| AT3G50460 | Homolog of RPW8 |
| AT3G50470 | Homolog of RPW8 |
| AT3G50480 | Homolog of RPW8 |
| AT4G22970 | Encodes a separase (ESP), homologous to human and mouse separase protein. Separase is a capase family protease required for the release of sister chromatid cohesion during meiosis and mitosis. Arabidopsis separase contains a predicted 2Fe2S-ferredoxin domain that is not present in the proteins of other organisms. Also contains a putative EF-hand calcium binding domain. Mutant seeds exhibited embryo arrest at the globular stage. The endosperm also exhibited a weak titan-like phenotype. Transgenic plants expressing AESP RNA interference (RNAi) from the meiosis-specific DMC1 promoter exhibited alterations in chromosome segregation during meiosis I and II that resulted in polyads containing from one to eight microspores. Plays an essential role in embryo development. Required for the removal of cohesin from meiotic chromosomes and establishment of meiotic nuclear domains. This gene was also identified through the rsw4 mutant. Lines carrying recessive, temperature-sensitive mutations exhibit reduced anisotropic growth at 30 degrees Celsius. Microtubules and cellulose microfibrils are not depleted or disoriented in the mutants at the restrictive temperature. |
| AT1G04050 | Encodes SUVR1, one of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. Localized to the nucleolus, maybe involved in regulation of rRNA expression. |
| AT3G23100 | A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. Yeast two-hybrid analysis demonstrated a strong interaction between A. thaliana DNA ligase IV and the A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. This interaction is shown to be mediated via the tandem BRCA C-terminal domains of A. thaliana DNA ligase IV protein. |
| AT5G02410 | Encodes ALG10, an ER-resident alpha1,2-glucosyltransferase that is required for lipid-linked oligosaccharide biosynthesis and subsequently for normal leaf development and abiotic stress response. |
| AT1G10030 | Encodes a protein that functions as a scaffolding platform for coassembling the sterol C4 demethylation enzyme complex. It also plays an essential role in the maintenance of polar auxin transport (PAT) by restricting the release and accumulation of 4-carboxy-4-methyl-24-methylenecycloartanol (CMMC), a PAT inhibitor. |
| AT5G48120 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G16440 | Encodes a [FeFe]-hydrogenase-like protein named Gollum (for Growth in different Oxygen LeveLs inflUences Morphogenesis). Heterologous expression of Gollum in E. coli indicates that it probably contains two [Fe-S] clusters with different magnetic properties. Sequence alignment analysis indicates that these two clusters would be topologically equivalent to the mesial and proximal [Fe-S] centers of [FeFe]-hydrogenases. Knockdown mutants (RNAi) show a dwarf phenotype at the normal atmospheric partial oxygen pressure of 21 kPa. This dwarf phenotype could be rescued by growing the plant under low oxygen pressure (5kPa), suggesting a role for this gene in oxygen sensing. |
| AT5G08110 | Plays a role in the maintenance of genome stability and the repair of aberrant replication intermediates in the root meristem. Is involved with RAD1, FAN1, and RECQ4A in the repair of DNA CLs. |
| AT4G39740 | Encodes HCC2, one of the two Arabidopsis genes (HCC1 and HCC2) resulting from a duplication with homology to the SCO proteins involved in copper insertion during cytochrome c oxidase (COX) assembly in other organisms. HCC2, which lacks the cysteines and histidine putatively involved in copper binding, functions in copper sensing and redox homeostasis. |
| AT4G13940 | Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. The mRNA is cell-to-cell mobile. |
| AT2G17265 | Encodes a homoserine kinase (HSK) which produces O-phospho-L-homoserine (HserP), a compound at the branching point of methionine and threonine biosynthesis. HSK is found in the stromal fraction of chloroplasts. Mutation of this gene results in higher level of the amino acid homoserine and resistance to downy mildew pathogen Hyaloperonospora arabidopsidis. |
| AT1G12270 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G18360 | Host immune receptor which recognizes the conserved effector HopB1. |
| AT1G70690 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT1G80600 | Encodes HopW1-1-Interacting protein 1 (WIN1). Interacts with the P. syringae effector HopW1-1. WIN1 is a putative acetylornithine transaminase. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320). Mediates red-light inhibition of seed germination. |
| AT3G50950 | Encodes a canonical CC-type NLR protein that is required for the recognition of the T3SE HopZ1a as well as several other Hop effectors from the pathogenic bacteria P. syringae. |
| AT3G25790 | Encodes a nuclear localized member of the GARP family of transcription factors. Along with AtNIGT1/HRS1 it is involved in nitrate and phosphate signaling in the root. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT4G32010 | Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing. |
| AT4G22670 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The mRNA is cell-to-cell mobile. |
| AT3G63070 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. The mRNA is cell-to-cell mobile. |
| AT4G02730 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G24960 | Homologous to a eukaryote specific ABA- and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. The mRNA is cell-to-cell mobile. |
| AT4G17520 | Hyaluronan / mRNA binding family;(source:Araport11) |
| AT1G20050 | C-8 sterol isomerase that also plays a role in miRNA function. |
| AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile. |
| AT4G20930 | Encodes a 3-hydroxyisobutyrate dehydrogenase. |
| AT5G08280 | Encodes a protein with porphobilinogen deaminase activity. This protein is targeted to the chloroplast. Mutants spontaneously develop chlorotic leaf lesions in the absence of pathogen attack, resembling the phenotype of lesion-mimic mutants. It has been shown to interact with the PPR protein AtECB2 for chloroplast RNA editing. |
| AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
| AT1G79870 | Hydroxyphenylpyruvate reductase (HPPR), which catalyzes the reduction of 4-hydroxyphenylpyruvic acid (pHPP) to 4-hydroxyphenyllactic acid (pHPL). Together with HPPR3 and TAT1 involved in the biosynthesis of pHPL from tyrosine. |
| AT2G45630 | Hydroxyphenylpyruvate reductase (HPPR) family member with low activity. |
| AT2G25260 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT4G32120 | Encodes a hydroxyproline O-galactosyltransferase. |
| AT2G25300 | Encodes a hydroxyproline O-galactosyltransferase. |
| AT1G69840 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT5G51570 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT1G64960 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G61460 | Encodes SMC6B (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6B), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
| AT1G13300 | Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. |
| AT5G55510 | PRAT protein family which has a unique system for importing and exporting proteins from chloroplasts. Acts in the export of proteins from chloroplasts during leaf senescence. |
| AT1G05575 | transmembrane protein;(source:Araport11) |
| AT3G10020 | plant/protein;(source:Araport11) |
| AT3G27220 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G10040 | transmembrane protein;(source:Araport11) |
| AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
| AT1G68100 | member of IAA-alanine resistance protein 1 |
| AT1G24180 | Arabidopsis thaliana pyruvate dehydrogenase E1a-like subunit. 81% identical to a previously characterized Arabidopsis mitochondrial PDH E1a-subunit, At1g59900. Serine 296 phosphorylation of IAR4 has critical function in root hair formation and root development. Changing Ser296 in IAR4 to Ala resulted in a phenotype intermediate between mutant and wild-type, while substitution to Asp was either lethal or caused an extreme dwarf phenotype. |
| AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
| AT3G18485 | Encodes a novel protein with no predicted membrane-spanning domains that is polymorphic among Arabidopsis accessions. The protein may modulate a metal transporter. Mutants are resistant to IAA-Leu, IAA-Phe, and the divalent metals cobalt and manganese but remain sensitive to free IAA; they are defective in lateral root formation and primary root elongation. |
| AT5G54680 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G54140 | encodes a protein similar to IAA amino acid conjugate hydrolase |
| AT4G37550 | Indole-3-acetamide (IAM) hydrolase gene required for the auxin effects of IAM. |
| AT2G31580 | ICA1 is a nuclear localized member of the tRNA(His) guanylyl transferase superfamily. Loss of function alleles show increased sensitivity to growth at high temperatures defects in cell cycle progression and DNA repair. |
| AT2G34900 | Encodes a member of the BET subgroup of bromodomain proteins, a novel class of putative transcription factors. Its expression is induced during seed imbibition and downregulated during germination. Seeds of a loss-of-function mutant allele, imb1, show impaired cotyledon greening during germination in abscisic acid (ABA) and express higher levels of ABI5 protein than the wild type. Moreover, imb1 seeds are deficient in the phytochrome A (phyA)-mediated very-low-fluence response of germination. |
| AT3G22425 | Encodes imidazoleglycerolphosphate dehydratase. |
| AT4G09950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G33880 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT1G33890 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT1G33930 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT3G23900 | Physically interacts with, and promotes canonical splicing of, transcripts encoding defense signaling proteins, including the key negative regulator of pattern recognition receptor signaling complexes, CALCIUM-DEPENDENT PROTEIN KINASE 28 (CPK28). Upon immune activation by Plant Elicitor Peptides (Peps), IRR is dephosphorylated, disrupting interaction with CPK28 transcripts and resulting in accumulation of an alternative splice variant encoding a truncated CPK28 protein with impaired kinase activity and diminished function as a negative regulator. |
| AT1G18670 | Encodes a cyclin-dependent kinase-like protein with a ser/thr protein kinase domain and an N-terminal myristoylation sequence. Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
| AT1G51800 | The gene encodes a putative member of the LRR-RLK protein family. Expressin and mutant analysis revealed that it contributes to the interaction between Arabidopsis and Hyaloperonospora arabidopsidis. and The mRNA is cell-to-cell mobile. |
| AT4G16143 | Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT5G49310 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT4G27640 | Nuclear import receptor for GRF-interacting factors (GIFs),roles in ovule development. |
| AT5G66730 | C2H2-like zinc finger protein;(source:Araport11) |
| AT4G02670 | indeterminate(ID)-domain 12;(source:Araport11) |
| AT1G21120 | O-methyltransferase family protein;(source:Araport11) |
| AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
| AT3G23050 | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover. |
| AT4G14550 | IAA14 is a member of the Aux/IAA protein family. Involved in lateral root development. Gain of function mutation decreases auxin-inducible gene expression. Protein is localized to the nucleus. Expressed in stele and root tip epidermis. Functions as a negative regulator of ARF7/19. |
| AT3G15540 | Primary auxin-responsive gene. Involved in the regulation stamen filaments development. |
| AT3G23030 | auxin inducible gene expressed in the nucleus |
| AT5G25890 | encodes a protein that may be a negative regulator of lateral root formation in response to auxin. It is a member of IAA/ARF gene family and is plant-specific. Gain of function mutations in this gene suppresses lateral root formation and is resistant to inhibition of root elongation by auxin, cytokinin, and ethylene. |
| AT5G65670 | auxin (indole-3-acetic acid) induced gene The mRNA is cell-to-cell mobile. |
| AT1G04100 | Auxin induced gene, IAA10 (IAA10). |
| AT2G22670 | Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. The mRNA is cell-to-cell mobile. |
| AT3G25655 | Similar to Inflorescence Deficient in Abscission (IDA). Involved in floral organ abscission. |
| AT2G31305 | Encodes inhibitor-3 (Inh3), a regulatory subunit of protein phosphatase 1 (PP1). Inh3 inhibits the phosphatase activity of the PP1 catalytic subunit (PP1c). Biochemical analyses demonstrate that Inh3 binds to PP1c via the RVxF motif of Inh3, a consensus PP1c-binding sequence both in vitro and in vivo. |
| AT5G48820 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type and CDC2A cyclins and may inhibit cell cycle. Seven KRP genes were found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
| AT2G46470 | inner membrane protein OXA1-like protein;(source:Araport11) |
| AT5G67610 | Encodes an orthlog of the Xenopus inner nuclear membrane (INM) protein Nemp1/TMEM194A. |
| AT4G33770 | Inositol pyrophosphate kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
| AT4G16480 | Encodes a high affinity H+:myo-inositol symporter. The only other compound shown to be transported was pinitol, a methylated derivative of myo-inositol. The mRNA is cell-to-cell mobile. |
| AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
| AT5G42810 | Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. Is also required for growth and modulates phosphate homeostasis at the transcriptional level. |
| AT2G43900 | Encodes a 5-inositol-phosphate phosphatase, that, in vitro, shows activity against IP(1,4,5). |
| AT2G43850 | Integrin-linked protein kinase family;(source:Araport11) |
| AT5G46950 | One of of a pair of paralogous invertase with very high similarity.Expressed in female gametophyte and endosperm, particularly mycropylar endosperm. May function during embryogenesis to provide sugars to the developing embryo. |
| AT1G48280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G23060 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G62070 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G07240 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G16490 | Member of IQ67 (CaM binding) domain containing family. |
| AT2G26180 | Transient Expression of Pro35S:YFP-IQD5 in leaves of N. benthamiana alters microtubule organization.Member of IQ67 (CaM binding) domain containing family. |
| AT5G26820 | Mutations in MAR1 confer resistance, while MAR1 overexpression causes hypersensitivity to multiple aminoglycoside antibiotics. Localizes to the chloroplast envelope. MAR1 may act as a plastid transporter involved in cellular iron homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G19690 | The gene encodes Fe2+ transporter protein. It is a member of the Zrt/Irt-like protein (ZIP) family of transporters. AtIRT1 has broad specificity for divalent heavy metals, mediating the transport of zinc, manganese, cobalt and cadmium under Fe-deficient conditions. IRT1 is monoubiquitinated to promote endocytic trafficking. The mRNA is cell-to-cell mobile. |
| AT4G18780 | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. |
| AT2G38080 | LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype. |
| AT5G67210 | Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall. |
| AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
| AT4G35260 | Encodes a regulatory subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. |
| AT3G02780 | Encodes a protein with isopentenyl diphosphate:dimethylallyl diphosphate isomerase activity. There is genetic evidence that it functions in the mevalonate, but not the MEP biosynthetic pathway. |
| AT1G68460 | Encodes a putative adenylate isopentenyltransferase. It catalyzes the formation of isopentenyladenosine 5'-monophosphate (iPMP) from AMP and dimethylallylpyrophosphate (DMAPP), but it has a lower Km for ADP and likely works using ADP or ATP in plants. It is involved in cytokinin biosynthesis. |
| AT5G19040 | Encodes cytokinin synthase. |
| AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
| AT4G13430 | Encodes a methylthioalkylmalate isomerase involved in glucosinolate biosynthesis. |
| AT2G43090 | One of three genes encoding the small subunit of isopropylmalate isomerase, a heterodimer consisting of a large and a small subunit. A function in both leucine biosynthesis and the first cycle of Met chain elongation has been demonstrated for this subunit. The mRNA is cell-to-cell mobile. |
| AT1G51900 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT2G19710 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT4G32350 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
| AT3G16430 | Encodes a protein that increases the beta-glucosidase activities of three scopolin glucosidases in vitro. |
| AT3G16460 | Mannose-binding protein |
| AT1G58160 | At1g58160 in Col-0 has been shown to be a pseudogene due to a stop codon in the first exon (PMID:22307853). Its functional copy in other ecotypes (Bay-0) encodes JAX1, a jacalin-type lectin gene that confers resistance against potexviruses. |
| AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
| AT3G11180 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT3G55970 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT1G19180 | JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile. |
| AT5G13220 | Plants overexpressing At5g13220.3, but not At5g13220.1 showed enhanced insensitivity to MeJa. |
| AT1G72450 | JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. |
| AT2G29640 | JOSEPHIN-like protein;(source:Araport11) |
| AT5G46910 | H3K27me3 demethylase involved in temperature and photoperiod dependent repressing of flowering. |
| AT1G63490 | Histone demethylase belonging to the KDM5/JARID1 family which plays crucial roles in response to dehydration stress and abscisic acid (ABA). Directly binds the chromatin of OPEN STOMATA 1 (OST1) and demethylated H3K4me3 for the regulation of OST1 mRNA abundance, thereby modulating the dehydration stress response. |
| AT5G63080 | Encodes a HR demethylase that acts as a positive regulator of seed germination in the PHYB-PIL5-SOM pathway. |
| AT5G11800 | member of Putative potassium proton antiporter family |
| AT2G26650 | Encodes AKT1, a member of the Shaker family inward rectifying potassium channel predominantly expressed in predominantly in root hairs and root endodermis. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT4G33530 | potassium transporter |
| AT1G70300 | potassium transporter |
| AT5G09400 | Encodes a potassium uptake permease with a functional adenylate cyclase (AC) center. The first 100 aa of this protein can complement AC-deficient E. coli and display AC activity in vitro. KUP7 is localized to the plasma membrane where it functions in potassium uptake and translocation. |
| AT4G19960 | Encodes a potassium ion transmembrane transporter. Also mediates cesium uptake when expressed in E. coli. The mRNA is cell-to-cell mobile. |
| AT5G16560 | Encodes a KANADI protein (KAN) that regulates organ polarity in Arabidopsis. KAN is required for abaxial identity in both leaves and carpels, and encodes a nuclear-localized protein in the GARP family of putative transcription factors. Together with KAN2, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN2 and KAN4, KAN1 appears to be required for proper regulation of PIN1 in early embryogenesis. |
| AT4G17695 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT5G23430 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT3G61980 | Encodes a Kazal-type serine proteinase inhibitor that is highly expressed in seedlings and flowers. |
| AT3G52890 | KCBP-interacting protein kinase interacts specifically with the tail region of KCBP |
| AT5G03770 | Encodes a putative KDO (3-deoxy-D-manno-octulosonate) transferase |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT1G05360 | KMS2 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
| AT2G17220 | Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated. |
| AT4G21270 | Encodes a kinesin-like motor protein heavy chain. Loss of function mutations have reduced fertility and are defective in spindle formation in male meiosis. |
| AT5G54670 | Encodes a truncated KatC polypeptide (KatC(207-754)), which includes the carboxyl-terminal region of KatC. This was expressed in Escherichia coli and was shown to possess microtubule-stimulated ATPase activity. |
| AT1G21730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G10470 | Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA2. Demarcates the division site in plant cells. |
| AT3G44730 | kinesin-like protein 1;(source:Araport11) |
| AT5G02520 | Arabidopsis KNL2 localizes at chromocenters during all stages of the mitotic cell cycle, except from metaphase to mid-anaphase, and its level is strictly regulated by the proteasome degradation pathway. Knockout of KNL2 via a T-DNA insertion resulted in a reduced amount of centromeric cenH3, mitotic and meiotic abnormalities, and reduced growth and fertility. |
| AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT3G59940 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB50, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
| AT4G08150 | A member of class I knotted1-like homeobox gene family (together with KNAT2). Similar to the knotted1 (kn1) homeobox gene of maize. Normally expressed in the peripheral and rib zone of shoot apical meristem but not in the leaf primordia. It is also expressed in the fourth floral whorl, in the region that would become style, particularly in the cell surrounding the transmitting tissue. No expression was detected in the first three floral whorls. Expression is repressed by auxin and AS1 which results in the promotion of leaf fate. |
| AT1G70510 | A member of class I knotted1-like homeobox gene family (together with KNAT1). Similar to the knotted1 (kn1) homeobox gene of maize. KNAT2 acts synergistically with cytokinins and antagonistically with ethylene based on ectopic expression studies in different mutant backgrounds and hormone treatments. In addition, KNAT2 is negatively regulated by AS and YABBY genes. KNAT2 is strongly expressed in the shoot apex of seedlings, while in mature plants the gene is primarily expressed in flowers and inflorescence stems. |
| AT4G32040 | A member of Class II KN1-like homeodomain transcription factors factors (together with KNAT3 and KNAT4), with greatest homology to the maize knox1 homeobox protein. Regulates photomorphogenic responses and represses late steps in gibberellin biosynthesis. KNAT5 promoter activity showed cell-type specific pattern along longitudinal root axis, primarily in the epidermis of the distal end of primary root elongation zone. |
| AT5G63720 | Encodes KOKOPELLI (KPL). kokopelli (kpl) mutants display frequent single-fertilization events indicating that KPL is involved in double fertilization. KPL and an inversely transcribed gene, ARIADNE14 (ARI14), which encodes a putative ubiquitin E3 ligase, generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
| AT1G77860 | Mutant has Altered morphology of pollen exine wall; Seven-Path Transmembrane Protein |
| AT1G74910 | KONJAC1 is imilar to sugar pyrophosphorylases but has an insertion of 2 AA in the pyrophosphorylase consensus motif that is highly conserved in GMPPs. It lacks GDP-mannose pyrophosphorylase activity but can simulate the GDP-mannose pyrophosphorylase activity of VTC1. |
| AT2G46750 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT5G11540 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT1G01220 | Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis. |
| AT3G45330 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60310 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60320 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G45390 | LOW protein: L-type lectin-domain receptor kinase-like protein;(source:Araport11) |
| AT3G45410 | encodes a receptor-like kinase that has serine/threonine kinase activity whose expression is induced by high salt stress. This induction is inhibited by tobacco ethylene receptor. |
| AT3G45420 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G45440 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60280 | Plasma membrane localized receptor kinase. Binds NAD+ and induces expression of disease resistance genes. |
| AT5G59260 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G59270 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G29220 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G29250 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G53810 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT4G02410 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT4G02420 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G10530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT1G15530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G32800 | protein kinase family protein;(source:Araport11) |
| AT5G06740 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G43690 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G59700 | Member of Receptor kinase-like protein family. Represses stomatal immunity induced by Pseudomonas syringae pv. tomato DC3000. |
| AT3G08870 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT4G04960 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G03140 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G01540 | Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity. |
| AT5G21160 | Encodes a protein with sequence similarity to mRNA binding proteins from humans. LARP1a is involved in mRNA degradation in response to heat stress. Upon heat stress LARP1a interacts with XRN4 and appears to be responsible for addressing XRN4 to the polysome. LARP1/XRN4 double mutants are impaired in thermotolerance and lower levels of heat induced RNA turnover. |
| AT4G35890 | Encodes a cytoplasmic LAM domain containing protein that is involved in leaf senescence. The mRNA is cell-to-cell mobile. |
| AT5G01190 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G05390 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G09360 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G58910 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G60020 | LAC17 appears to have laccase activity based on enzyme assays performed using lac17 mutants. Notably, these mutants appear to have a reduced deposition of G lignin units. LAC17 is expressed in interfascicular fibers and likely contributes to lignin biosynthesis, and hence, cell wall biosynthesis, there. |
| AT2G30210 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT2G40370 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). Together with DP1/DIR12 involved in neolignan biosynthesis via sinapoylcholine/feruloylcholine. |
| AT3G09220 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT3G25440 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
| AT3G45130 | lanosterol synthase 1;(source:Araport11) |
| AT1G18850 | PCP2 encodes a novel plant specific protein that is co-expressed with components of pre-rRNA processing complex. Co-localizes with NuGWD1 and SWA1. |
| AT3G51810 | Encodes a ABA-inducible protein that accumulates during seed maturation, in parallel with its corresponding mRNA but with a 3 d delay. During germination, AtEm1 protein undergoes two successive cleavages before being degraded. Both proteins are more stable than the corresponding mRNA. The gene can be activated by the basic leucine zipper transcription factor ABI5. Expressed predominantly in provascular tissues with the strongest expression in the root tip. |
| AT1G01470 | Encodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against desiccation. |
| AT5G63090 | Involved in lateral organ development |
| AT2G42430 | LOB-domain protein gene LBD16. This gene contains one auxin-responsive element (AuxRE). Regluates lateral root formation. |
| AT1G55580 | Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching. |
| AT1G77220 | LAZ1H1 is a DUF300 that is localized to the tonoplast. Along with LAZ1 it appears to play a role in maintaining the structural integrity of vacuoles and regulating BR signaling by modulating downstream subcellular distribution of BAK1. |
| AT4G38360 | LAZ1 is a DUF300 domain protein that appears to function in vacuolar transport effecting brassinosteroid and programmed cell dealth signaling pathways. |
| AT5G44870 | Encodes LAZ5, a TIR-class NB-LRR R protein of unknown pathogen specificity with sequence similarity to RPS4, an R protein conferring resistance to Pseudomonas syringae expressing the effector AvrRPS4. Overexpression of LAZ5 results in hypersensitive cell death (plants did not survive to set seeds). |
| AT5G38210 | Protein kinase family protein;(source:Araport11) |
| AT1G25390 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G11755 | Encodes a cis-prenyltransferase, involved in dolichol biosynthesis. Wilted leaves in mutants due to cell membrane lesions. Mutants have increased drought tolerance, but hypersensitve to dark stress. |
| AT5G51410 | LUC7 N terminus domain-containing protein;(source:Araport11) |
| AT4G18670 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT1G07650 | Leucine-rich repeat receptor-like kinase with extracellular malectin-like domain, which possesses cell death induction activity in plant leaves. |
| AT1G12040 | encodes a a chimeric leucine-rich repeat/extensin protein that regulates root hair morphogenesis and elongation. Null mutants develop root hairs that frequently abort, swell, or branch. Gene is expressed in root hair cells and protein is specifically localized in the wall of the hair proper. The mRNA is cell-to-cell mobile. |
| AT4G22880 | encodes leucoanthocyanidin dioxygenase, which is involved in proanthocyanin biosynthesis. Mutant analysis suggests that this gene is also involved in vacuole formation. |
| AT4G32551 | LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors. |
| AT2G32700 | Encodes a WD40 repeat and LUFS domain containing protein that is similar to LUG. Interacts physically with SEUSS and likely functions as part of a repressor complex that represses AG. Involved in cell wall modifications necessary for mucilage extrusion and mediates aluminium sensitivity through PECTIN METHYLESTERASE46-modulated root cell wall pectin methylesterification. |
| AT4G00830 | Encodes a heterogeneous nuclear ribonucleoprotein (hnRNP-Q) that is involved in the plant innate immune response and may function as a suppressor of cell-autonomous immunity. |
| AT3G04290 | Li-tolerant lipase 1;(source:Araport11) |
| AT1G03070 | Bax inhibitor-1 family protein;(source:Araport11) |
| AT2G40100 | Lhcb4:3 protein (Lhcb4.3, light harvesting complex of photosystem II The mRNA is cell-to-cell mobile. |
| AT5G64813 | The LIP1 gene encodes a small GTPase that influences the light input pathway of the plant circadian network. An MBP:LIP1 fusion protein has GTP hydrolyzing abilities in vitro. In plants, LIP1 seems to play a negative role in regulating circadian period that can be suppressed by light. LIP1 also seems to negatively affect light-pulse-dependent resetting of the clock, especially during the first portion of the subjective evening. LIP1 expression levels are not significantly affected by the circadian clock in seedlings grown under LL conditions. The levels of the YFP:LIP1 protein expressed under the control of the 35S promoter, shows a low amplitude variation, with protein levels peaking near the beginning of subjective night under LL conditions. In hypocotyl epidermal cells of dark and light-grown seedlings, a YFP:LIP1 fusion protein can be seen in the cytoplasm and the nucleus, and does not cluster in nuclear speckles. LIP1 may also be involved in photomorphogenesis. The mRNA is cell-to-cell mobile. |
| AT3G23290 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT1G07090 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT3G47470 | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
| AT3G01510 | Encodes a putative phosphatase, LSF1, required for normal starch turnover in leaves. |
| AT2G15230 | Lipase active on medium and short chain triacylglycerols, but not on phospho- or galactolipids. Active between pH4 and 7 with an optimum at pH6. Knock-out mutant has not obvious phenotype. Predicted to be extracellular. |
| AT3G50920 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon1) and LPPepsilon2, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
| AT5G66450 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon2) and LPPepsilon1, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
| AT2G15050 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT3G51590 | Encodes a member of the lipid transfer protein family. Proteins of this family are generally small (~9 kD), basic, expressed abundantly and contain eight Cys residues. The proteins can bind fatty acids and acylCoA esters and can transfer several different phospholipids. They are localized to the cell wall. The LTP12 promoter is active exclusively in the tapetum during the uninucleate microspore and bicellular pollen stages. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT3G51600 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT1G55020 | lipoxygenase, a defense gene conferring resistance Xanthomonas campestris The mRNA is cell-to-cell mobile. |
| AT3G45140 | Chloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis.Mutants are resistant to Staphylococcus aureus and accumulate salicylic acid upon infection. The mRNA is cell-to-cell mobile. |
| AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
| AT1G72520 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT1G67230 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT5G65770 | Encodes a protein that localizes to the nuclear periphery and affects nuclear morphology. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT1G07900 | LOB domain-containing protein 1;(source:Araport11) |
| AT2G30340 | Lateral Organ Boundaries domain protein. LOB13 promotes lateral root formation. |
| AT2G40470 | LOB-domain containing protein. Involved in regulation of xylem differentiation- acts as a regulator of VND7 which is a master regulator of xylem cell differentiation. |
| AT2G45420 | LOB domain-containing protein 18;(source:Araport11) |
| AT2G45410 | LOB domain-containing protein 19;(source:Araport11) |
| AT3G11090 | LOB domain-containing protein 21;(source:Araport11) |
| AT3G26660 | LOB domain-containing protein 24;(source:Araport11) |
| AT3G27650 | LOB domain-containing protein 25;(source:Araport11) |
| AT3G27940 | LOB domain-containing protein 26;(source:Araport11) |
| AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
| AT2G19820 | LOB domain-containing protein 9;(source:Araport11) |
| AT1G10920 | Encodes LOV1, a disease susceptibility gene that, paradoxically, is a member of the NBS-LRR resistance gene family. Conditions susceptibility to the fungus Cochliobolus victoriae and victorin-dependent induction of defense-associated proteins. Saturation mutagenesis identified 59 lov mutations that all display reduced susceptibility to vitorin. Mutations in known defense response pathways do not prevent susceptibility to C. victoriae. |
| AT5G19080 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
| AT5G47040 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
| AT2G28305 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT2G37210 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At5g11950. |
| AT3G53450 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT5G03270 | lysine decarboxylase family protein;(source:Araport11) |
| AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
| AT1G64625 | Encodes a plant-specific basic helix-loop-helix (bHLH) protein that is required for normal meiotic entry and the establishment of meiotic synchrony. It plays a role in xylem differentiation downstream of auxin. |
| AT3G55850 | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids. |
| AT1G77590 | Encodes major plastidic long chain acyl-CoA synthetase with a slight substrate preference of oleic acid over any of the other fatty acids. |
| AT2G47240 | Encodes an acyl-CoA synthetase that acts on long-chain and very-long-chain fatty acids, involved in cuticular wax and cutin biosynthesis The mRNA is cell-to-cell mobile. |
| AT4G23850 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT2G46090 | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
| AT5G15580 | Encodes LONGIFOLIA1 (LNG1). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG1 homologue LNG2 (At3g02170) has similar function. |
| AT3G09770 | Encodes a ubiquitin E3 ligase LOG2 (LOSS OF GDU2). Required for GLUTAMINE DUMPER1(GDU1)-induced amino secretion. |
| AT1G56070 | encodes a translation elongation factor 2-like protein that is involved in cold-induced translation. Mutations in this gene specifically blocks low temperature-induced transcription of cold-responsive genes but induces the expression of CBF genes and mutants carrying the recessive mutations fail to acclimate to cold and is freezing sensitive. |
| AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G02910 | Mutants defective in this gene were shown to have a reduced PSII content (overall reduction in the levels of several PSII subunits) and a disrupted grana stack structure. The N-terminal half of the protein contains two tetratricopeptide repeat (TPR) motifs that are arranged tandemly, each consisting of a 34-residue degenerate consensus sequence. The N-terminal sequence is rich in positive and hydroxylated amino acid residues. |
| AT1G75690 | Thylakoid Thiol/Disulfide-Modulating Protein. |
| AT5G48905 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G49435 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G11760 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G10535 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G28335 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G09153 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G19905 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G23167 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G14935 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G07005 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G28355 | low-molecular-weight cysteine-rich 5;(source:Araport11) |
| AT5G47077 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G30067 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G02135 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G31953 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G54225 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G14365 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
| AT5G52310 | cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile. |
| AT4G21610 | Contains the same novel zinc finger motif with LSD1, a negative regulator of cell death and defense response. Due to differential splicing, it encodes two different proteins, one of which contains an additional, putative DNA binding motif. Northern analysis demonstrated that LOL2 transcripts containing the additional DNA binding motif are predominantly upregulated after treatment with both virulent and avirulent Pseudomonas syringae pv maculicola strains. |
| AT5G57030 | Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase |
| AT4G35180 | LYS/HIS transporter 7;(source:Araport11) |
| AT5G40780 | Encodes LHT1 (lysine histidine transporter), a high-affinity transporter for cellular amino acid uptake in both root epidermis and leaf mesophyll. |
| AT2G17120 | Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. It contains a C-terminal GPI anchor signal and is an ortholog of OsCEBiP. |
| AT3G01840 | Encodes a putative LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it was determined to be a pseudo kinase since lack of the ATP-binding P-loop in the kinase domain. |
| AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT2G33580 | Encodes a putative LysM-containing receptor-like kinase. LYK5 is a major chitin receptor and forms a chitin-induced complex with related kinase CERK1. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT2G45670 | Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 20:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds. |
| AT5G50850 | Transketolase family protein;(source:Araport11) |
| AT5G65080 | Is upregulated during vernalization and regulates flowering time. Encodes MADS-domain protein. Two variants encoding proteins of 198 and 184 amino acids have been reported. |
| AT4G15570 | Similar to yeast Sen1 (splicing endonuclease 1)helicase protein. Involved in female gametophyte development. The mRNA is cell-to-cell mobile. |
| AT4G28580 | Transmembrane magnesium transporter that induces Mg transport from tapetum cell to locule. One of nine family members. Functions in pollen development. |
| AT3G19640 | Transmembrane magnesium transporter. One of nine family members. |
| AT3G47810 | Homolog of yeast retromer subunit VPS29. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. |
| AT3G47700 | Involved in transportation of seed storage proteins from the ER to the vacuole. Mutant seed cell accumulates the precursors of 12S globulin and 2S albumin instead of the vacuolar-located mature proteins. Member of MAG2 complex, involved in the development of vegetative organs. |
| AT2G04865 | Encodes a nuclear localized aminotransferase-like protein containing a plant mobile domain. The mRNA is cell-to-cell mobile. |
| AT1G17930 | Mobile domain protein involved in silencing of transposable elements. Loss of function affects shoot and root meristem maintenance. Interacts and functions with MAIL1 and PP7L in gene silencing. |
| AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G45840 | Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1. |
| AT1G66170 | Encodes a PHD-domain containing protein required for male meiosis. Gene is expressed in developing male meiocytes and protein is localized to nuclear euchromatin specifically during diplotene. Required to regulate microtubule organization and cell cycle transitions during male meiosis, and functions as a direct transcription activator of the meiotic gene TDM1. |
| AT1G19890 | histone 3.3, male-gamete-specific expression. Direct target promoter of the male germline-specific transcription factor DUO1. |
| AT4G20900 | Encodes a tetratricopeptide repeat protein required for cell cycle exit after meiosis II.ms5 mutants are male sterile, pollen tetrads undergo an extra round of division after meiosis II without chromosome replication, resulting in chromosome abnormalities. Gene product has some similarity to SCP1, a rat synaptonemal complex protein. |
| AT4G27940 | manganese tracking factor for mitochondrial SOD2;(source:Araport11) |
| AT1G51630 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants. |
| AT5G43710 | Glycosyl hydrolase family 47 protein;(source:Araport11) |
| AT1G01560 | Member of MAP Kinase family. Flg22-induced activation is blocked by AvrRpt2. |
| AT2G01450 | MPK17 Map kinase family member. Mutants have increased numbers of peroxisomes a phenotype that can be suppressed by mutations in PMD1. This and other treatments, suggests a function in control of peroxisome proliferation in salt stress. |
| AT4G01370 | Encodes a nuclear and cytoplasmically localized MAP kinase involved in mediating responses to pathogens. Its substrates include MKS1 and probably MAP65-1.The MAP65-1 interaction is involved in mediating cortical microtuble organization. Required for male-specific meiotic cytokinesis. The mRNA is cell-to-cell mobile. |
| AT2G43790 | Encodes a MAP kinase induced by pathogens, ethylene biosynthesis, oxidative stress and osmotic stress.Also involved in ovule development. Homozygous mutants in a MPK3 heterozygous background are female sterile due to defects in integument development.MPK6 appears to be associated with the microsomal compartment and may be involved in mediating secretory processes. The mRNA is cell-to-cell mobile. |
| AT4G29810 | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT5G56580 | Encodes a member of the MAP Kinase Kinase family of proteins. It can phosphorylate MPK12 in vitro and it can be dephosphorylated by MKP2 in vitro. |
| AT1G18350 | MAP kinase kinase7. Member of plant mitogen-activated protein kinase kinase group D. Negative regulator of polar auxin transport. Overexpression leads to activation of basal and systemic acquired resistance. |
| AT3G18690 | Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators. |
| AT4G26070 | Member of MAP Kinase Kinase. Likely functions in a stress-activated MAPK pathway. Can phosphorylate the MAPK AtMPK4, in response to stress. Gets phosphorylated by MEKK1 in response to wounding. |
| AT1G15400 | Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
| AT4G08470 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. |
| AT5G11850 | MAP3 kinase involved phosphorylation of a critical Ser171 for OST1/SnRK2.6 activation. |
| AT2G15890 | Encodes CBP1, a regulator of transcription initiation in central cell-mediated pollen tube guidance. |
| AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G46330 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G13610 | DNA (cytosine-5-)-methyltransferase family protein;(source:Araport11) |
| AT5G45800 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G70170 | Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence. |
| AT4G08850 | MIK1 encodes a receptor kinase that forms a complex with MDIS1/MIK2 and binds LURE1, the female pollen guidance chemi-attractant. MIK1 phosphorylates MDIS1 and is autophosphorylated. |
| AT5G19520 | mechanosensitive channel of small conductance-like 9;(source:Araport11) |
| AT1G23230 | Mediator tail subunit, involved in transcriptional regulation. Mediator Complex Subunit, interacts with MED2, MED5, MED16 in the Regulation of Phenylpropanoid Biosynthesis. |
| AT3G52860 | Encodes a mediator subunit,, important for development and senescence. |
| AT5G38990 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39020 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39030 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G07290 | AML4 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML4 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM14. AML4 is expressed during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
| AT5G61960 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices. |
| AT1G29400 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
| AT5G15460 | membrane-anchored ubiquitin-fold protein 2;(source:Araport11) |
| AT5G26230 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G52870 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G54110 | Encodes a highly polar protein with more than 60% hydrophilic amino acid residues that is associated with the plasma membrane. It has limited secondary structure similarity to VAP-33 from Aplysia, which may be involved in membrane trafficking. The mRNA is cell-to-cell mobile. |
| AT4G21750 | Encodes a homeobox protein similar to GL2. It is expressed in both the apical and basal daughter cells of the zygote as well as their progeny. Expression is detected starting the two-celled stage of embryo development and is later restricted to the outermost, epidermal cell layer from its inception. Its promoter is highly modular with each region contributing to specific aspects of the gene's spatial and temporal expression. Double mutant analysis with PDF2, another L1-specific gene, suggests that their functions are partially redundant and the absence of both of the genes result in abnormal shoot development. |
| AT4G25110 | Encodes a type I metacaspase. Two Arabidopsis metacaspases, AT1G02170 (MC1) and AT4G25110 (MC2) antagonistically control programmed cell death in Arabidopsis. MC1 is a positive regulator of cell death and requires conserved caspase-like putative catalytic residues for its function. MC2 negatively regulates cell death. This function is independent of the putative catalytic residues. A third type I Arabidopsis metacaspase is MC3 (AT5g64240). |
| AT1G79320 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT3G12100 | Cation efflux family protein;(source:Araport11) |
| AT1G07600 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage. |
| AT2G36880 | methionine adenosyltransferase 3;(source:Araport11) |
| AT3G59990 | Encodes a MAP2 like methionine aminopeptidase |
| AT3G01120 | encodes a cystathionine gamma-synthase, which performs the first committed step in methionine biosynthesis. A conserved motif of 13 amino acids in the first exon is required for posttranscriptional autoregulation. This enzyme shares the same substrate as threonine synthase (TS) and its absence transcriptionally affects 8 genes in the genome. |
| AT2G18030 | Peptide methionine sulfoxide reductase family protein;(source:Araport11) |
| AT4G21830 | methionine sulfoxide reductase B7;(source:Araport11) |
| AT3G03780 | Encodes a cytosolic methionine synthase, involved in methionine regeneration via the activated methyl cycle (or SAM cycle) |
| AT5G17920 | Encodes a cytosolic cobalamin-independent methionine synthase, involved in methionine regeneration via the activated methyl cycle (SAM cycle). The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
| AT1G26360 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
| AT1G33990 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT1G69240 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
| AT2G23550 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
| AT3G02790 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT5G16470 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT3G59970 | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
| AT2G44160 | methylenetetrahydrofolate reductase MTHFR2 mRNA, complete The mRNA is cell-to-cell mobile. |
| AT1G11580 | methylesterase PCR A;(source:Araport11) |
| AT1G18500 | Encodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040). The mRNA is cell-to-cell mobile. |
| AT2G38700 | Encodes mevalonate diphosphate decarboxylase, the enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in sterol and isoprenoid biosynthesis. The protein appears to form a homodimeric complex. Incidentally, it was shown that the Arabidopsis MVD protein could also interact with its yeast homolog to form a heterodimer. |
| AT5G13130 | Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. Possible role in the development of reproductive tissues. |
| AT1G66783 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGACAGAAGAUAGAGAGCAC |
| AT3G18217 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGACAGAAGAUAGAGAGCAC. Pri-mRNA coordinates for MIR157c (converted to TAIR10 based on PMID19304749): Chr3: 6244826-6243830 (reverse), length: 997 bp; exon coordinates: exon 1: 6244826 to 6244347, exon 2: 6244115 to 6243830; mature miRNA and miRNA* are located on exon 1. |
| AT1G66725 | Encodes a microRNA that targets several SAMT family members. miR163, is highly expressed in A. thaliana diploids but down-regulated in A. thaliana autotetraploids and repressed in A. arenosa and A. suecica. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGAAGAGGACUUGGAACUUCGAU |
| AT5G01747 | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA |
| AT2G46685 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. This particular miRNA is involved in the regulation of vascular development in inflorescence stems, primarily through the regulation of mRNA cleavage of the class III homeodomain-leucine zipper transcription factor ATHB15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166a (converted to TAIR10 based on PMID19304749): Chr2: 19175959-19177071 (forward), length: 1113 bp; exon coordinates: exon 1: 19175959 to 19176341, exon 2: 19176820 to 19177071; mature miRNA and miRNA* are located on exon 1. |
| AT5G41905 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
| AT5G45307 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
| AT1G53687 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAGCCAAGGAUGACUUGCCG |
| AT3G26813 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAGCCAAGGAUGACUUGCCUG |
| AT3G11435 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAG |
| AT1G69797 | Encodes a microRNA that targets both APS and AST family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CUGAAGUGUUUGGGGGGACUC. Predicted targets are ATP sulfurylases. |
| AT4G05105 | Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG |
| AT1G29265 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAUUUGCCCUG |
| AT2G32698 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TTTAAATCATATACTTTTGGT |
| AT4G03455 | Encodes a microRNA that targets several 2-phosphoglycerate kinase-related family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGGGACGAGAUGUUUUGUUG |
| AT2G41616 | Encodes a microRNA that targets several SET domain-containing genes including SUVH6. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGCUUGGUUUAUGUACACCG |
| AT2G22496 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUCUGCUAUGUUGCUGCUCAU |
| AT4G14811 | Encodes a microRNA that targets CHX18. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCUUCGUGAAUAUCUGGCA |
| AT3G59884 | Encodes a microRNA that targets several SPX C3HC4 RING zinc finger family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUAGAUGACCAUCAACAAACU |
| AT1G32713 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CAAAUUAAAGCUUCAAGGUAG |
| AT1G61224 | Encodes a microRNA that targets several Jacalin lectin family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCAUGGUCAGAUCCGUCAUCC |
| AT4G23387 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CGGCUCUGAUACCAAUUGAUG |
| AT5G26038 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCAAUAGAUUGGACUAUGUAU |
| AT4G13494 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGAGCAACAAGACAUAAU |
| AT5G39693 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUGGUGUUGAGAUAGUUGAC |
| AT4G26760 | microtubule-associated protein 65-2;(source:Araport11) |
| AT1G24764 | Member of the MAP70 protein family. |
| AT4G17220 | Encodes a microtubule associated protein (MAP70-5). Regulates secondary wall patterning in wood cells. Expressed in all tissues. |
| AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G26700 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO14 belongs to the clade I, with AtMLO4 and AtMLO11. The gene is expressed during early seedling growth, in developing primary root, and particularly in root tips of 10-day old seedlings; it was not expressed in leaves or flowers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G44110 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO15 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root tips and flower (papillae, anthers and pollen grains), as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT3G45290 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO3 belongs to the clade IV, with AtMLO2, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in primary root and lateral root primordia, in fruit abscission zone, in vascular system of cotyledons and in trichomes of young leaves,; it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G61560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of cotyledons, young leaves and petals, in mature rosette leaves, in anthers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G26800 | MPSR1 is cytoplasmic E3 ligase that senses misfolded proteins independently of chaperones and targets those proteins for degradation via the 26S proteasome. Involved in the regulation of the homeostasis of sensor NLR immune receptors. |
| AT3G14395 | Protein Involved in the Regulation of Herbivore-Associated Signaling Pathways, affecting the expression of genes involved in biosynthesis and signaling of the jasmonic acid and salicylic acid hormones. |
| AT1G65290 | Encodes a member of the mitochondrial acyl carrier protein (ACP) family that forms part of the membrane arm of mitochondrial complex and contributes to the mitochondrial respiratory chain. The mRNA is cell-to-cell mobile. The designations of mtACP-1 and mtACP-2 in Klusch et al. 2021 (DOI:10.1093/plcell/koab092)are flipped with respect to the nomenclature published by Meyer et al. 2007 (DOI:10.1007/s11103-007-9156-9). |
| AT4G04750 | Putative mitochondrial F1F0-ATPase. |
| AT1G66345 | Pentatricopeptide Repeat Protein involved in splicing of nad4 intron which affects biogenesis of the respiratory complex I. |
| AT1G07030 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT4G35490 | mitochondrial ribosomal protein L11;(source:Araport11) |
| AT3G09040 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G74120 | Encodes a mitochondrial transcription termination factor mTERF15. Required for mitochondrial nad2 intron 3 splicing and functional complex I activity. |
| AT4G25200 | AtHSP23.6-mito mRNA, nuclear gene encoding mitochondrial |
| AT3G45640 | Encodes a mitogen-activated kinase whose mRNA levels increase in response to touch, cold, salinity stress and chitin oligomers.Also functions in ovule development. Heterozygous MPK3 mutants in a homozygous MPK6 background are female sterile due to defects in integument development. MPK3 can be dephosphorylated by MKP2 in vitro. The mRNA is cell-to-cell mobile. |
| AT1G59580 | encodes a mitogen-activated kinase involved in innate immunity The mRNA is cell-to-cell mobile. |
| AT1G07150 | Member of MEKK subfamily. Involved in wound induced signaling where it interacts with At5g40440, and activates At1g59580. |
| AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
| AT5G55090 | member of MEKK subfamily |
| AT4G26890 | Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580. |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT1G05100 | member of MEKK subfamily. Negatively regulated by RGLG1 and RGLG2; involved in drought stress tolerance. |
| AT4G36950 | member of MEKK subfamily |
| AT1G53570 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
| AT5G66850 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
| AT4G08480 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. |
| AT1G01453 | HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals. |
| AT3G16270 | Involved in the plant trans-Golgi network (TGN), where it is part of an adaptor protein (AP) complex to promote vesicle generation with different cargo specificity and destination. Interacts with AP-4, whose function is required for MTV1 recruitment. |
| AT5G05680 | Encodes MOS7 (Modifier of snc1,7), homologous to human and Drosophila melanogaster nucleoporin Nup88. Resides at the nuclear envelope. Modulates the nuclear concentrations of certain defense proteins regulates defense outputs. |
| AT2G25680 | Encodes a high-affinity molybdate transporter. Mutant has reduced concentrations of molybdate in roots and shoots, and reduced shoot and root length when growing on Mo-limited medium. |
| AT2G28390 | SAND family protein;(source:Araport11) |
| AT4G31780 | Encodes an A-type monogalactosyldiacylglycerol (MGDG) synthase. It represents the isoform responsible for the bulk of MGDG synthesis in Arabidopsis. |
| AT4G15760 | Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA). |
| AT1G02740 | MRG1 and MRG2 proteins act as readers of H3K4me3/H3K36me3 marked chromatin. They interact with each other as well as several other protein classes, to modulate the activity of flowering genes. |
| AT1G21920 | MRF1 is related to SET7/9 proteins but contains an atypical SET domain. It is expressed in phloem and mutants have a weak late flowering phenotype. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G37113 | hypothetical protein;(source:Araport11) |
| AT2G33780 | VQ motif-containing protein;(source:Araport11) |
| AT4G14605 | Encodes a putative mitochondrial transcription termination factor whose mutation results in plants that exhibit altered chloroplast morphology and plant growth, and reduced pigmentation of cotyledons, leaves, stems and sepals. |
| AT1G53480 | Encodes MRD1 (mto 1 responding down). Down-regulated in mto1-1 mutant that over-accumulates soluble methionine. |
| AT1G53500 | encodes a putative NDP-L-rhamnose synthase, an enzyme required for the synthesis of the pectin rhamnogalacturonan I, the major component of Arabidopsis mucilage. Gene is involved in seed coat mucilage cell development. Mutant analyses suggest that MUM4 is required for complete mucilage synthesis, cytoplasmic rearrangement and seed coat development. |
| AT3G61300 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT1G04150 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
| AT4G11610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G44780 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT2G35240 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT3G51160 | Catalyzes the first step in the de novo synthesis of GDP-L-fucose. Loss of function mutations result in reduced levels of fucosylation and decreased freezing tolerance. |
| AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
| AT1G75640 | Encodes a Leucine-Rich Repeat Receptor-Like Kinase MUSTACHES (MUS). Regulates stomatal bilateral symmetry. Mutants have abnormally shaped guard cells, absent or skewed stomatal pores. |
| AT3G04605 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
| AT3G05850 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
| AT5G15400 | Single copy gene encoding a putative ubiquitin conjugating E4 factor. Contains Ub elongating factor core domain and C-terminal U-box. Involved in ubiquitination of NLRs. |
| AT3G24320 | Encodes a DNA binding protein that promotes re-arrangements of mitochondrial genome. Mutations affects mitochondrial gene expression, and impairs mitochondrial function. Dual targeting of the protein to mitochondria and chloroplasts caused by alternative translation initiation. Plastid MSH1 depletion results in variegation, abiotic stress tolerance, variable growth rate, and delayed maturity. |
| AT4G09140 | Encodes a protein with similarity to Mut1 DNA mismatch repair protein, from E.coli. The protein is expressed during prophase I of meiosis, colocalizes with MLH3 throughout pachytene and is dependent on MLH3 for proper localization. |
| AT3G09230 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT3G12820 | Member of the R2R3 factor gene family. |
| AT2G26950 | Member of the R2R3 factor gene family. |
| AT3G06490 | Encodes a MYB transcription factor involved in regulating anther dehiscence as well as regulating cell death, and cuticle-related Botrytis immunity. |
| AT3G62610 | Member of the R2R3 factor gene family. Together with MYB12 and MYB111 redundantly regulates flavonol biosynthesis. |
| AT1G25340 | putative transcription factor (MYB116) |
| AT2G47460 | MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots. Mutations in MYB12 block both auxin and ethylene stimulation of flavonoid synthesis. |
| AT3G30210 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB121). |
| AT1G74080 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB122). |
| AT3G23250 | Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity |
| AT5G15310 | Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation. |
| AT2G47190 | Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin. |
| AT3G27810 | Encodes a member of the R2R3-MYB transcription factor gene family. Induced by jasmonate. Involved in jasmonate response during stamen development. MYB21 interacts with JAZ proteins, and functions redundantly with MYB24 and MYB57 to regulate stamen development. Promotes flavonol biosynthesis through regulation of FLS1 gene expression. |
| AT5G40330 | Encodes a MYB gene that, when overexpressed ectopically, can induce ectopic trichome formation. It is a member of subgroup 15, together with WER and GL1. Members of this subgroup share a conserved motif of 19 amino acids in the putative transcription activation domain at the C-terminal end. The gene is expressed in leaves, stems, flowers, seeds and roots and quite strongly in trichomes. There is partial functional redundancy between ATMYB23 and GL1. The two proteins are functionally equivalent with respect to the regulation of trichome initiation but not with respect to trichome branching - which is controlled by MYB23 and not GL1. |
| AT5G07690 | Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses. |
| AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
| AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
| AT1G74650 | Member of the R2R3 factor gene family. |
| AT5G23000 | Putative homolog of the Blind gene in tomato. Together with RAX2 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB37, regulates axillary meristem formation. RAX1 is expressed in a small central domain within the boundary zone separating SAM and leaf primordia during early leaf primordium development and is currently the earliest spatial marker for future axillary meristems. Member of the R2R3 factor gene family. |
| AT4G17785 | Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes. |
| AT4G38620 | Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. The mRNA is cell-to-cell mobile. |
| AT4G28110 | Member of the R2R3 factor gene family. Expression is induced in response to desiccation, ABA and salt treatment. Overexpression of Myb41 results in abnormal cuticle development and decreased cell expansion. |
| AT3G48920 | Member of the R2R3 factor gene family. |
| AT5G12870 | Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea. |
| AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
| AT5G54230 | MYB49 transcription factor. Binds to and promotes expression of genes involved in cadmium accumulation. Interacts with ABI5 which acts as a repressor preventing MYB49 induced expression of target genes. |
| AT3G18100 | Member of the R2R3 transcription factor gene family. |
| AT1G18570 | Encodes a member of the R2R3-MYB transcription family. Involved in indole glucosinolate biosynthesis. The mRNA is cell-to-cell mobile. |
| AT3G01530 | Member of the R2R3 factor gene family.MYB57 interacts with JAZ proteins, and functions redundantly with MYB21 and MYB24 to regulate stamen development. Promote flavonol biosynthesis through regulation of FLS1 gene expression. |
| AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
| AT1G68320 | putative transcription factor: R2R3-MYB transcription family. Involved in regulation of phosphate starvation responses and gibberellic acid biosynthesis. |
| AT5G14750 | Encodes a MyB-related protein containing R2 and R3 repeats, involved in root and hypocotyl epidermal cell fate determination. Loss of function mutations make extra root hairs. Nuclear localized protein is a positive regulator for expression of CAPRICE (CPC). |
| AT5G65790 | Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development. |
| AT2G16720 | Encodes a member of MYB3R- and R2R3- type MYB- encoding gene family that acts as a repressor of flavonol biosynthesis. AtMYB7 gene expression is induced by salt treatment. |
| AT2G23290 | Member of the R2R3 factor gene family. |
| AT4G37260 | Member of the R2R3 factor gene family. The mRNA is cell-to-cell mobile. |
| AT5G07700 | Encodes a putative transcription factor (MYB76). |
| AT5G49620 | Member of the R2R3 factor gene family. |
| AT4G13480 | Member of the R2R3 factor gene family. |
| AT3G49690 | Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB84, regulates axillary meristem formation. |
| AT5G26660 | myb domain protein 86;(source:Araport11) |
| AT4G37780 | encoded by the Myb-like transcription factor MYB87, regulates axillary meristem formation, expressed throughout the plant. Member of the R2R3 factor gene family. |
| AT5G10280 | Encodes a putative transcription factor (MYB92). |
| AT1G34670 | Encodes a member of the R2R3 transcription factor gene family that is a negative regulator of lateral root (LR) development. It has been proposed that this transcription factor is part of a novel negative feedback loop stimulated specifically in the endodermis upon LR initiation to ensure that LRs are formed only in the correct place. |
| AT3G47600 | Encodes a putative transcription factor (MYB94). |
| AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
| AT4G18770 | MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects. |
| AT5G62320 | Encodes a putative transcription factor (MYB99). |
| AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
| AT4G21440 | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
| AT1G71030 | Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves. |
| AT5G18650 | Encodes a RING-type E3 ubiquitin ligase that interacts with and ubiquitinates MYB30, leads to MYB30 proteasomal degradation and downregulation of its transcriptional activity. Since MYB30 is a positive regulator of Arabidopsis HR and defence responses, MIEL1 is involved in the negative regulation of these processes. The mRNA is cell-to-cell mobile. |
| AT3G61950 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
| AT1G17580 | Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development. |
| AT5G43900 | Encodes a member of the type XI myosin protein family that binds F-actin and co-localizes with actin filaments and peroxisomes. Homozygous mutants are reported to have pleiotropic effects in growth and fertility and may also be lethal. This protein is also involved in root hair growth and organelle trafficking. This protein interacts with RabC2a and RabD1 in a GTP-dependent manner. |
| AT5G16720 | caldesmon-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G04540 | Myotubularin-like phosphatases II superfamily;(source:Araport11) |
| AT3G57560 | encodes a N-acetylglutamate kinase, involved in arginine biosynthesis |
| AT4G35160 | Encodes a cytosolic N-acetylserotonin O-methyltransferase that can convert N-acetylserotonin to melatonin and serotonin to 5-methoxytryptamine in the process of melatonin synthesis. It does not have caffeic acid O- methyltransferase activity. |
| AT5G11790 | Plays a role in dehydration stress response. |
| AT1G80410 | Encodes the catalytic subunit of a N-terminal acetyltransferase. |
| AT1G01010 | NAC domain containing protein 1;(source:Araport11) |
| AT1G56010 | Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. |
| AT5G66300 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
| AT1G33280 | NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root. |
| AT1G34180 | NAC domain containing protein 16;(source:Araport11) |
| AT1G34190 | Encodes a NAC domain transcription factor that regulates the mitochondrial retrograde response and coordinates organellar functions and stress responses. |
| AT1G54330 | NAC domain containing protein 20;(source:Araport11) |
| AT1G61110 | NAC transcription regulator. Regulates endosperm cell expansion during germination. |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
| AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
| AT3G01600 | NAC domain containing protein 44;(source:Araport11) |
| AT3G04060 | NAC046 is a member of the NAC domain containing family of transcription factors. It was identified in a screen for regulators of chlorophyll protein gene expression. Mutants in NAC046 have delayed senescence and increased CHL content suggesting a role in regulation of senescence and chlorophyll degradation. |
| AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
| AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
| AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
| AT3G44350 | NAC domain containing protein 61;(source:Araport11) |
| AT4G01520 | NAC domain containing protein 67;(source:Araport11) |
| AT4G10350 | NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root. |
| AT4G36160 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT5G22380 | NAC domain containing protein 90;(source:Araport11) |
| AT3G61910 | NAC transcription factor NST2. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls. NST2 promoter was particularly strong in anther tissue. |
| AT5G62380 | Encodes a NAC-domain transcription factor involved in xylem formation. Induces transdifferentiation of various cells into metaxylem vessel elements. Located in the nucleus. Expression induced in the presence of auxin, cytokinin and brassinosteroids. |
| AT3G12977 | NAC transcription regulator. Regulates endosperm cell expansion during germination. |
| AT5G07710 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G46830 | Calcium-binding transcription factor involved in salt stress signaling. |
| AT3G21070 | Encodes a protein with NAD(H) kinase activity. |
| AT2G47490 | Encodes a chloroplast-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro. |
| AT4G00570 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the beta family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the alpha-type NAD-ME2 (At2g13560). NAD-ME2 transcript and protein levels are higher during the night than during the day. |
| AT4G23890 | NAD(P)H-quinone oxidoreductase subunit S;(source:Araport11) |
| AT4G09350 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G21430 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G27890 | Encodes NAD(P)H:quinone reductase which is an FMN binding protein that catalyzes the reduction of quinone substrates to hydroquinones.The enzyme activity was confirmed by in vitro assay. |
| AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT1G74560 | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP2. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. Plant mutated in both NRP1 and NRP2 genes show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. NRP genes act synergistically with NAP1 genes in promoting somatic homologous recombination. |
| AT2G27080 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G06320 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane. |
| AT1G65690 | Encodes NHL6 (NDR1/HIN1-like 6). Plays an important role in the abiotic stresses-induced ABA signaling and biosynthesis, particularly during seed germination and early seedling development. |
| AT1G32340 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression is not detected under normal conditions and in response to cucumber mosaic virus or spermine. |
| AT1G28380 | This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. The mRNA is cell-to-cell mobile. |
| AT1G74360 | NILR1 encodes a serine/threonine kinase involved in defense response to nematodes. |
| AT1G03080 | kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT5G05970 | a WD40 repeat protein related to the animal NEDD1/GCP-WD protein, which interacts with the g-tubulin complex. Plays a critical role in MT organization during mitosis |
| AT1G07380 | Encodes a neutral ceramidase that is involved in sphingolipid homeostasis and responses to oxidative stress. |
| AT2G38010 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
| AT4G25910 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU1 and 2 than to NFU4 and 5. Targeted to the chloroplast. The mRNA is cell-to-cell mobile. |
| AT2G46870 | Member of the RAV family of DNA binding proteins. Contains B3 domain. Recognizes 5'-CACCTG-'3 motif. |
| AT3G61970 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT1G01030 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G04950 | Encodes a nicotianamide synthase. |
| AT5G56080 | Encodes a protein with nicotianamine synthase activity. Its transcript levels rise in roots in response to zinc deficiency and rise in leaves in response to elevated levels of zinc. |
| AT1G56430 | Encodes a protein with nicotianamine synthase activity. |
| AT3G13050 | Encodes a plant nicotinate transporter than can also transport trigonelline (N-methylnicotinate). |
| AT3G54500 | Member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK2 along with LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex. Functions as a transcriptional coactivator. |
| AT3G12320 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism. |
| AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
| AT3G25882 | encodes a kinase that physically interacts with NPR1/NIM1 |
| AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
| AT3G12200 | Encodes AtNek7, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT4G24020 | Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile. |
| AT2G17150 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT4G35270 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT1G76350 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
| AT1G08100 | Encodes a high-affinity nitrate transporter. |
| AT1G08090 | High-affinity nitrate transporter. Up-regulated by nitrate. Functions as a repressor of lateral root initiation independently of nitrate uptake. |
| AT3G44320 | This enzyme catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. It is the only one of the four Arabidopsis nitrilases whose mRNA levels are strongly induced when plants experience sulphur deprivation. This enzyme likely participates in other non-auxin-related metabolic pathways. |
| AT3G16410 | Encodes a nitrile-specifier protein NSP4. NSP4 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile. |
| AT2G15620 | Involved in the second step of nitrate assimilation. Its expression is induced by nitrate. The mRNA is cell-to-cell mobile. |
| AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
| AT2G43040 | encodes a calmodulin-binding protein that is expressed specifically in pollen and is required for pollen development. |
| AT1G08300 | no vein-like protein;(source:Araport11) |
| AT1G31885 | NOD26-like intrinsic protein 3;(source:Araport11) |
| AT5G37820 | NOD26-like intrinsic protein 4;(source:Araport11) |
| AT4G10380 | Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells. |
| AT1G80760 | Encodes a protein with boron transporter activity. It helps to preferentially direct boron to young developing tissues in the shoot, such as immature leaves, under low boron conditions. This boron channel appears to be impermeable to water, unlike the closely related NIP5;1 boron transporter. This protein also allows the transport of glycerol, urea, and formimide but not larger uncharged solutes such as arabitol and sucrose when it is expressed heterologously. |
| AT4G19030 | an aquaporin whose expression level is reduced by ABA, NaCl, dark, and desiccation. is expressed at relatively low levels under normal conditions. Also functions in arsenite transport and tolerance. |
| AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
| AT5G45410 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT4G25030 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT3G20600 | Required for non-race specific resistance to bacterial and fungal pathogens.Mediates systemic acquired resistance (SAR) response. The mRNA is cell-to-cell mobile. |
| AT5G20730 | Encodes an auxin-regulated transcriptional activator. Activates expression of IAA1 and IAA9 in the presence of auxin. Mutants affect blue light and gravitropic and auxin mediated growth responses. Together with AUX19, it is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
| AT1G07230 | non-specific phospholipase C1;(source:Araport11) |
| AT3G03540 | Encodes a nonspecific phospholipase C. Located in the cytosol. Involved in the conversion of phospholipids to glycolipids under phosphate deprivation conditions. |
| AT1G64280 | This gene is a key regulator of the salicylic acid (SA)-mediated systemic acquired resistance (SAR) pathway. It is similar to the transcription factor inhibitor I kappa B, and contains ankyrin repeats. It confers resistance to the pathogens Pseudomonas syringae and Peronospora parasitica in a dosage-dependent fashion. Although transgenic Arabidopsis plants overexpressing NPR1 acquire enhanced sensitivity to SA and (benzothiadiazole) BTH, they display no obvious detrimental morphological changes and do not have elevated pathogenesis-related gene expression until activated by inducers or pathogens. |
| AT1G80460 | Encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1. |
| AT5G11630 | The mutant is insensitive to oxylipin 9-HOT treatment. Involved in plant defense. |
| AT1G09000 | NPK1-related protein kinase 1S |
| AT3G06030 | NPK1-related protein kinase 3 |
| AT4G19660 | Encodes NPR4, a ankyrin repeat BTB/POZ domain-containing protein with 36% sequence identity with NPR1. Mutants are more susceptible to the bacterial pathogen Pseudomonas syringe pv. tomato DC3000 and to the fungal pathogen Erysiphe cichoracearum, but do not differ markedly from wild type in interaction with virulent and avirulent strains of the oomycete Peronospora parasitica. NPR4 is required for basal defense against pathogens, and may be implicated in the cross-talk between the SA- and JA-dependent signaling pathways. NPR3 and NPR4 are receptors for the immune signal salicylic acid. |
| AT3G47960 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT5G62680 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile. |
| AT3G45650 | Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots. |
| AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G27040 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G69850 | Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems. |
| AT1G72125 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G72120 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G46050 | Encodes a di- and tri-peptide transporter involved in responses to wounding, virulent bacterial pathogens, and high NaCl concentrations. The protein is predicted to have 12 transmembrane helicies. |
| AT2G26690 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
| AT2G02020 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G30640 | Protein kinase family protein;(source:Araport11) |
| AT5G06510 | nuclear factor Y, subunit A10;(source:Araport11) |
| AT3G05690 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
| AT1G72830 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. Expression is upregulated in the shoot of cax1/cax3 mutant. |
| AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
| AT2G38880 | Encodes a transcription factor from the nuclear factor Y (NF-Y) family, AtNF-YB1. Confers drought tolerance. |
| AT5G47640 | Involved in the regulation of response to nutrient levels. |
| AT2G47810 | nuclear factor Y, subunit B5;(source:Araport11) |
| AT5G27910 | nuclear factor Y, subunit C8;(source:Araport11) |
| AT5G58740 | Member of the family of NudC proteins. Over-expression improves free radical sacenving activity and antioxidant status, promotes root growth and branching under abiotic stress. |
| AT3G57660 | Encodes a subunit of RNA polymerase I (aka RNA polymerase A). The mRNA is cell-to-cell mobile. |
| AT1G29940 | Encodes a subunit of RNA polymerase 1 (aka RNA polymerase A). |
| AT1G06790 | Encodes a subunit of RNA polymerase III involved in maintaining global RNA homeostasis, not just that of genes transcribed by RNA pol III. |
| AT1G32070 | Encodes a acetyltransferase (NSI) that is localized in the nucleus and chloroplast. It interacts with the geminivirus movement protein NSP. This interaction is required for viral infection and systemic spread. Acetylates the viral coat protein (CP) in vitro, but not NSP. NSP inhibits NSI activity in vitro. In the chloroplast NSI functions in the dynamic reorganization thylakoid membrane complexes. NSI is highly transcribed in phloem and in xylem parenchyma cells, and in the apical meristem and guard cells, within young tissues in Arabidopsis, and its expression is turned off as tissues mature.Mutants have reduced melatonin and anthocyanin levels and do not accumulate the PSI-LHCII state transition complex.The protein has distinct lysine acetylation and relaxed N-terminal acetylation specificities on chloroplast proteins as determined by in vitro as well as in vivo analyses using quantitative protein mass spectrometry (PMID:32633465). |
| AT1G52980 | Encodes a GTPase that belongs to the subfamily of YlqF/YawG GTPases. Functions in Pre-60S ribosomal subunit maturation. The mRNA is cell-to-cell mobile. |
| AT2G05760 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G79150 | binding protein;(source:Araport11) |
| AT1G60420 | Reduce transmission through pollen. The mRNA is cell-to-cell mobile. |
| AT5G56950 | Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
| AT4G39390 | Encodes a golgi localized nucleotide sugar transporter. |
| AT1G12880 | nudix hydrolase homolog 12;(source:Araport11) |
| AT3G26690 | Encodes AtNUDT13, a mitochondrial Nudix hydrolase specific for long-chain diadenosine polyphosphates. |
| AT2G01670 | nudix hydrolase homolog 17;(source:Araport11) |
| AT1G14860 | nudix hydrolase homolog 18;(source:Araport11) |
| AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
| AT5G06340 | nudix hydrolase homolog 27;(source:Araport11) |
| AT1G79690 | Encodes a dual activity enzyme which catalyses the hydrolysis of a peptide bond and of a phosphate bond, acting both as a dipeptidyl peptidase III and an atypical Nudix hydrolase. |
| AT1G18300 | nudix hydrolase homolog 4;(source:Araport11) |
| AT2G04430 | nudix hydrolase homolog 5;(source:Araport11) |
| AT2G04450 | Encodes a protein with NADH pyrophosphatase activity. Although this protein was also shown to have ADP-ribose diphosphatase activity in vitro, mutant analyses suggest that NUDX6 is involved in NADH metabolism in vivo. |
| AT4G14880 | Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. Lines carrying semi-dominant mutations exhibit early senescence. Required for pollen tube growth and/or fertilization. |
| AT3G22460 | Encodes a member of a family of genes with O-acetylserine(thiol)lyase activity. |
| AT2G43750 | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasB, the key enzyme for fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Required for pollen tube growth and/or fertilization. |
| AT3G59760 | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasC. Required for pollen tube growth and/or fertilization. |
| AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
| AT3G07780 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. The mRNA is cell-to-cell mobile. |
| AT5G48160 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE1 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. |
| AT5G60850 | Encodes a zinc finger protein. |
| AT1G06160 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT3G46990 | DUF740 family protein, putative (DUF740);(source:Araport11) |
| AT3G14360 | Lipid droplet-associated triacylglycerol lipase (TAG) involved in pollen tube growth. TAG is possibly a direct precursor for the synthesis of membrane lipids in pollen tubes. |
| AT1G05510 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G55920 | Encodes a homolog of the S. cerevisiae Nop2 that is involved in ribosome biogenesis and plays a role on organ size control by promoting cell proliferation and preventing compensation in normal leaf development. |
| AT4G27730 | oligopeptide transporter |
| AT4G10770 | oligopeptide transporter |
| AT1G20510 | OPC-8:0 CoA ligase1;(source:Araport11) |
| AT1G05290 | Member of the CONSTANS-Like protein family which is a putative regulator of reactive oxygen species homeostasis. |
| AT2G41225 | Encodes a protein of unknown function that is involved in regulation of cell expansion. Based on sequence similarity OSR2 is localized to the plasma membrane. It is expressed in organs that are undergoing cell expansion. Over-expression modifies plant sensitivity to ethylene, leading to improved drought tolerance. |
| AT5G65620 | Zincin-like metalloproteases family protein;(source:Araport11) |
| AT1G73530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G13880 | Encodes a pentatricopeptide repeat (PPR) protein involved in RNA editing in mitochondria. |
| AT5G59200 | Encodes a chloroplast RNA editing factor. |
| AT1G79360 | organic cation/carnitine transporter 2;(source:Araport11) |
| AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
| AT2G35720 | Encodes OWL1, a J-domain protein involved in perception of very low light fluences. |
| AT2G37560 | Origin Recognition Complex subunit 2. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts strongly with all ORC subunits. |
| AT5G16690 | Origin Recognition Complex subunit 3. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
| AT2G01120 | Origin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
| AT1G13170 | OSBP(oxysterol binding protein)-related protein 1D;(source:Araport11) |
| AT4G22540 | OSBP(oxysterol binding protein)-related protein 2A;(source:Araport11) |
| AT5G59420 | OSBP(oxysterol binding protein)-related protein 3C;(source:Araport11) |
| AT4G25860 | OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11) |
| AT5G19620 | AtOEP80 is paralog to the chloroplastic protein translocation channel Toc75. Mutations in this locus result in embryo lethality. |
| AT2G28900 | Encodes AtOEP16, a 16-KDa plastid outer membrane protein involved in plastid import of protochlorophyllide oxidoreductase A. Predominantly expressed in leaves and is also inducible by cold treatment. |
| AT5G04820 | ovate family protein 13;(source:Araport11) |
| AT2G36050 | ovate family protein 15;(source:Araport11) |
| AT2G30395 | Member of the plant specific ovate protein family of unknown function. |
| AT3G52540 | ovate family protein 18;(source:Araport11) |
| AT2G18500 | ovate family protein 7;(source:Araport11) |
| AT5G19650 | Transcriptional repressor of KNOX family transcription factors. Encodes pluripotency and stemness, upregulated in LRP cells. |
| AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
| AT4G29190 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses |
| AT5G37830 | Encodes a 5-oxoprolinase that acts in the glutathione degradation pathway and in 5-oxoproline metabolism. |
| AT1G12480 | Encodes a membrane protein with 10 predicted transmembrane helices. SLAC1 is a multispanning membrane protein expressed predominantly in guard cells that plays a role in regulating cellular ion homeostasis and S-type anion currents. SLAC1 is important for normal stomatal closure in response to a variety of signals including elevated CO2, ozone, ABA, darkness, and humidity. SLAC1:GFP localizes to the plasma membrane. |
| AT4G24520 | Encodes a cyp450 reductase likely to be involved in phenylpropanoid metabolism. |
| AT5G39860 | Encodes PRE1 (PACLOBUTRAZOL RESISTANCE1). PRE1 and IBH1 form a pair of antagonistic HLH/bHLH transcription factors that function downstream of BZR1 to mediate brassinosteroid regulation of cell elongation. BNQ1 is directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
| AT3G28857 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT2G32240 | PAMP induced protein involved in defense response. Interaction with UBAC2 proteins in the ER, is necessary for PAMP mediated accumulation of the callose synthase PMR4. |
| AT4G37060 | Patatin-related phospholipase A. Expressed weakly in roots, cotyledons, and leaves but is transcriptionally induced by auxin. Phosphorylation by calcium-dependent protein kinases in vitro enhances its activity. |
| AT4G29800 | PATATIN-like protein 8;(source:Araport11) |
| AT3G54950 | Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition. |
| AT1G22530 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT1G75040 | Thaumatin-like protein involved in response to pathogens. mRNA level of the PR-5 gene (At1g75040)is significantly changed after cutting the inflorescence stem indicating the existence of a network of signal transducing pathways as other stress-regulated genes (At5g01410, At3g17800, At1g29930)do not response to the treatment. The mRNA is cell-to-cell mobile. |
| AT5G12360 | Encodes a protein that protects meiotic centromere cohesion. |
| AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
| AT5G03320 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G06370 | PSE1 is a single copy gene that is induced in response to lead and confers increased tolerance to lead when overexpressed. It is localized to the cytoplasm. The protein has an NC domain. PSE1 appears to regulate tolerance via a GSH dependent phytochelatin synthesis pathway. |
| AT3G55450 | PBS1-like 1;(source:Araport11) |
| AT2G07180 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G69790 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G47070 | Encodes a member of the RLCK VII-4 subfamily of receptor-like cytoplasmic kinases that has been shown to phosphorylate MAPKKK5 Ser-599 and MEKK1 Ser-603, both players in PRR-mediated resistance to bacterial and fungal pathogens. |
| AT4G17660 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G24790 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G15080 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G01300 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28940 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G39110 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28590 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G01020 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G54960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G09410 | Pectinacetylesterase family protein;(source:Araport11) |
| AT5G45280 | Pectin acetylesterase involved in pectin remodelling. |
| AT2G45220 | Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea. |
| AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
| AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G00190 | pectin methylesterase 38;(source:Araport11) |
| AT4G33220 | pectin methylesterase 44;(source:Araport11) |
| AT3G59010 | Encodes PME35, a pectin methylesterase. PME35-mediated demethylesterification of the primary cell wall regulates the mechanical strength of the supporting tissue. |
| AT2G47670 | PMEI6 pectin methylesterase inhibitor functions in establishing a patter of homogalacturonan methylesterification of seed coat cell wall proteins . |
| AT5G53370 | pectin methylesterase PCR fragment F;(source:Araport11) |
| AT5G04960 | Encodes a protein that modulates the activity of pectin methylesterase within the cell wall. |
| AT3G58390 | Represses the RNA the non-stop decay (NSD) and no-go decay (NGD) quality control systems that act during translation. Impairs NSD likely by sequestering the HBS1 components of the NSD complex. |
| AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
| AT1G59870 | ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. Contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration in a salicylic acid?dependent manner. Required for mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and contributes to heavy metal resistance. The mRNA is cell-to-cell mobile. |
| AT4G15340 | Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast. |
| AT5G04810 | Pentatricopeptide which is essential during the early stages of embryo development and acts in the plastid nucleoids as the factor responsible of rps12 intron 1 trans-splicing and, indirectly, in the assembly of 70S ribosomes and plastid translation. |
| AT2G03380 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G73080 | Encodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks. The mRNA is cell-to-cell mobile. |
| AT5G49570 | Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants). |
| AT5G07460 | ubiquitous enzyme that repairs oxidatively damaged proteins. Methionine sulfoxide reductase activity. Mutant lacking reductase activity showed increased protein oxidation, nitration and glycation of specific amino acid residues during darkness. |
| AT1G31050 | Together with PFA2 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G27660 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT5G23940 | Encodes PERMEABLE LEAVES3 (PEL3), a putative acyl-transferase. Mutation in this locus results in altered trichome phenotype (trcichomes become tangled during leaf expansion). Additional phenotype includes altered cuticle layer. |
| AT4G11290 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT1G14540 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT5G05340 | Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes. |
| AT5G42180 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT5G64120 | Encodes a cell wall bound peroxidase that is induced by hypo-osmolarity and is involved in the lignification of cell walls. Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT5G66390 | Encodes a peroxidase that is involved in lignin biosynthesis. Required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT3G49110 | Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
| AT1G01820 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT2G45740 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile. |
| AT1G06530 | Encodes PEROXISOMAL AND MITOCHONDRIAL DIVISION FACTOR2. Involved in mitochondrial morphogenesis. |
| AT5G14520 | Encodes a nucleolar protein that plays an essential role in cell growth and survival through its regulation of ribosome biogenesis and mitotic progression. |
| AT1G30490 | Dominant PHV mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Has overlapping functions with PHABULOSA, REVOLUTA and CORONA/ATHB15 in patterning the apical portion of the embryo. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. |
| AT3G29670 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. The mRNA is cell-to-cell mobile. |
| AT1G65390 | Phloem Protein2 family gene encoding a two-domain protein containing predicted lectin and Toll/Interleukin-1 receptor domains, which is induced upon spider mite attack and improves the ability to defend against T. urticae by participating in the tight regulation of hormonal cross talk upon mite feeding. |
| AT3G53000 | phloem protein 2-A15;(source:Araport11) |
| AT2G26820 | phloem protein 2-A3;(source:Araport11) |
| AT5G45090 | phloem protein 2-A7;(source:Araport11) |
| AT5G45070 | phloem protein 2-A8;(source:Araport11) |
| AT2G02230 | phloem protein 2-B1;(source:Araport11) |
| AT1G56250 | Encodes an F-box protein that can functionally replace VirF, regulating levels of the VirE2 and VIP1 proteins via a VBF-containing SCF complex. It is thought to be involved in DNA integration and T-DNA degradation. |
| AT1G09155 | phloem protein 2-B15;(source:Araport11) |
| AT2G02250 | phloem protein 2-B2;(source:Araport11) |
| AT2G02310 | phloem protein 2-B6;(source:Araport11) |
| AT2G40180 | Encodes PP2C5, a member of the PP2C family phosphatases. PP2C5 acts as a MAPK phosphatase that positively regulates seed germination, stomatal closure and ABA-inducible gene expression. |
| AT2G33770 | Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response and mediates degradation of PHO1 and PHT1s at endomembrane. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT5G23630 | A member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure. MIA is also named PDR2 and was shown to be required for proper expression of SCARECROW (SCR), a key regulator of root patterning, and for stem-cell maintenance in Pi-deprived roots. |
| AT5G43360 | Encodes Pht1;3, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT3G54700 | Encodes Pht1;7, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT1G20860 | Encodes Pht1;8, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT1G76430 | Encodes Pht1;9, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT5G43370 | Encodes a phosphate transporter Pht1;2. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341) The mRNA is cell-to-cell mobile. |
| AT2G29650 | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. |
| AT3G52190 | Encodes a plant specific protein structurally related to the SEC12 proteins of the early secretory pathway. Mutation of PHF1 impairs Pi transport. Expression was detected in all tissues, and was induced by Pi starvation. Localized in endoplasmic reticulum (ER), and mutation of PHF1 resulted in ER retention and reduced accumulation of the plasma membrane PHT1;1 transporter. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
| AT5G42870 | The PAH2 gene encodes a phosphatidate phosphohydrolase. Mutant analysis revealed its involvement in galactolipid synthesis pathway, and the membrane lipid remodeling. The pah1pah2 double-mutant showed enhanced Al-susceptibility under low-P conditions, but there was no significant differences in Al tolerance between pah1pah2 and wild type when they were grown in a solution containing 35 μM Pi. |
| AT3G09920 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) family member. Family members are key enzymes in the process of phosphatidylinositol signaling pathway and have essential functions in growth, development, and biotic and abiotic stresses responses in plants |
| AT2G39290 | Encodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria. |
| AT1G03050 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT1G77740 | Encodes PIP5K2, a phosphatidylinositol-4-phosphate 5-kinase (PtdIns(4)P 5-kinase 2; or PIP5K2 that is involved in regulating lateral root formation and root gravity response. The mRNA is cell-to-cell mobile. |
| AT3G47220 | Encodes a plasma membrane-localized phosphoinositide-specific phospholipase C with a role in thermotolerance. |
| AT3G47290 | phosphatidylinositol-speciwc phospholipase C8;(source:Araport11) |
| AT4G16700 | Encodes a mitochondrial phosphatidylserine decarboxylase. Expressed mainly in roots and flowers. |
| AT1G53310 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.Plays an important role in carbon and nitrogen metabolism. |
| AT2G42600 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.PPC1 and PPC2 are crucial for balancing carbon and nitrogen metabolism. |
| AT1G12580 | phosphoenolpyruvate carboxylase-related kinase 1;(source:Araport11) |
| AT1G12680 | phosphoenolpyruvate carboxylase-related kinase 2;(source:Araport11) |
| AT1G48600 | Encodes a phosphoethanolamine N-methyltransferase that catalyses the last two methylation steps of the three sequential methylations of phosphoethanolamine (PEA) that are required for the synthesis of phosphocholine (PCho) in plants. |
| AT1G17710 | Encodes a phosphoethanolamine/phosphocholine phosphatase. It is likely to be involved in the liberation of inorganic phosphate from intracellular sources. Expression is upregulated in the shoot of cax1/cax3 mutant. |
| AT4G29220 | phosphofructokinase 1;(source:Araport11) |
| AT4G26270 | phosphofructokinase 3;(source:Araport11) |
| AT2G40850 | phosphoinositide 4-kinase gamma 1;(source:Araport11) |
| AT2G03890 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. The mRNA is cell-to-cell mobile. |
| AT2G26560 | Encodes a lipid acyl hydrolase with wide substrate specificity that accumulates upon infection by fungal and bacterial pathogens. Protein is localized in the cytoplasm in healthy leaves, and in membranes in infected cells. Plays a role in cell death and differentially affects the accumulation of oxylipins. Contributes to resistance to virus. |
| AT4G16820 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT3G55940 | Phospholipase C family member. Double mutants with PLC5 show defects in seed coat mucilage, leaf serration and over-expression improves drought tolerance. |
| AT1G13680 | Encodes a phospholipase C-like protein that serves as a convergence point for fumonisin B1 and extracellular ATP signalling, and functions in Arabidopsis stress response to fumonisin B1. |
| AT5G58670 | phosphatidylinositol-specific phospholipase C is induced to a significant extent under various environmental stresses, such as dehydration, salinity, and low temperature. May play a role in secondary ABA response. There are two genes called ATPLC1, one corresponding to AT4g38530 and one corresponding ot AT5g58670 (this one). |
| AT1G52570 | member of C2-PLD subfamily |
| AT4G11850 | Encodes a phospholipase D (gamma) that is involved in aluminum tolerance and plays a role in membrane lipid modulation under Al stress. |
| AT4G11830 | Encodes one of three phospholipase D enzymes of the gamma class. |
| AT4G11840 | member of C2-PLD subfamily |
| AT4G35110 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT1G04010 | phospholipid sterol acyl transferase 1;(source:Araport11) |
| AT1G32060 | phosphoribulokinase;(source:Araport11) |
| AT2G32260 | phosphorylcholine cytidylyltransferase;(source:Araport11) |
| AT1G12370 | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
| AT2G47590 | photolyase/blue light photoreceptor PHR2 (PHR2) mRNA, |
| AT3G12810 | Encodes a protein similar to ATP-dependent, chromatin-remodeling proteins of the ISWI and SWI2/SNF2 family. Genetic analyses suggest that this gene is involved in multiple flowering pathways. Mutations in PIE1 results in suppression of FLC-mediated delay of flowering and causes early flowering in noninductive photoperiods independently of FLC. PIE1 is required for expression of FLC in the shoot apex but not in the root.Along with ARP6 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). The mRNA is cell-to-cell mobile. |
| AT3G47390 | Encodes a protein that is believed to function as a pyrimidine reductase involved in riboflavin and FAD biosynthesis. phs1 was identified as a photosensitive mutant that shows reduced growth, chloroplast developmental abnormalities, reduced chlorophyll levels, increased oxidative stress, reduced NADPH/NADP+ ratios, reduced photosystem I electron transport, and reduced photosynthetic protein levels under high light conditions. Many of these abnormal phenotypes likely arise from the reduction in the levels of FAD in the phs1 mutant. |
| AT1G68650 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
| AT5G13120 | Encodes a lumenal cyclophilin with peptidyl-prolyl isomerase activity that is associated with the NAD(P)H dehydrogenase complex in stromal regions of the thylakoid membrane. It is likely to be important for the accumulation of the hydrophobic domain of the NAD(P)H dehydrogenase complex. This complex is associated with PSI and is responsible for the reduction of plastoquinone. |
| AT1G03130 | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2) |
| AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
| AT1G67740 | PsbY precursor (psbY) mRNA. This single nuclear gene is imported into the chloroplasts where it is processed into two integral membrane proteins with identical topology (PsbY-1 and PsbY-2). The protein appears to bind manganese. Important for the redox control of cytochrome b559. |
| AT2G30170 | Encodes a chloroplast PP2C phosphatase that is required for efficient dephosphorylation of PSII proteins and involved in light acclimation.Loss of function enhances immunity to bacterial pathogens. |
| AT2G20890 | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane?delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. The mRNA is cell-to-cell mobile. |
| AT2G30570 | Encodes PsbW, a protein similar to photosystem II reaction center subunit W. Loss of PsbW destabilizes the supramolecular organization of PSII. |
| AT2G06520 | Encodes a protein with sequence similarity to the spinach photosystem II subunit PsbX. |
| AT4G14150 | Microtubule motor kinesin PAKRP1/Kinesin-12A. Together with PAKRP1L/Kinesin-12B, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT3G26830 | Mutations in pad3 are defective in biosynthesis of the indole derived phytoalexin camalexin. Encodes a cytochrome P450 enzyme that catalyzes the conversion of dihydrocamalexic acid to camalexin. The mRNA is cell-to-cell mobile. |
| AT2G18790 | Red/far-red photoreceptor involved in the regulation of de-etiolation. Exists in two inter-convertible forms: Pr and Pfr (active). Involved in the light-promotion of seed germination and in the shade avoidance response. Promotes seedling etiolation in both the presence and absence of phytochrome A. Overexpression results in etiolation under far-red light. Accumulates in the nucleus after exposure to far red light. The phosphorylation state of the Ser-86 residue of the phytochrome B molecule alters dark reversion of the molecule. The mRNA is cell-to-cell mobile. |
| AT5G35840 | Encodes the apoprotein of phytochrome;one of a family of photoreceptors that modulate plant growth and development. The mRNA is cell-to-cell mobile. |
| AT3G16500 | phytochrome-associated protein 1 (PAP1) |
| AT4G29080 | phytochrome-associated protein 2 (PAP2) |
| AT1G72390 | nuclear receptor coactivator;(source:Araport11) |
| AT2G31980 | PHYTOCYSTATIN 2;(source:Araport11) |
| AT4G16500 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G13590 | Encodes a phytosulfokine-alpha (PSK) precursor, a unique plant peptide growth factor first described in Asparagus. |
| AT2G22860 | Phytosulfokine 2 precursor, coding for a unique plant peptide growth factor. The mRNA is cell-to-cell mobile. |
| AT3G44735 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. |
| AT3G49780 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. Plants overexpressing this gene (under a 35S promoter), develop normal cotyledons and hypocotyls but their growth, in particular that of their roots, was faster than that of wildtype. |
| AT4G37720 | Probable phytosulfokines 6 precursor, coding for a unique plant peptide growth factor. |
| AT5G53890 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of phytosulfokine (PSK), which is a 5-aa tyrosine-sulfated peptide that primarily promotes cellular proliferation. |
| AT1G54570 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
| AT2G25170 | Encodes a SWI/SWF nuclear-localized chromatin remodeling factor of the CHD3 group. Involved in post-germination repression of embryonic development. Acts with GA to establish repression of embryonic genes upon germination. Protein preferentially accumulates in differentiating tissues. Loss of function alleles are associated with expression of embryonic traits in adult plants and derepression of embryonic genes such as PHEROS1. Is an extragenic suppressor of slr2 (SSL2). Mutations in PKL (SSL2) restores lateral root formation in the slr2 mutant slr-1. It was proposed that PKL/SSL2-mediated chromatin remodeling negatively regulates auxin-mediated LR formation in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT4G31900 | chromatin remodeling factor;(source:Araport11) |
| AT2G39210 | Major facilitator superfamily transmembrane transporter responsible for the uptake of picolinate herbicides. |
| AT5G12130 | integral membrane TerC family protein;(source:Araport11) |
| AT4G30720 | Encodes a putative oxidoreductase/electron carrier detected in the chloroplast stroma that is essential to ensure a correct electron flow through the photosynthetic chain and, hence, photosynthesis efficiency and normal growth. Mutations in the Col-0 allele result in pale green pigmentation and defective growth. |
| AT4G32260 | ATPase, F0 complex, subunit B/B, bacterial/chloroplast;(source:Araport11) |
| AT1G68450 | VQ motif-containing protein;(source:Araport11) |
| AT2G26510 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
| AT1G76620 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G77110 | Rate-limiting factor in saturable efflux of auxins. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT1G23080 | Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT1G71090 | Auxin efflux carrier family protein;(source:Araport11) |
| AT1G76520 | Auxin efflux carrier family protein;(source:Araport11) |
| AT1G76530 | Auxin efflux carrier family protein;(source:Araport11) |
| AT2G34650 | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
| AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
| AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
| AT4G02075 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G05000 | Encodes an atypical dual-specificity phosphatase. |
| AT2G32960 | Encodes an atypical dual-specificity phosphatase. |
| AT1G14880 | PLANT CADMIUM RESISTANCE 1;(source:Araport11) |
| AT1G77130 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT4G33330 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT3G26500 | Encodes PIRL2, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT4G26050 | Encodes PIRL8, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
| AT2G18660 | Encodes PNP-A (Plant Natriuretic Peptide A). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. PNP-A contains a signal peptide domain and is secreted into the extracellular space. Co-expression analyses using microarray data suggest that PNP-A may function as a component of plant defence response and SAR in particular, and could be classified as a newly identified PR protein. It is stress responsive and can enhance its own expression. |
| AT5G58650 | Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK). |
| AT2G28830 | Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor. |
| AT3G54850 | Encodes a protein with a typical U-box domain followed by an Armadillo repeat region, a domain organization that is frequently found in plant U-box proteins. Displays ubiquitin ligase activity in vitro. Regulator of flowering time. |
| AT5G42340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G29340 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity. It is required for cell death and full resistance specified by Arabidopsis RPM1 and RPS4 resistance proteins against Pseudomonas syringae pv tomato. The mRNA is cell-to-cell mobile. |
| AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
| AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
| AT3G19380 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
| AT1G49780 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
| AT3G54790 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G62560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G76390 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G18320 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress.Expression in roots is enhanced by auxin and to a lesser extent ABA and cytokinin treatment. |
| AT4G21350 | Encodes a U-box/ARM repeat protein required fore self-incompatibility. |
| AT4G04210 | Arabidopsis thaliana CDC48-interacting UBX-domain protein (PUX4) |
| AT2G01650 | encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo. |
| AT1G67690 | Zincin-like metalloproteases family protein;(source:Araport11) |
| AT4G36650 | Encodes a protein with similarity to the general transcription factor TFIIB. pBRP binds rDNA sequences in vitro. pBRP has been localized to the outer face of the plastid membrane with GFP fusion however, under conditions of proteosome inhibition it is found in the nucleus. |
| AT1G19880 | Encodes a regulator of chromatin condensation 1 (RCC1) family protein; confers plasticity of rosette diameter in response to changes in N availability. |
| AT2G16070 | An integral outer envelope membrane protein (its homolog in A thaliana PDV1), component of the plastid division machinery. Similar to ARC6, PDV2 localizes to a continuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. |
| AT5G20610 | Encodes a member of a plant specific C2 domain containing gene family. Along with PMI, it appears to be involved in chloroplast and nuclear relocation in response to light. |
| AT2G33450 | Ribosomal L28 family;(source:Araport11) |
| AT5G65220 | Ribosomal L29 family protein;(source:Araport11) |
| AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
| AT2G34640 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. |
| AT1G68590 | Ribosomal protein PSRP-3/Ycf65;(source:Araport11) |
| AT1G32440 | encodes a chloroplast pyruvate kinase beta subunit. The enzyme is less active than the other chloroplast pyruvate kinase beta subunit encoded by AT5G52920. Involved in seed oil biosynthesis. Can partially complement the AT5G52920 mutant. |
| AT5G16150 | Encodes a putative plastidic glucose transporter. |
| AT5G52920 | encodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. The mRNA is cell-to-cell mobile. |
| AT2G29700 | Encodes a protein containing one PH (pleckstrin homology) domain with a short N-terminal extension The mRNA is cell-to-cell mobile. |
| AT4G15900 | Mutations confer hypersensitivity to glucose and sucrose and augments sensitivity to cytokinin, ethylene, ABA and auxin. Encodes a nuclear WD40 protein that is imported into the nucleus. Essential for plant innate immunity. Interacts with MOS4 and AtCDC5. It is also predicted to have two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase, and may affect the stability of AKIN10. |
| AT5G02400 | Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background. |
| AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
| AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT2G29790 | Encodes a Maternally expressed gene (MEG) family protein [pseudogene] |
| AT2G16535 | Encodes a Maternally expressed gene (MEG) family protein |
| AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT1G22760 | Putative poly(A) binding protein May there fore function in posttranscriptional regulation, including mRNA turnover and translational initiation. Expression detected only in floral organs. |
| AT3G06560 | Encodes a poly(A) polymerase. Located in the cytoplasm. |
| AT4G02390 | Encodes a DNA dependent nuclear poly (ADP-ribose) polymerase (E.C.2.4.2.30), thought to be involved in post-translational modification . |
| AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT3G59050 | Encodes a polyamine oxidase. |
| AT1G70370 | Polygalacturonase involved in cell wall modification. |
| AT2G41850 | ADPG2. |
| AT5G06860 | Encodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection. Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
| AT3G26610 | Encodes an apoplast-localized polygalacturonase involved in cell elongation and flower development. |
| AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
| AT1G09815 | polymerase delta 4;(source:Araport11) |
| AT2G16120 | polyol/monosaccharide transporter 1;(source:Araport11) |
| AT3G18830 | This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (myo-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily. |
| AT4G36670 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G16530 | Encodes polyprenol reductase involved in N-gylcosylation. Mutants are defective in pollen development. Knockouts are embryo lethal |
| AT3G20160 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT3G01150 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
| AT4G07410 | Encodes a WD-40 protein expressed both during embryo development and postembryonically in the SAM and RAM that functions in the auxin pathway, integrating auxin signaling in the organization and maintenance of the SAM and RAM. |
| AT4G39920 | Microtubule-folding cofactor, produces assembly-competent alpha-/beta-tubulin heterodimers. |
| AT2G18740 | Putative temperature-specific splice regulator of development. Only the first splice form (PCP-alpha) has this function as result of C-terminal addition. |
| AT5G46240 | Encodes a potassium channel protein (KAT1). ABA triggers KAT1 endocytosis both in epidermal cells as well as guard cells. Upon removal of ABA, KAT1 is recycled back to the plasma membrane. KAT1 is localized within 0.5?0.6 μm diameter microdomains at the plasma membrane surface. KAT1 belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT4G32650 | Encodes KAT3, a member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inwardly rectifying conductance): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT1G44910 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. |
| AT3G19840 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. |
| AT1G49800 | Homolog of PIP1. |
| AT5G43066 | Homolog of prePIP1. |
| AT5G44585 | Precursor of serine-rich endogenous peptide which regulates defense response and root elongation. Has properties of phytocytokines, activates the phospholipid signaling pathway, regulates reactive oxygen species response, and is perceived in a BAK1 co-receptor-dependent manner. |
| AT5G49510 | prefoldin 3;(source:Araport11) |
| AT2G40380 | prenylated RAB acceptor 1.B2;(source:Araport11) |
| AT5G01640 | prenylated RAB acceptor 1.B5;(source:Araport11) |
| AT5G07110 | Encodes PRA1.B6, an isoform of the PRA1 (Prenylated Rab acceptors) family. PRAs bind to prenylated Rab proteins and possibly aids in targeting Rabs to their respective compartments. PRA1.B6 localizes to the Golgi apparatus and its ER-to-Golgi trafficking and localization to the Golgi apparatus are regulated by multiple sequence motifs in both the C- and N-terminal cytoplasmic domains. |
| AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
| AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT5G58750 | Putative PRISE (progesterone 5β-reductase and/or iridoid synthase-like 1,4-enone reductases). |
| AT1G29850 | Encodes a protein that by its interaction with HAM acetyltransferases plays an important role during DNA damage responses induced by UV-B radiation and participates in programmed cell death programs. |
| AT5G40770 | prohibitin 3 |
| AT4G02060 | Member of the minichromosome maintenance complex, involved in DNA replication initiation. Abundant in proliferating and endocycling tissues. Localized in the nucleus during G1, S and G2 phases of the cell cycle, and are released into the cytoplasmic compartment during mitosis. Binds chromatin. |
| AT2G39890 | Encodes a proline transporter with affinity for gly betaine, proline and GABA. Protein is expressed in the vascular tissue, specifically the phloem. |
| AT3G55740 | Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed most highly in the roots. |
| AT3G24400 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G18810 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G68690 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G62680 | Proline-rich protein The mRNA is cell-to-cell mobile. |
| AT4G38770 | Encodes one of four proline-rich proteins in Arabidopsis which are predicted to localize to the cell wall. Transcripts are most abundant in aerial organs of the plant. |
| AT3G06300 | Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins. The mRNA is cell-to-cell mobile. |
| AT2G17720 | Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells. |
| AT1G20380 | Putative prolyl oligopeptidase, associated with quantitive disease resistance to S. sclerotiorum. |
| AT3G62120 | Encodes a cytosolic prolyl-tRNA synthetase. |
| AT3G13330 | Encodes a protein that interacts with the 26S proteasome. Mutants are phenotypically indistinguishable from wild type plants under a variety of growth conditions. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor. |
| AT1G04870 | Encodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
| AT4G16570 | protein arginine methyltransferase 7;(source:Araport11) |
| AT1G08910 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
| AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
| AT5G19680 | PP1 Regulatory Subunit3. Interacts with members of the Type One Protein Phosphatases (TOPP) family.Facilitates the nuclear localization of TOPP4 which is required for its activity in mediating ABA responses. |
| AT1G51690 | 55 kDa B regulatory subunit of phosphatase 2A mRNA, |
| AT3G56930 | Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane. |
| AT2G35680 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem. |
| AT5G56610 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT1 in root. For PTPMT2.1, lower expression levels were detected in leaf and stem as compared to the other tissues. |
| AT2G32230 | Encodes a protein-only RNase P that is involved in the 5? cleavage of the precursor tRNAs and is able to cleave tRNA-like structures involved in the maturation of plant mitochondrial mRNAs. Mutants show a drastic reduction in the levels of mature plastid tRNA-Phe(GAA) and tRNA-Arg(ACG), limiting plastid gene expression. |
| AT1G03630 | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
| AT2G42840 | Encodes a putative extracellular proline-rich protein is exclusively expressed in the L1 layer of vegetative, inflorescence and floral meristems and the protoderm of organ primordia. |
| AT4G04890 | Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. |
| AT5G06970 | PATROL1 is a Munc13-like protein involved in mediating H[+]-ATPase translocation. It interacts with AHA1and is responsible for its translocation during stomatal movement. |
| AT3G15340 | Encodes PPI2 (proton pump interactor 2), a homologue of PPI1, a protein that interacts with the plasma membrane H+ ATPase AHA1. |
| AT3G25840 | Spliceosome-associated kinase involved in alternative splicing. May influence alternative splicing patterns by phosphorylating a subset of splicing regulators. |
| AT5G49240 | member of Response Regulator: Pseudo |
| AT5G24470 | Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR7 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
| AT1G50510 | 5'-pseudouridine monophosphate Glycosylase (PUMY) that hydrolyzes 5'-pseudouridine monophosphate to uracil and ribose-5-phosphate. Acts together with the a pseudouridine kinase PUKI in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. |
| AT1G34320 | Ikzf5 (DUF668);(source:Araport11) |
| AT1G72300 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by AT5G58650 that promotes cellular proliferation and expansion. |
| AT5G43090 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G60110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G09610 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT3G24270 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT4G25880 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT2G32080 | similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication |
| AT1G19770 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT1G75470 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G57990 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G47603 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT4G18205 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT4G18197 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT4G18195 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G13750 | Encodes a purple acid phosphatase whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. |
| AT2G16430 | Encodes an acid phosphatase involved plant acclimation to Pi deprivation. |
| AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
| AT3G07130 | Encodes PAP15, a purple acid phosphatase with phytase activity. Expression of PAP15 is developmentally and temporally regulated, with strong expression at the early stages of seedling growth and pollen germination. The expression is also organ/tissue-specific, with strongest expression in the vasculature, pollen grains, and roots. Recombinant PAP protein exhibits broad substrate specificity with moderate phytase activity. PAP15 likely mobilizes phosphorus reserves in plants, particularly during seed and pollen germination. |
| AT3G52820 | purple acid phosphatase 22;(source:Araport11) |
| AT1G52940 | Encodes a purple acid phosphatase that is induced under prolonged phosphate (Pi) starvation and is required for maintaining basal resistance against Pseudomonas syringae and Botrytis cinerea. |
| AT2G01880 | PEP complex component. |
| AT2G03450 | purple acid phosphatase 9;(source:Araport11) |
| AT1G62290 | Saposin-like aspartyl protease family protein;(source:Araport11) |
| AT2G47750 | Encodes GH3.9, a member of the GH3 family auxin-responsive genes. gh3.9-1 mutants had greater primary root length, increased sensitivity to indole-3-acetic acid (IAA)-mediated root growth inhibition, but no obvious effects on apical dominance or leaf morphology. |
| AT3G17410 | Positively regulates ABA-mediated physiological responses via phosphorylation on RCAR3/ RCAR11. |
| AT5G01890 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT3G16420 | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. The mRNA is cell-to-cell mobile. |
| AT1G73000 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. The mRNA is cell-to-cell mobile. |
| AT4G01026 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of ABI1 and ABI2. |
| AT4G22930 | Encodes dihydroorotase (PYR4). |
| AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
| AT5G12200 | Encodes a protein with dihydropyrimidine amidohydrolase activity. It localizes to the secretory system and plays a role in uracil metabolism. |
| AT3G53620 | Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate. The mRNA is cell-to-cell mobile. |
| AT5G01330 | pyruvate decarboxylase |
| AT3G06483 | Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily. |
| AT3G07970 | Required for pollen separation during normal development. In qrt mutants, the outer walls of the four meiotic products of the pollen mother cell are fused, and pollen grains are released in tetrads.May be required for cell type-specific pectin degradation. |
| AT1G15020 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
| AT1G49890 | Together with QWRF1 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
| AT3G06540 | Encodes a cytoplasmic Rab escort protein that preferentially binds the GDP-bound form of Rab and stimulates geranylgeranylation of various Rab GTPases in Arabidopsis extracts in vitro. |
| AT5G41820 | RAB geranylgeranyl transferase alpha subunit 2;(source:Araport11) |
| AT5G47200 | AtRabD2b encodes a Rab GTPase, which plays important roles in pollen development, germination and tube elongation. The mRNA is cell-to-cell mobile. |
| AT2G21880 | RAB GTPase homolog 7A;(source:Araport11) |
| AT1G16920 | small GTP-binding protein (Rab11)similar to YPT3/RAB11 proteins in yeast and mammals, respectively. YPT3/RAB11 is involved in intracellular protein trafficking. |
| AT4G18430 | RAB GTPase homolog A1E;(source:Araport11) |
| AT3G46830 | RAB GTPase homolog A2C;(source:Araport11) |
| AT5G59150 | RAB GTPase homolog A2D;(source:Araport11) |
| AT5G47520 | RAB GTPase homolog A5A;(source:Araport11) |
| AT4G17160 | RAB GTPase homolog B1A;(source:Araport11) |
| AT2G22290 | RAB GTPase homolog H1D;(source:Araport11) |
| AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G45130 | small GTP binding protein The mRNA is cell-to-cell mobile. |
| AT5G06070 | Isolated as a mutation defective in petal development with specific effects on adaxial petals which are filamentous or absent. Encodes a Superman (SUP) like protein with zinc finger motifs. Transcript is detected in petal primordia and protein is localized to the nucleus. |
| AT4G35950 | A member of ROP GTPases gene family-like. GTP binding protein Arac6. |
| AT1G75840 | Belongs to the plant-specific ROP group of Rho GTPases; localized to the plasma membrane of tips of root hairs; involved in polar growth control. The mRNA is cell-to-cell mobile. |
| AT1G19510 | RAD-like 5;(source:Araport11) |
| AT5G21900 | Contributes to UV tolerance through nucleotide excision repair. |
| AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
| AT4G01265 | Pseudogene of AT4G01265; raffinose synthase family protein |
| AT3G29780 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT5G58590 | Encodes a Ran-binding protein 1 homolog (RanBP1). |
| AT5G19320 | Encodes RAN GTPase activating protein 2. The protein is localized to the nuclear envelope during interphase. |
| AT5G01770 | Encodes one of two Arabidopsis RAPTOR/KOG1 homologs. RAPTOR proteins are binding partners of the target of rapamycin kinase that is present in all eukaryotes and play a central role in the stimulation of cell growth and metabolism in response to nutrients. Mutations in this gene have no visible effects on embryo or plant development. |
| AT5G55080 | A member of RAN GTPase gene family. |
| AT3G21060 | Encodes a structural core component of a COMPASS-like H3K4 histone methylation complex that is also involved in the timing of the floral transition. |
| AT5G66160 | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2. |
| AT1G65790 | An alternatively spliced gene that encodes a functional transmembrane receptor serine/threonine kinase, alternate form may not have transmembrane domain. |
| AT1G65800 | Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile. |
| AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
| AT1G71390 | receptor like protein 11;(source:Araport11) |
| AT1G74170 | receptor like protein 13;(source:Araport11) |
| AT1G74190 | receptor like protein 15;(source:Araport11) |
| AT2G15040 | pseudogene of receptor like protein 53;(source:Araport11) |
| AT2G15080 | receptor like protein 19;(source:Araport11) |
| AT1G17240 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. |
| AT2G25440 | receptor like protein 20;(source:Araport11) |
| AT2G32660 | receptor like protein 22;(source:Araport11) |
| AT2G32680 | NLP20 LRR receptor protein involved in PAMP mediated immunity. |
| AT2G33020 | receptor like protein 24;(source:Araport11) |
| AT2G33080 | receptor like protein 28;(source:Araport11) |
| AT3G05370 | receptor like protein 31;(source:Araport11) |
| AT3G05650 | receptor like protein 32;(source:Araport11) |
| AT3G05660 | receptor like protein 33;(source:Araport11) |
| AT3G11010 | receptor like protein 34;(source:Araport11) |
| AT3G11080 | receptor like protein 35;(source:Araport11) |
| AT3G23010 | receptor like protein 36;(source:Araport11) |
| AT3G23110 | receptor like protein 37;(source:Araport11) |
| AT3G23120 | receptor like protein 38;(source:Araport11) |
| AT1G28340 | receptor like protein 4;(source:Araport11) |
| AT4G04220 | receptor like protein 46;(source:Araport11) |
| AT4G13900 | pseudogene of receptor like protein 47;(source:Araport11) |
| AT4G13920 | receptor like protein 50;(source:Araport11) |
| AT5G25910 | putative disease resistance protein induced by chitin oligomers. |
| AT5G27060 | receptor like protein 53;(source:Araport11) |
| AT1G45616 | receptor like protein 6;(source:Araport11) |
| AT1G47890 | receptor like protein 7;(source:Araport11) |
| AT1G58190 | receptor like protein 9;(source:Araport11) |
| AT2G18890 | RLCK VI_A class kinase which activity is regulated by Rho-of-plants (ROP) GTPases. Controls seedling and plant growth in parallel with gibberrellin. |
| AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
| AT5G60900 | Encodes a receptor-like protein kinase. |
| AT3G46530 | Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile. |
| AT1G58602 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT5G43470 | Confers resistance to Peronospora parasitica. In arabidopsis ecotype Dijon-17, HRT-mediated signaling is dependent on light for the induction of hypersensitive response and resistance to turnip crinkle virus. |
| AT1G67500 | Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
| AT5G63540 | Encodes RMI1. Suppresses somatic crossovers. Essential for resolution of meiotic recombination intermediates. |
| AT4G34410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Regulates programmed cell death (PCD) inhibitor genes. Involved in retarding programmed cell death under salt stress due to the regulation of processes participating in ROS inhibition. ERF-regulated transcripts belong to the tryptophan biosynthesis, tryptophan metabolism, and downstream plant hormone signal transduction pathways, where ERF109 potentially acts as a 'master switch' mediator of a cascade of consecutive events across the three pathways, promoting plant growth and re-adjustment to homeostasis due the direct participation in auxin biosynthesis leading to the plants ability to tolerate salt stress. |
| AT1G70630 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT4G28080 | Encodes REDUCED CHLOROPLAST COVERAGE 2 (REC2). Along with REC1 and REC3 it contributes to establishing the size of the chloroplast compartment. |
| AT1G15290 | Encodes REDUCED CHLOROPLAST COVERAGE 3 (REC3). Contributes to establishing the size of the chloroplast compartment. |
| AT4G04340 | Encodes a plasma membrane localized hyperosmolality gated calcium channel that is expressed in guard cells and roots. |
| AT5G41040 | Encodes a feruloyl-CoA transferase required for suberin synthesis. Has feruloyl-CoA-dependent feruloyl transferase activity towards substrates with a primary alcohol. |
| AT1G19360 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
| AT3G18990 | Required for vernalization. Essential for the complete repression of FLC in vernalized plants. Required for the methylation of histone H3 |
| AT5G46340 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT3G17170 | Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11) |
| AT3G26090 | Encodes AtRGS1, a putative membrane receptor for D-glucose. Also functions as a regulator of G-protein signaling. Has GTPase-accelerating activity. Regulates the activity of AtGPA1. Lines over-expressing the gene are more tolerant to dehydration and root elongation. These phenotypes are dependent on ABA. Nuclear localization of the protein is dependent on ABA. RGS1 endocytosis is induced by JA which promotes its dissociation from GPA1. |
| AT1G79950 | Encodes a homologue of human Regulator of Telomere Elongation Helicase1 (RTEL1). Plays a central role in the preservation of genome stability. |
| AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
| AT4G36900 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1. |
| AT1G22190 | The gene encodes a putative transcription factor belongings to the abiotic stress-associated DREB A-6 clade. The mRNA is cell-to-cell mobile. |
| AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT2G28550 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY2 to regulate CO and FT. TOE1 binds to activation domain of CO and binds CORE sequences of the FT promoter.TOE1/TOE2 are also targets of MiR172b and function in regulation of innate immunity. |
| AT2G22010 | Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. |
| AT1G49480 | Encodes a nuclear-localized DNA-binding protein that interacts with ITN1 at the PM and nuclei in vivo and may regulate ITN's subcellular localization. |
| AT3G48430 | Relative of Early Flowering 6 (REF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a positive regulator of flowering in an FLC-dependent pathway. REF6 mutants have hyperacetylation of histone H4 at the FLC locus. REF6 interacts with BES1 in a Y2H assay and in vitro. REF6 may play a role in brassinoteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. It is most closely related to the JHDM3 subfamily of JmjN/C proteins. The mRNA is cell-to-cell mobile. |
| AT3G57540 | Remorin family protein;(source:Araport11) |
| AT1G77470 | Encodes a protein with high homology to the Replication Factor C, Subunit 3 (RFC3) of yeast and other eukaryotes. rfc3 mutants are hypersensitive to salicylic acid and exhibit enhanced induction of PR genes and resistance against virulent oomycete Hyaloperonospora arabidopsidis Noco2. The enhanced pathogen resistance in the mutant is NPR1-independent. |
| AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
| AT5G23730 | Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling. |
| AT2G16210 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT4G31615 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT2G44420 | protein N-terminal asparagine amidohydrolase family protein;(source:Araport11) |
| AT1G79670 | Encodes a receptor-like kinase that does not contain an extracellular leucine-rich repeat domain. A novel type of dominant disease-resistance protein that confers resistance to a broad spectrum of Fusarium races. |
| AT3G07040 | Contains an N-terminal tripartite nucleotide binding site and a C-terminal tandem array of leucine-rich repeats. Confers resistance to Pseudomonas syringae strains that carry the avirulence genes avrB and avrRpm1. |
| AT1G54470 | Encodes a Cf-like gene in Arabidopsis that confers downy mildew resistance to several isolates of Peronospora parasitica. |
| AT1G11330 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT3G03710 | Encodes a chloroplast polynucleotide phosphorylase (PNPase). Involved in response to phosphorus (P) starvation. Mutants impaired in the expression of this gene have been selected through their resistance to fosmidomycin, a strong inhibitor of DXR, an enzyme of the methylerythritol-dependent IPP biosynthesis pathway. The pathway enzymes were upregulated in the mutant seedlings. |
| AT5G05630 | Encodes POLYAMINE UPTAKE TRANSPORTER 3, an amino acid permease family protein. |
| AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
| AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
| AT1G12220 | Resistance gene, mediates resistance against the bacterial pathogen Pseudomonas syringae. Contains a putative nucleotide binding site composed of kinase-1a (or P-loop), kinase-2a, and putative kinase-3a domains, 13 imperfect leucine-rich repeats, a potential leucine zipper, and two uncharacterized motifs that are well conserved in products of previously isolated R genes. Confers resistance to Pseudomonas syringae strains that express avrPphB. |
| AT5G46470 | Encodes RPS6 (RESISTANT TO P. SYRINGAE 6), a member of the TIR-NBS-LRR class resistance protein. The mRNA is cell-to-cell mobile. |
| AT5G45260 | Confers resistance to Ralstonia solanacearum. Similar to NBLS-TIR resistance genes,and also contains similarity to transcription factors. Interacts with pathogen effector protein AvrPop2. |
| AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT4G31920 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT2G25180 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical.The retention of leaf water content, maintenance of cell membrane stability, and enhancement of anthocyanin biosynthesis were found to contribute to the enhanced drought tolerance of the arr1,10,12 triple mutant. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT3G62670 | member of Response Regulator: B- Type |
| AT5G07210 | member of Response Regulator: B- Type |
| AT5G26594 | Encodes an atypical subtype of the ARR (Arabidopsis response regulator) protein family . It appears to be expressed in floral buds, mature flowers, and pollen. But, unlike the related ARR22 protein, it does not appear to be expressed at the seed:funiculus junction. |
| AT1G59940 | Type A response regulator highly similar to bacterial two-component response regulators. Rapidly induced by cytokinin. Involved in red-light signaling. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT2G41310 | Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT3G49570 | response to low sulfur 3;(source:Araport11) |
| AT5G24655 | response to low sulfur 4;(source:Araport11) |
| AT4G39090 | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R?mediated resistance response. |
| AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
| AT5G44790 | ATP dependent copper transporter vital for ethylene response pathway |
| AT3G10260 | Reticulon family protein;(source:Araport11) |
| AT3G61560 | Reticulon family protein;(source:Araport11) |
| AT4G02960 | a copia-type retrotransposon element containing LTRs and encoding a polyprotein. This retro element exists in two loci in Landsberg erecta but only once in Columbia |
| AT4G01280 | RVE5 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
| AT3G09600 | Encodes a MYB-like transcription factor similar to CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) and ELONGATED HYPOCOTYL (LHY). Involved in the regulation of circadian clock by modulating the pattern of histone 3 (H3) acetylation. Functions as a transcriptional activator of evening element containing clock genes. Involved in heat shock response. |
| AT3G08900 | RGP3 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It is a reversibly autoglycosylated protein. Fluorescently-tagged RGP3 is found in the cytosol and associated with Golgi-like particles when expressed in tobacco leaves. An RGP3-YFP fusion protein under the control a native promoter can be found in the endosperm of Arabidopsis embryos during the linear and bent cotyledon stages of development. |
| AT3G03450 | Encodes a DELLA protein, a member of the GRAS superfamily of putative transcription factors. DELLA proteins restrain the cell proliferation and expansion that drives plant growth. Negative regulator of the response to GA in controlling seed germination. GA triggers the degradation of RGL2 protein in a process blocked by both proteasome inhibitors and serine/threonine phosphatase inhibitors. The protein undergoes degradation in response to GA via the 26S proteasome. RGL2 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Regulates GA-promoted seed germination. Involved in flower and fruit development. |
| AT2G22620 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT1G56550 | Encodes a rhamnogalacturonan II specific xylosyltransferase. |
| AT4G01750 | Encodes a protein with UDP-xylose-dependent xylosyltransferase activity, which transfers Xyl onto L-fucose and (albeit less efficiently) L-arabinose. The linkage to L-fucose was shown to be preferentially to the O-4 position. Analysis of mutant containing T-DNA insertion in this gene indicate that the RGXT2 protein might be involved in the synthesis of the α-D-Xyl-(1,3)-α-L-Fuc-(1,4)-L-Rha structure in pectic rhamnogalacturonan II. The mRNA is cell-to-cell mobile. |
| AT1G78570 | Encodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in E. coli. |
| AT3G14790 | rhamnose biosynthesis 3;(source:Araport11) |
| AT5G45160 | Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11) |
| AT3G09970 | Encodes a cytosolic tyrosine phosphatase. |
| AT3G53780 | RHOMBOID-like protein 4;(source:Araport11) |
| AT1G17160 | RBSK is a plastid localized ribokinase involved in nucleoside metabolism. It is the only member of this gene family in Arabidopsis. |
| AT2G39780 | Encodes the main endoribonuclease activity in plant cells and localizes to the endoplasmic reticulum (ER), ER-derived structures, and vacuoles. It is essential for normal ribosomal RNA recycling. The mRNA is cell-to-cell mobile. |
| AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it. |
| AT2G36620 | RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020). |
| AT5G40950 | ribosomal protein large subunit 27;(source:Araport11) |
| AT5G30510 | ribosomal protein S1;(source:Araport11) |
| AT3G07750 | 3-5-exoribonuclease family protein;(source:Araport11) |
| AT1G79380 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
| AT5G14420 | Encodes RGLG2 (RING domain ligase 2), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. |
| AT3G45480 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
| AT4G28270 | Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro. |
| AT4G11370 | Encodes a putative RING-H2 finger protein RHA1a. |
| AT4G11360 | Encodes a putative RING-H2 finger protein RHA1b. The mRNA is cell-to-cell mobile. |
| AT4G35480 | Encodes a putative RING-H2 finger protein RHA3b. |
| AT2G40830 | Encodes an E3 ubiquitin ligase for the GA-receptor GID1 that functions as a negative regulator of GA signaling in seedlings and seeds by inducing ubiquitin-dependent proteolysis of GID1s. Tyr321 phosphorylation of GARU by TAGK2 inactivates GARU. |
| AT1G29730 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
| AT1G29740 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
| AT2G42520 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G09720 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G41340 | NRPE5-like protein of unknown function; homologous to budding yeast RPB5 |
| AT1G74230 | encodes a glycine-rich RNA binding protein. The mRNA is cell-to-cell mobile. |
| AT1G17640 | Belongs to a member of the RNA-binding glycine-rich (RBG) gene superfamily. |
| AT2G33410 | Belongs to a member of the RNA-binding glycine-rich (RBG) gene superfamily. The mRNA is cell-to-cell mobile. |
| AT5G54900 | RNA-binding protein 45A;(source:Araport11) |
| AT1G49600 | RNA-binding protein 47A;(source:Araport11) |
| AT1G47490 | RNA-binding protein 47C;(source:Araport11) |
| AT1G47500 | RNA-binding protein 47C;(source:Araport11) |
| AT4G03110 | Encodes a putative RNA-binding protein that is located in the cytoplasm and is involved in the hypersensitive response and positively regulates salicylic acid-mediated immunity. |
| AT1G07910 | Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains, an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo. |
| AT1G08540 | Enodes a subunit of chloroplast RNA polymerase, confers the ability to recognize promoter sequences on the core enzyme. SIG1 is induced by red and blue light. |
| AT4G15417 | RNAse II-like 1;(source:Araport11) |
| AT1G80650 | RNAse THREE-like protein 1;(source:Araport11) |
| AT1G30510 | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G64440 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Mutants in RHD1 have abnormally shaped root hairs with a bulbous region at the base. Allelic to REB1 encoding a UDP-D-glucose 4-epimerase involved in cell wall biosynthesis.Involved in growth and cell wall carbohydrate biosynthesis. |
| AT4G22080 | root hair specific 14;(source:Araport11) |
| AT4G29180 | root hair specific 16;(source:Araport11) |
| AT4G38390 | root hair specific 17;(source:Araport11) |
| AT5G67400 | root hair specific 19;(source:Araport11) |
| AT1G63450 | Encodes a xyloglucan-specific galacturonosyltransferase (XUT1) that forms the beta-d-galactosyluronic acid-(1->2)-alpha-d-xylosyl linkage. |
| AT5G02820 | Involved in the patterning and shape of leaf trichomes. Encodes the DNA topoisomerase VI SPO11-3, involved in endoreduplication |
| AT5G57280 | Gene encodes a methyltransferase-like protein involved in pre-rRNA processing. |
| AT2G31190 | Encodes RUS2 (root UVB sensitive2), a DUF647-containing protein that is homologous to the RUS1 protein. RUS2 works with RUS1 in a root UV-B sensing pathway that plays a vital role in Arabidopsis early seedling morphogenesis and development. Required for auxin polar transport. |
| AT2G26290 | root-specific kinase 1;(source:Araport11) |
| AT1G52240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
| AT1G31650 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT1G01700 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G55660 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G11490 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
| AT4G04900 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC9 and RIC11 (subfamily group I). Gene is expressed predominantly in roots, leaves, and seedlings. |
| AT4G38740 | Encodes cytosolic cyclophilin ROC1. |
| AT1G17235 | This gene is predicted to encode a small protein with a DVL domain found in the DVL / RTFL protein family. Over-expression analyses using truncated versions of a related family member, ROT4, suggest that the DVL / RTF domain is involved in regulating cell proliferation. |
| AT5G16023 | Encodes a plant peptide that could be involved in the coordination of socket cell development in wild-type plants. |
| AT1G64585 | ROTUNDIFOLIA like 22;(source:Araport11) |
| AT3G46613 | Encodes a small is a member of an angiosperm specific gene family. |
| AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
| AT5G05780 | Encodes a putative 26S proteasome subunit RPN8a. The function of RPN8a and other 26S subunits may be required for specifying leaf adaxial identity. The mRNA is cell-to-cell mobile. |
| AT3G23390 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
| AT2G20310 | Encodes RPM1 Interacting Protein 13 (RIN13), a resistance protein interactor shown to positively enhance resistance function of RPM1. |
| AT3G25070 | Encodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation. Major virulence target of the TTSE HopF2Pto. The mRNA is cell-to-cell mobile. |
| AT5G35910 | Encodes a nuclear-localized RRP6-like protein whose mutation leads to accumulation of an rRNA maturation by-product. |
| AT5G58020 | Encodes a replication termination factor 2 domain containing protein involved in the regulation of pre-mRNA splicing. |
| AT5G53040 | Encodes GROUNDED (GRD), a putative RWP-RK-type transcription factor broadly expressed in early development. GRD promotes zygote elongation and basal cell fates. |
| AT4G39460 | Encodes a plastid metabolite transporter required for the import of S-Adenosylmethionine from the cytosol. Impaired function of SAMT1 led to decreased accumulation of prenyllipids and mainly affected the chlorophyll pathway. |
| AT4G01850 | S-adenosylmethionine synthetase 2;(source:Araport11) |
| AT1G61380 | Encodes a membrane localized S-domain receptor kinase that is involved in lipopolysaccharide (LPS) sensing. SD1-29 detected LPS of Pseudomonas and Xanthomonas species for which it serves as a microbe associated molecular pattern triggering innate immunity. Loses of function mutants are hyper susceptible to P.syringae. |
| AT4G32300 | S-domain-2 5;(source:Araport11) |
| AT1G49820 | encodes 5-methylthioribose kinase, involved in methionine cycle The mRNA is cell-to-cell mobile. |
| AT1G58250 | SABRE, putative gene of unknown function, homologous to maize apt1 gene. Required for normal cell expansion in the root cortex. The sabre mutation results in abnormal cell expansion. Encodes a rare message; very low level of expression was detected in roots and shoots. |
| AT3G58865 | Member of Sadhu non-coding retrotransposon family |
| AT5G22450 | SAGA complex subunit. Regulates gene expression by affecting histone H3 acetylation. |
| AT5G02020 | Encodes a protein involved in salt tolerance, names SIS (Salt Induced Serine rich). |
| AT2G01980 | Encodes a plasma membrane-localized Na+/H+ antiporter SOS1. Functions in the extrusion of toxic Na+ from cells and is essential for plant salt tolerance. Has 12 predicted transmembrane domains in the N-terminal region and a long cytoplasmic tail of approx. 700 aa at the C-terminal side. SOS1 interacts through its predicted cytoplasmic tail with RCD1, a regulator of oxidative-stress responses, suggesting that SOS1 might function in oxidative-stress tolerance. |
| AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
| AT2G31380 | a B-box zinc finger protein that interacts with COP1. contains a novel 11 amino acid motif at the C-terminus (also found at the N-terminus of HY5) that is involved in the COP1 interaction. |
| AT1G27730 | Related to Cys2/His2-type zinc-finger proteins found in higher plants. Compensated for a subset of calcineurin deficiency in yeast. Salt tolerance produced by ZAT10 appeared to be partially dependent on ENA1/PMR2, a P-type ATPase required for Li+ and Na+ efflux in yeast. The protein is localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin oligomers. Also involved in response to photooxidative stress. |
| AT5G22270 | hypothetical protein;(source:Araport11) |
| AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
| AT2G31870 | The gene encodes a poly(ADPribose) glycohydrolase (PARG1). Mutant analysis suggests that PARG1 plays a role in abiotic stress responses and DNA repair. Loss of function mutants accumulate poly(ADPribose) and have increased cell death when treated with bleomycin. |
| AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
| AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
| AT5G52810 | SAR-DEFICIENT4 (SARD4) alias ORNITHINE CYCLODEAMINASE/m-CRYSTALLIN (ORNCD1) is involved in the biosynthesis of pipecolic acid. The reductase converts dehydropipecolic acid intermediates generated from L-Lysine by AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) to pipecolic acid (PMID:28330936). |
| AT3G13570 | encodes an SC35-like splicing factor of 30 kD that is localized to the nuclear specks. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT4G17230 | Encodes a scarecrow-like protein (SCL13). Member of GRAS gene family. Regulated by heat shock. |
| AT1G50420 | Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT5G13300 | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin. |
| AT3G12900 | S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil. |
| AT3G23727 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT3G27503 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G10767 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G08695 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT2G05117 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT3G04240 | Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570). |
| AT1G03220 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G39180 | encodes a protein that complements the function of a sec14(ts) mutant of S. cerevisiae |
| AT1G61250 | Encodes a putative secretory carrier membrane protein (SC3). The mRNA is cell-to-cell mobile. |
| AT3G48460 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G26740 | Encodes caleosin, a 27-kDa protein found within seed lipid bodies. Gene is expressed preferentially in the embryo, has similarity to a rice ABA-responsive gene, EFA27. Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
| AT1G55740 | seed imbibition 1;(source:Araport11) |
| AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
| AT2G34380 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction between VAP27-1 and SEIPIN3 requires the N-terminal 25 amino acids of SEIPIN3 that contain an FFAT motif. |
| AT3G47300 | SELT-like protein precursor;(source:Araport11) |
| AT3G10985 | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. The mRNA is cell-to-cell mobile. |
| AT1G20780 | Encodes a protein containing a U-box and an ARM domain. Homozygous mutant seedlings have a seedling lethal phenotype with widespread cell death lesions throughout the cotyledons and roots. |
| AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. The mRNA is cell-to-cell mobile. |
| AT5G22890 | An unique homologue of STOP1 (AT1G34370) in Arabidopsis genome. Transformation to the stop1-mutant activated several genes that are regulated by STOP1, and conferred proton sensitive phenotype. |
| AT3G53030 | Encodes a protein kinase SRPK4 that specifically targets Arabidopsis Ser/Arg-rich (SR) slicing factors involved in RNA metabolism. In vitro kinase assay showed that SRPK4 phosphorylates the SR protein RSp31. |
| AT3G12230 | serine carboxypeptidase-like 14;(source:Araport11) |
| AT3G12240 | serine carboxypeptidase-like 15;(source:Araport11) |
| AT3G12220 | serine carboxypeptidase-like 16;(source:Araport11) |
| AT1G33540 | serine carboxypeptidase-like 18;(source:Araport11) |
| AT5G09640 | encodes a serine carboxypeptidase-like (SCPL) protein. Mutants accumulate sinapoylglucose instead of sinapoylcholine, and have increased levels of choline and decreased activity of the enzyme sinapoylglucose:choline sinapoyltransferase. |
| AT4G12910 | serine carboxypeptidase-like 20;(source:Araport11) |
| AT2G35780 | serine carboxypeptidase-like 26;(source:Araport11) |
| AT2G35770 | serine carboxypeptidase-like 28;(source:Araport11) |
| AT3G17180 | serine carboxypeptidase-like 33;(source:Araport11) |
| AT2G12480 | serine carboxypeptidase-like 43;(source:Araport11) |
| AT1G28110 | serine carboxypeptidase-like 45;(source:Araport11) |
| AT2G33530 | serine carboxypeptidase-like 46;(source:Araport11) |
| AT1G15000 | serine carboxypeptidase-like 50;(source:Araport11) |
| AT2G27920 | serine carboxypeptidase-like 51;(source:Araport11) |
| AT5G01820 | Encodes a CBL-interacting serine/threonine protein kinase. |
| AT3G08720 | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
| AT5G08160 | Encodes a serine/threonine protein kinase. |
| AT5G37055 | Encodes SERRATED LEAVES AND EARLY FLOWERING (SEF), an Arabidopsis homolog of the yeast SWC6 protein, a conserved subunit of the SWR1/SRCAP complex. SEF loss-of-function mutants have a pleiotropic phenotype characterized by serrated leaves, frequent absence of inflorescence internodes, bushy aspect, and flowers with altered number and size of organs. sef plants flower earlier than wild-type plants both under inductive and non-inductive photoperiods. SEF, ARP6 and PIE1 might form a molecular complex in Arabidopsis related to the SWR1/SRCAP complex identified in other eukaryotes. |
| AT1G11870 | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
| AT5G53430 | Homology Subgroup III; Orthology Group 2 - A putative histone methyltransferase (predicted to methylate H3K4) related to the Drosophila trithorax group proteins TRX and TRR and the yeast gene SET1. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
| AT4G30860 | Encodes a member of the trxG protein family. Contains a SET domain which is known to be involved in modification of histone tails by methylation. Interacts physically with AMS, but the implications of this interaction are unknown.Overexpression results in plieotrophic developmental defects. |
| AT4G27910 | Encodes a SET domain containing protein, putative H3K4 methyltransferase. Involved in bolting/flowering time together with ATX1 and ATX3. |
| AT4G25520 | SEUSS-like 1;(source:Araport11) |
| AT4G34660 | SH3 domain-containing protein;(source:Araport11) |
| AT4G18060 | SH3 domain-containing protein;(source:Araport11) |
| AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
| AT4G00720 | Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase. Functions in the brassinosteroid signalling pathway. |
| AT5G49270 | Involved in successfully establishing tip growth in root hairs. |
| AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
| AT1G07010 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT1G19790 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT5G11190 | Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT4G31120 | Involved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. |
| AT5G39510 | Encodes a member of SNARE gene family. Homologous with yeast VTI1 and is involved in vesicle transport. Mutant alleles such as sgr4/zig are defective in the shoots response to gravity resulting in a zigzag growth pattern of the stem. Involved in protein trafficking to lytic vacuoles. Can conditionally substitute VTI12 in protein storage vacuole trafficking when plants are devoid of VTI12. The mRNA is cell-to-cell mobile. |
| AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
| AT5G66350 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Shi mutant is dominant, has dwarf phenotype. Loss of function mutations have no observable phenotype. Putative zinc finger protein. Involved in the response to gibberellic acid. |
| AT2G09795 | Natural antisense transcript overlaps with AT2G09800. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT5G24735 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT4G37650 | Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains. SHORT-ROOT forms a network in combination with JACKDAW, BLUEJAY AND SCARECROW to regulate tissue patterning through asymmetric cell division. The ground tissue lineage remains in shortroot mutant, while it is progressively lost in the triple mutant bluejay jackdaw scarecrow and double mutant jackdaw scarecrow. In addition, ground tissue basal identity remains in shortroot mutant while it is defective in the quadruple mutant bluejay jackdaw magpie nutcracker. |
| AT3G29250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G47140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G51680 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G47130 | Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria. |
| AT3G08800 | Encodes a nuclear and endosome localized protein with ARM and HEAT domains that interacts with SHR and other non-cell-autonomous proteins and may be involved in their intercellular movement. Hypomorphic mutant phenotypes suggest involvement of the protein in root patterning. |
| AT1G66970 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G58050 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G58170 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G02220 | cyclin-dependent kinase inhibitor;(source:Araport11) |
| AT1G05820 | SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11) |
| AT2G22300 | Encodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
| AT3G15390 | Encodes a novel protein that is similar to PRL1 interacting factor and is involved in virus induced silencing. |
| AT2G35510 | Encodes a WWE domain-containing protein with 76% similarity to RCD1. The protein also contains a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
| AT1G23550 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Its transcript level is up-regulated by tunicamycin (N-linked glycosylation inhibitor causing ER stress). |
| AT5G62520 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
| AT1G70060 | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). The mRNA is cell-to-cell mobile. |
| AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
| AT1G10230 | Involved in protein degradation. One target is PHR1. |
| AT1G20140 | SKP1-like 4;(source:Araport11) |
| AT3G21840 | SKP1-like 7;(source:Araport11) |
| AT5G67250 | Encodes an SKP1 interacting partner (SKIP2).Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,2, and 3. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT1G55560 | SKU5 similar 14;(source:Araport11) |
| AT4G22010 | SKU5 similar 4;(source:Araport11) |
| AT1G21860 | SKU5 similar 7;(source:Araport11) |
| AT4G38420 | SKU5 similar 9;(source:Araport11) |
| AT1G41830 | SKU5-similar 6;(source:Araport11) |
| AT4G27970 | Encodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane. |
| AT1G62262 | Predicted to encode a protein with similarity to the SLAC1 protein involved in ion homeostasis in guard cells. |
| AT5G48170 | encodes an F-box protein whose protein sequence is similar to SLY1, which belongs to SCF-SLY1 E3 ligase complex. SCF-SLY1 E3 ligase degrades DELLA proteins that are involved in promoting growth. Overexpression of SLY2 can partially compensate sly1-10 mutant phenotype of dwarfism. |
| AT1G55040 | SED1 is a protein of unknown function that is located in the mitochondrion. sed1 mutants are embryo lethal. |
| AT1G76860 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT3G59810 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT4G13520 | Encodes a small acid protein (SMAP1) that mediates responses Arabidopsis root to the synthetic auxin 2,4-Dichlorophenoxyacetic acid. The mRNA is cell-to-cell mobile. |
| AT3G56950 | One of the Major Intrinsic Proteins(MIPs) which facilitate the passive transport of small molecules across membranes.Belongs to a family of plant aquaporins.Similar to yeast and radish aquaporins. Located on ER. Probably involved in the alleviation of ER stress; the lack of SIP2;1 reduces both pollen germination and pollen tube elongation. |
| AT1G55270 | SAGL1 is a member of a small family of KELCH domain containing proteins. Loss of function mutants show increased lignin and anthocyanin production suggesting a role in regulation of phenylpropanoid biosynthesis. |
| AT1G79130 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G16510 | Encodes a clade III SAUR gene with a distinctive expression pattern in root meristems. It is normally expressed in the quiescent center and cortex/endodermis initials and upon auxin stimulation, the expression is found in the endodermal layer. Overexpression studies suggest roles in cell expansion and auxin transport. |
| AT2G18010 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G13790 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G22620 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G12410 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G36210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G19830 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G50760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G53250 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G60690 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G12955 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G36110 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G55170 | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. |
| AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
| AT3G52490 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT1G07200 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT3G48880 | Encodes an F-box protein, SNIPER4, that regulates the turnover of MUSE13 and MUSE14, redundant TRAF proteins serving as adaptors in the SCFCRP1 complex to facilitate the turnover of nucleotide-binding domain and leucine-rich repeats (NLR) immune receptors. |
| AT3G50500 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. |
| AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
| AT5G60750 | Encodes a chloroplast endoproteinase, SNOWY COTYLEDON4 (SCO4), required for photosynthetic acclimation to higher light intensities. |
| AT1G26470 | chromatin modification-like protein;(source:Araport11) |
| AT4G32400 | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
| AT2G37390 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
| AT1G17050 | Encodes one of the two paralogous solanesyl diphosphate synthases - SPS1 (At1g78510) and SPS2 (At1g17050) - that assemble the side-chain of plastoquinone-9 in plastids. |
| AT5G61210 | membrane localized t-SNARE SNAP25 homologue, probably involved in cytokinesis and cell plate formation The mRNA is cell-to-cell mobile. |
| AT2G13790 | somatic embryogenesis receptor-like kinase 4;(source:Araport11) |
| AT2G13800 | somatic embryogenesis receptor-like kinase 5;(source:Araport11) |
| AT1G79580 | NAC-domain protein. Involved in root cap development. Involved in a regulatory feedback loop with FEZ. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions. |
| AT1G03790 | Encodes SOMNUS (SOM), a nucleus-localized CCCH-type zinc finger protein. SOM negatively regulates light-dependent seed germination downstream of PIL5 (AT2G20180). |
| AT5G07120 | Encodes sorting nexin SNX2b. SNX2b is peripherally associated with membranes. Involved in vesicular trafficking from endosomes to the vacuole. |
| AT3G48195 | Encodes a member of the Arabidopsis sorting nexin family. |
| AT1G05577 | SOK1 is a DUF966 domain containing protein. It is expressed during embryogenesis in the apical-lateral plasma membrane. SOK1 can form homodimers and it's polar localization of SOK1 depends on N terminal domains within the protein. Misexpression of SOK1 or delocalization alters cell division planes. |
| AT3G46110 | DUF966 domain containing protein, expressed during embryogenesis. |
| AT5G59790 | SOK5 is a DUF966 domain containing protein expressed in early embryos. |
| AT1G09070 | SRC2 specifically binds the peptide PIEPPPHH, and moves from ER to a vacuole fraction where it gets internalized. Involved in Protein Storage Vacuole targeting. The mRNA is cell-to-cell mobile. |
| AT4G11110 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA2 primarily regulates seedling development in darkness and has little function in light-grown seedlings or adult plants. |
| AT1G70310 | Spermidine synthase. |
| AT5G53120 | encodes a novel spermine synthase and is a paralog of previously characterized spermidine synthases, SPDS1 and SPDS2. SPDS3 forms heterodimers with SDPS2, which in turn forms heterodimers with SDPS1 in vivo. The gene does not complement speDelta3 deficiency of spermidine synthase in yeast but DOES complement speDelta4 deficiency. |
| AT1G14290 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT3G61580 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
| AT3G58490 | Encodes a long-chain base 1-phosphate (LCBP) phosphatase that is expressed in the endoplasmic reticulum. |
| AT4G21540 | Encodes a sphingosine kinase, also has enzyme activity towards other plant long-chain sphingoid bases. Involved in guard cell ABA signalling and seed germination. |
| AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
| AT3G02180 | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT5G15600 | SPIRAL1-LIKE4 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT4G23496 | Belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT1G03060 | Encodes a WD/BEACH domain protein involved in cell morphogenesis and ribonucleoprotein particle formation. It interacts with the P-body core component DCP2, associates to mRNA processing bodies (P-bodies), and regulates their assembly upon salt stress. It accumulates at the root hair apex via post-Golgi compartments and positively regulates tip growth by maintaining tip-focused vesicle secretion and filamentous-actin integrity. |
| AT3G45590 | Encodes a catalytic subunit of tRNA splicing endonuclease. |
| AT5G63670 | Transcription elongation factor SPT4 homolog 2. T-DNA mutant is more susceptible to the biotroph Hpa. |
| AT2G22830 | squalene epoxidase 2;(source:Araport11) |
| AT2G47070 | member of SPL gene family, encodes DNA binding proteins and putative transcription factors. All have the SBP-box, which encodes the SBP-domain, required for and sufficient for interaction with DNA. |
| AT3G57920 | Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase transition. Expression is regulated by MIR156b. |
| AT5G43270 | Member of the SPL (squamosa-promoter binding protein-like) gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. In conjunction with SPL10 and SPL11, SPL2 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. |
| AT3G15270 | Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR. |
| AT4G03430 | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
| AT1G11720 | Encodes a starch synthase that in addition to its role in starch biosynthesis also has a negative regulatory function in the biosynthesis of transient starch. The protein apparently contains a starch-binding domain (SBD). |
| AT5G19690 | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions The mRNA is cell-to-cell mobile. |
| AT1G34130 | Encodes homolog of yeast STT3, a subunit of oligosaccharyltransferase. |
| AT3G07020 | encodes a 3beta-hydroxy sterol UDP-glucosyltransferase. ugt80a2 mutant plants have reduced steryl glycoside and acyl steryl glycoside levels and reduced seed size. ugt80a2/b1 double mutants have normal levels of celluose and normal cold stress tolerance. |
| AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
| AT4G13266 | PGG domain containing transmembrane protein.Functions in the stigma to prevent interspecies pollen from forming pollen tubes. |
| AT3G48860 | coiled-coil protein;(source:Araport11) |
| AT3G57480 | SAP1 is a protein of unknown function whose expression is responsive to abiotic stressors including metals, salt, and ABA. Over expression confers increased tolerance to a variety of abiotic stressors. |
| AT4G34190 | Encodes a stress enhanced protein that localizes to the thylakoid membrane and whose mRNA is upregulated in response to high light intensity. It may be involved in chlorophyll binding. |
| AT1G51850 | Malectin-like receptor-like kinase involved in MAMP mediated stomatal immunity. Interacts with BAK1/FLS2 signaling complex and subsequently phosphorylates and activates SLAC1. |
| AT1G51805 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G25380 | stress-associated protein 10;(source:Araport11) |
| AT1G74000 | encodes a protein similar to strictosidine synthase, which is involved in the production of monoterpene indole alkaloids. This gene belongs to a family of 13 members in Arabidopsis. |
| AT4G08390 | Encodes a chloroplastic stromal ascorbate peroxidase sAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The mRNA is cell-to-cell mobile. |
| AT1G78980 | STRUBBELIG-receptor family 5;(source:Araport11) |
| AT5G48600 | member of SMC subfamily |
| AT5G07660 | Encodes SMC6A (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6A), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
| AT1G68830 | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation. STN7 is involved in state transitions. |
| AT2G22740 | Encodes a SU(VAR)3-9 homolog, a methyltransferase involved in histone methylation. The protein was shown to bind to methylated cytosines of CG, CNG and CNN motifs but has a preference for the latter two. This is a member of a subfamily of SET proteins that shares a conserved SRA domain. |
| AT5G51750 | subtilase 1.3;(source:Araport11) |
| AT4G21650 | Subtilase family protein;(source:Araport11) |
| AT4G10540 | Proteolytic enzyme of that phytaspase family which at pH 5.5 is strictly Asp-specific. Strongly preferred cleavage motifs are YVAD and IETD. |
| AT5G59090 | subtilase 4.12;(source:Araport11) |
| AT1G71950 | SPI-1 is a member of the I9 inhibitor family. It is an inhibitor of SBT4.13 subtilase. |
| AT2G39851 | Proteinase inhibitor, propeptide;(source:Araport11) |
| AT3G10380 | Subunit of the Putative Arabidopsis Exocyst Complex |
| AT2G18450 | Nuclear encoded mitochondrial flavoprotein subunit of succinate dehydrogenase complex . |
| AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile. |
| AT5G20280 | Encodes a sucrose-phosphate synthase activity. This is the major leaf isoform. |
| AT5G20830 | Encodes a protein with sucrose synthase activity (SUS1). |
| AT2G02860 | encodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding. |
| AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
| AT1G22710 | Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage. |
| AT3G19940 | Encodes a hexose-H(+) symporter that catalyzes the high-affinity uptake of glucose, galactose and mannose that is induced under low-glucose conditions in pollen tubes. |
| AT5G26250 | Sugar transporter expressed strongly in pollen and pollen tubes. |
| AT1G11260 | Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile. |
| AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
| AT3G51895 | Encodes a chloroplast-localized sulfate transporter. |
| AT3G15990 | Vascular cambium-localized sulfate transporter, mediates xylem-to-phloem transfer of phosphorus. 2 for its preferential distribution |
| AT5G19600 | Encodes sulfate transporter Sultr3;5. |
| AT5G13550 | Encodes a sulfate transporter. |
| AT3G01910 | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT5G04590 | A.thaliana gene encoding sulfite reductase. |
| AT5G01220 | Encodes a UDP-sulfoquinovose:DAG sulfoquinovosyltransferase that is involved in sulfolipid biosynthesis and whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
| AT1G13430 | Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiements show that this enzyme does not act brassinosteroids. ST4C is expressed in the roots and transcript levels rise in response to cytokinin treatment. |
| AT1G04770 | SDI2 is a member of a small family of TPR proteins in Arabidopsis. Like SDI1 it is induced by low sulfer and appears to play a role in negative regulation of glucosinolate biosynthesis. |
| AT4G08620 | Encodes a high-af?nity sulfate transporter. Contains STAS domain. Expressed in roots and guard cells. Up-regulated by sulfur deficiency. |
| AT2G03760 | Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens. |
| AT5G48850 | Homologous to the wheat sulphate deficiency-induced gene sdi1. Expression in root and leaf is induced by sulfur starvation. Knockout mutants retained higher root and leaf sulfate concentrations, indicating a role in regulation of stored sulfate pools. |
| AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
| AT4G33620 | Encodes a SUMO protease that, along with ASP1,is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
| AT4G24940 | Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein. |
| AT2G21470 | Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein. |
| AT4G23950 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins. It is involved in early seed development and nuclear morphology. |
| AT2G20610 | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis. Induced in epidermal cells attacked by powdery mildew. The RTY enzyme is expected to function as a dimer (or a higher order multimeric complex), as all RTY-related enzymes with a defined crystal structure are known to form dimers or tetramers. |
| AT3G54230 | Encodes a splicing factor SUA (suppressor of abi3-5), homologous to the human protein RBM5. Controls alternative splicing of the developmental regulator ABI3. |
| AT5G66020 | Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13. |
| AT1G17340 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT3G59770 | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. |
| AT4G22305 | Encodes SOBER1, a carboxylesterase that inhibits AvrBsT-triggered phenotypes in Arabidopsis. SOBER1 was formerly linked to AT4G22300 but this locus was split in the TAIR10 annotation into AT4G22300 and AT4G22305. AT4G22300 is now known as TIPSY1 and AT4G22305 corresponds to SOBER1. |
| AT2G31880 | Encodes a putative leucine rich repeat transmembrane protein that is expressed in response to Pseudomonas syringae. Expression of SRRLK may be required for silencing via lsiRNAs. Regulates cell death and innate immunity. |
| AT1G79820 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G25580 | Encodes suppressor of gamma response 1 (SOG1), a putative transcription factor governing multiple responses to DNA damage. |
| AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
| AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile. |
| AT1G12280 | Encodes a NB-LRR protein SUMM2 involved in defense response to bacterium. |
| AT1G21580 | Encodes a zinc-finger protein that co-localizes with the exosome-associated RNA helicase HEN2 and functions as a co-factor of nuclear RNA quality control by the nucleoplasmic exosome. |
| AT5G25440 | Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain. |
| AT2G45070 | Sec61 Beta Subunit |
| AT5G63020 | Nucleotide binding leucine rich repeat protein of the C-NB-LRR (CNL) type. Involved in TOPP4 mediated immune response. |
| AT1G31760 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT5G05490 | Encodes a RAD21-like gene essential for meiosis. Encodes a 627 a.a. protein that is slightly longer in the N-terminus than SYN1 BP5. |
| AT1G08560 | member of SYP11 syntaxin Gene Family |
| AT2G18260 | member of SYP11 Gene Family |
| AT3G11820 | Encodes a syntaxin localized at the plasma membrane. SYR1/PEN1 is a member of the SNARE superfamily and functions in positioning anchoring of the KAT1 K+ channel protein at the plasma membrane. Transcription is upregulated by abscisic acid, suggesting a role in ABA signaling. Also functions in non-host resistance against barley powdery mildew. It is a nonessential component of the preinvasive resistance against Colletotrichum fungus. Required for mlo resistance. The syp121 point mutation results in stomatal phenotypes that reduce CO2 assimilation, slow vegetative growth and increase water use efficiency in the whole plant, conditional upon high light intensities and low relative humidity. The R20R21 motif of SYP121 are essential for SEC11 interaction. Mutation of the R20R21 motif blocks vesicle traffic without uncoupling the effects of SYP121 on solute and K+ uptake associated with the F9xRF motif; the mutation also mimicks the effects on traffic block observed on coexpression of the dominant negative SEC11?149 fragment. |
| AT3G52400 | syntaxin protein, involved in the negative regulation of defense pathways such as programmed cell death, salicylic acid signalling pathway, jasmonic acid signalling pathway |
| AT1G11250 | member of SYP12 Gene Family |
| AT3G03800 | member of SYP13 Gene Family |
| AT4G02195 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP43, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
| AT3G05710 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP42, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
| AT3G09740 | syntaxin of plants 71 (SYP71) |
| AT3G61450 | syntaxin of plants 73 (SYP73) |
| AT5G12850 | CCCH-type zinc finger protein with ARM repeat domain-containing protein;(source:Araport11) |
| AT5G43630 | Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile. |
| AT4G24972 | Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1. |
| AT5G44510 | Encodes TAO1 (Target of AvrB Operation), a TIR-NB-LRR protein that contributes to disease resistance induced by the Pseudomonas syringae effector AvrB. |
| AT5G60120 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY1 and CRY2 during flowering as part of a regulatory circuit including FT and CO. TOE1/TOE2 are also targets of MiR172b repression and functions in regulation of innate immunity via repression of FLS. |
| AT4G34400 | B3-type transcription factor, which promotes floral transition and is repressed by FLC/SVP and promoted by SOC1. |
| AT1G50030 | Related to TOR proteins from yeast and mammals, regulators of cell growth in response to nutrient availability. TOR proteins belong to the family of phosphatidylinositol 3-kinase and are targets of the antiproliferative drug rapamycin. AtTOR binds the yeast FKBP12 protein in the presence of Rapamycin, is involved in embryogenesis and is expressed in embryos, endosperm and meristems. Participates in negatively modulating ethylene signals and the molecular mechanism is likely involved in the regulation of ethylene biosynthesis by affecting ACSs in transcription and protein levels |
| AT3G13445 | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex |
| AT1G04950 | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT2G20562 | Encodes a putative signalling peptide with similarity to TAX1. No known function has been demonstrated yet. |
| AT5G43130 | TBP-associated factor 4;(source:Araport11) |
| AT1G54360 | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
| AT5G08330 | Circadian oscillator protein which interacts with bZIP63 and regulates a response of the circadian oscillator to sugar. Is not required for the sugar-induced circadian phase advance in the morning; regulates a response of CCA1 to sugars. |
| AT1G72010 | Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT1G29010 | verprolin;(source:Araport11) |
| AT5G16850 | Encodes the catalytic subunit of telomerase reverse transcriptase. Involved in telomere homeostasis. Homozygous double mutants with ATR show gross morphological defects over a period of generations. TERT shows Class II telomerase activity in vitro, indicating that it can initiate de novo telomerase synthesis on non-telomeric DNA, often using a preferred position within the telomerase-bound RNA. Loss of function mutants have reduced telomere length in roots and over a period of generations, decreasing root meristem function. |
| AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
| AT3G27010 | Belongs to a TCP protein transcription factor family. Members of this family contain a predicted basic-helix-loop-helix domain involved in DNA binding. Related to rice PCF1 and PCF2 genes. Binds to the GCCCR element of CYCB1;1. Involved in regulation of expression of cell cycle control and ribosomal protein genes. |
| AT1G67770 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL2 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. Expression patterns were similar to TEL1, with lower expression levels in most tissues examined. |
| AT4G14770 | Regulates fate transition and cell Divisions in the stomatal lineage. |
| AT5G23030 | Member of TETRASPANIN family |
| AT2G03840 | TET13 encodes a member of the TETRASPANIN gene family that is expressed in the hypophysis, QC, root stem cells, lateral root primordia and is involved in primary root growth and lateral root development. |
| AT2G01960 | Member of TETRASPANIN family |
| AT5G60220 | Member of TETRASPANIN family |
| AT3G43210 | Encodes a kinesin TETRASPORE. Required for cytokinesis in pollen. In mutants, all four microspore nuclei remain within the same cytoplasm after meiosis. |
| AT3G17880 | Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. |
| AT1G78120 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT2G42580 | Encodes a member of the TTL family and contains a thioredoxin like domain and three tandom TPRs. Interacts physically with BRL2/VH1 and appears to play a role in brassiosteroid and auxin signaling. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
| AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
| AT1G08320 | bZIP transcription factor family protein;(source:Araport11) |
| AT3G12250 | basic leucine zipper transcription factor involved in the activation of SA-responsive genes. |
| AT5G54380 | Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT1G02880 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
| AT1G22940 | Encodes a bifunctional enzyme required for thiamine (vitamin B1) biosynthesis. TH1 can phosphorylate HMP-P to produce HMP-PP, the pyrimidine heterocyclic subunit of thiamine. TH1 also catalyzes the condensation of HMP-PP and HET to form thiamine monophosphate (TMP). TH1 also appears capable of phosphorylating HMP based on E.coli mutant complementation assays. th1 mutants are thiamine auxotrophs that die as seedlings on unsupplemented media. |
| AT5G10540 | Zincin-like metalloproteases family protein;(source:Araport11) |
| AT5G39950 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
| AT2G18990 | thioredoxin-like/ATP-binding protein;(source:Araport11) |
| AT1G45145 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
| AT1G69880 | thioredoxin H-type 8;(source:Araport11) |
| AT3G08710 | Associated to plasma membrane. Moves cell to cell, suggesting a role in intercellular communication. The redox reaction between oxidized AtGPX3 and reduced AtTRXh9 is realized through the forming and breaking of disulfide bonds via the active sites of Cys4 and Cys57 in AtTRXh9. |
| AT2G35010 | Localized in mitochondria; associated with redox-active functions and effects on plant growth in constant light; joint role with Trx h2 in regulating NADPH redox balance and photosynthetic performance in fluctuating light. |
| AT1G76760 | Encodes a y-type thioredoxin (Trx-y1) localized in chloroplast stroma. |
| AT1G65980 | thioredoxin-dependent peroxidase |
| AT2G30440 | Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile. |
| AT4G27800 | Choroplast protein phosphatase TAP38/PPH1 is required for efficient dephosphorylation of the LHCII anthena and state transition from state 2 to state 1. |
| AT5G23070 | Encodes a thymidine kinase that salvages DNA precursors. The pyrimidine salvage pathway is crucial for chloroplast development and genome replication, as well as for the maintenance of its integrity. |
| AT4G32570 | TIFY domain protein 8;(source:Araport11) |
| AT5G25810 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family (TINY). The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic or overexpression of this gene in a Ds tagged line has reduced cell expansion. The expression of this gene is induced by ethylene and light and appears to stimulate cytokinin biosynthesis. |
| AT5G20350 | Encodes a protein containing ankyrin and DHHC-CRD domain. Acts to restrict the size of the swelling that forms at the beginning of root hair cell growth, possibly by a mechanism that requires RHD1. Mutant displays defects in both root hair and pollen tube growth. The mRNA is cell-to-cell mobile. |
| AT5G44920 | Encodes a KASH domain protein that localizes to the nuclear envelope and affects nuclear morphology. |
| AT1G72950 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT5G48780 | disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT1G66090 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT1G72870 | TIR-NBS gene. |
| AT1G72890 | NBS TIR protein. |
| AT1G72910 | Nucleotide-binding, leucine-rich repeat (NLR) gene regulated by nonsense-mediated mRNA decay (NMD) genes UPF1 and UPF3. |
| AT2G27170 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
| AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
| AT5G16880 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT1G21380 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT1G76970 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT4G23020 | hypothetical protein;(source:Araport11) |
| AT2G20240 | GPI-anchored adhesin-like protein, putative (DUF3741);(source:Araport11) |
| AT5G43880 | methyl-coenzyme M reductase II subunit gamma, putative (DUF3741);(source:Araport11) |
| AT4G25430 | hypothetical protein;(source:Araport11) |
| AT1G18620 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
| AT1G74160 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
| AT5G26910 | Encodes a member of the TRM superfamily, that plays a role in preprophase band formation during plant cell division and controls the robustness of the orientation of that cell division. |
| AT4G00770 | DUF4378 domain protein;(source:Araport11) |
| AT3G26520 | gamma tonoplast intrinsic protein 2 (TIP2). expressed throughout the plant and transcript level is increased upon NaCl or ABA treatments. NaCl stress-sensitive yeast mutant strains exhibit more resistance to salt when expressing this protein. |
| AT1G80490 | Encodes a protein with a Lissen-cephaly type-1-like homology (LisH) domain at the N terminus,a C-terminal to LisH (CTLH) domain, and 12 WD (tryptophan-aspartic acid)-40 repeats at the C terminus. It is closely related to Topless (TPL), which mediates auxin-dependent transcriptional repression during embryogenesis. |
| AT3G23890 | Encodes a topoisomerase II that is highly expressed in young seedlings. The protein is localized in the nucleus and gene expression levels are increased in proliferative tissues. |
| AT5G46700 | Encodes a transmembrane protein of the tetraspanin (TET) family, one of 17 members found in Arabidopsis. Double mutant analysis showed that TRN1 and TRN2 act in the same pathway. Required for the maintenance of both the radial pattern of tissue differentiation in the root and for the subsequent circumferential pattern within the epidermis. |
| AT5G37770 | Encodes a protein with 40% similarity to calmodulin. Binds Ca(2+) and, as a consequence, undergoes conformational changes. CML24 expression occurs in all major organs, and transcript levels are increased from 2- to 15-fold in plants subjected to touch, darkness, heat, cold, hydrogen peroxide, abscisic acid (ABA), and indole-3-acetic acid. However, CML24 protein accumulation changes were not detectable. The putative CML24 regulatory region confers reporter expression at sites of predicted mechanical stress; in regions undergoing growth; in vascular tissues and various floral organs; and in stomata, trichomes, and hydathodes. CML24-underexpressing transgenics are resistant to ABA inhibition of germination and seedling growth, are defective in long-day induction of flowering, and have enhanced tolerance to CoCl(2), molybdic acid, ZnSO(4), and MgCl(2). Also regulates nitric oxide levels. |
| AT5G55860 | WEB1/PMI2 related protein involved in mecahnotransduction.TREPH1 is phosphorylated at position S625 in response to touch, and this is required for mechanosensitive growth response. |
| AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
| AT3G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G73020 | anoctamin-like protein;(source:Araport11) |
| AT2G39675 | Trans-acting siRNA1c primary transcript (TAS1c). Gb: AY922999 |
| AT3G23230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT5G43970 | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion. |
| AT2G29530 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. Together with AtTIM9, AtTIM10 is non-redundantly essential for maintaining mitochondrial function of early embryo proper cells and endosperm free-nuclei. |
| AT4G23430 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G02510 | An integral membrane GTPase that functions as a transit-sequence receptor required for the import of proteins necessary for chloroplast biogenesis. Located in the outer chloroplast membrane. Phosphorylation of the G-domains regulate translocon assembly. The mRNA is cell-to-cell mobile. |
| AT3G17970 | Integral chloroplast outer membrane protein. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G09420 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G36060 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.Overexpression results in increased drought tolerance and vitrified leaves. Binds to DRE/GCC promoter elements and activates expression of aquaporin genes AtTIP1;1, AtTIP2;3, and AtPIP2;2. |
| AT3G24660 | member of Receptor kinase-like protein family |
| AT1G55130 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. |
| AT3G13772 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. Overexpression of this protein in yeast alters copper and zinc homeostasis. |
| AT5G48100 | Encodes a protein that is similar to laccase-like polyphenol oxidases. Involved in lignin and flavonoids biosynthesis. It has four conserved copper binding domains. Expressed in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Mutant plants exhibited a delay in developmentally determined browning of the testa, characterized by the pale brown color of seed coat. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds. |
| AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
| AT5G35550 | TT2 encodes a R2R3 MYB domain putative transcription factor that acts as a key determinant in the proanthocyanidin accumulation of developing seed. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. |
| AT5G07990 | Required for flavonoid 3' hydroxylase activity. Enzyme abundance relative to CHS determines Quercetin/Kaempferol metabolite ratio. The mRNA is cell-to-cell mobile. |
| AT4G09820 | TT8 is a regulation factor that acts in a concerted action with TT1, PAP1 and TTG1 on the regulation of flavonoid pathways, namely proanthocyanidin and anthocyanin biosynthesis. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Also important for important for marginal trichome development. It binds the promoter of both AT3G26790 and AT1G28300.TT8 interacts with JAZ proteins to regulate anthocyanin accumulation. TT8 acts maternally to affect seed FA biosynthesis and inhibits seed FA accumulation by down-regulating a group of genes either critical to embryonic development or important in the FA biosynthesis pathway. TT8 represses the activities of LEAFY COTYLEDON1, LEAFY COTYLEDON2, and FUSCA3, the critical transcriptional factors important for seed development. |
| AT3G28430 | Encodes a peripheral membrane protein localized at the Golgi apparatus that is involved in membrane trafficking, vacuole development and in flavonoid accumulation in the seed coat. Mutant seed color is pale brown. |
| AT5G24520 | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. Auxin and ethylene responsiveness of TTG1 transcription is lost in myb12 mutants. |
| AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
| AT5G58220 | Encodes a transthyretin-like S-allantoin synthase protein that catalyzes two steps in the allantoin biosynthesis pathway by acting as a hydroxyisourate hydrolase and a 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline (OHCU) decarboxylase. Two alternatively spliced versions of the transcript give rise to a longer peroxisomally-targeted protein (AT5G58220.1 (called TTL1-)) and a slightly shorter cytoplasmic protein (AT5G58220.3 (called TTL2-)). Both have roughly equivalent enzymatic activity in vitro, but, allantoin biosynthesis is believed to occur in the peroxisome suggesting that the cytosolic form may participate in a different process. |
| AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
| AT1G70290 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT1G35910 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G65140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G46590 | Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers. |
| AT5G03780 | Encodes a protein whose sequence is similar to human telomere proteins. This belongs to TRFL family 2, which do not show DNA binding in vitro. |
| AT2G19450 | Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA). |
| AT2G37720 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G60790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G15890 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G70230 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G40150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G11030 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be observed only in double or triple mutant combinations with esk1. |
| AT5G01620 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL35 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. The biochemical phenotype can be observed in tbl35 esk1, double mutant and tbl34 tbl35 esk1 triple mutants. |
| AT2G34070 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA. |
| AT1G78710 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G48880 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G27695 | TGD5 encodes a small glycine rich protein that is localized to the chloroplast envelope and is a component of the ER to plastid lipid trafficking pathway. TGD5 interacts with other components of this pathway including TGD1, TGD2, TGD3, and TGD4. |
| AT1G45231 | Encodes a trimethylguanosine synthase that is required for chilling tolerance. tgs1 mutant have a striking chilling sensitive phenotype in which leaf and flower development are dramatically disrupted after long-term chilling treatment. |
| AT4G20850 | Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant. |
| AT1G05830 | Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1. |
| AT1G78190 | Trm112p-like protein;(source:Araport11) |
| AT4G01880 | methyltransferase;(source:Araport11) |
| AT3G21300 | RNA methyltransferase family protein;(source:Araport11) |
| AT2G28450 | zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT4G17610 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT4G04670 | Met-10+ like family protein / kelch repeat-containing protein;(source:Araport11) |
| AT3G16260 | Encodes a tRNase Z. The mRNA is cell-to-cell mobile. |
| AT2G43510 | Member of the defensin-like (DEFL) family. Encodes putative trypsin inhibitor protein which may function in defense against herbivory. |
| AT1G34060 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT2G36960 | Arabidopsis thaliana myb/SANT domain protein |
| AT1G76900 | Member of plant TLP family. Contains terminal F-box domain, interacts with ASK proteins. Tethered to the PM. |
| AT5G18680 | Member of TLP family of tubby like proteins that also contain an F-Box. Localized to the plasma membrane. |
| AT1G53320 | Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain. |
| AT4G14960 | Encodes an alpha-tubulin isoform required for right handed helical growth. |
| AT5G61780 | Involved in the regulation of AtGA20ox3 expression, as well as seed germination. The mRNA is cell-to-cell mobile. |
| AT3G21640 | encodes a 42 kDa FK506-binding protein (AtFKBP42) that possesses similarity to multidomain peptidyl-prolyl cis/trans isomerases (PPIases, EC 5.2.1.8), which are known to be components of mammalian steroid hormone receptor complexes. The protein appears to be localized to the plasma membrane by electron microscopy and binds to HSP90.1 and calmodulin in vitro. It also aggregates citrate synthase in vitro but does NOT show PPIase activity in vivo. Mutants are reduced in size and exhibit disoriented growth in all organs. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT4G03560 | Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress. |
| AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
| AT2G29400 | Type 1 protein phosphatase, expressed in roots, rosettes and flowers |
| AT3G05580 | Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with TOPP8 (AT5G27840). |
| AT5G59160 | Encodes the catalytic subunit of a Type 1 phosphoprotein Ser/Thr phosphatase, expressed in roots, shoots and flowers. |
| AT5G36160 | Encodes a cytosolic L-tyrosine aminotransferase. AtTAT2 exhibits much broader amino donor specificity than AtTAT1 and can use not only Tyr but also Phe, Trp, His, Met, Leu, Ala, Ser, Cys, Asp, Asn, Gln, and Arg as amino donors. |
| AT2G24850 | Encodes a tyrosine aminotransferase that is responsive to treatment with jasmonic acid. |
| AT1G08030 | Encodes a tyrosylprotein sulfotransferase (TPST). This protein is a 500-aa type I transmembrane protein that shows no sequence similarity to animal TPSTs. Activity confirmed by protein expression in yeast. TPST is expressed throughout the plant body, and the highest levels of expression are in the root apical meristem. TPST acts in the auxin pathway to maintain postembryonic root stem cell niche by defining the expression of the PLETHORA stem cell transcription factor genes. A loss-of-function mutant TPST displayed a marked dwarf phenotype accompanied by stunted roots, pale green leaves, reduction in higher order veins, early senescence, and a reduced number of flowers and siliques. TPST suppresses ethylene production through the action of PSK (phytosulfokine). |
| AT1G09760 | U2 small nuclear ribonucleoprotein A;(source:Araport11) |
| AT3G57645 | U2-2;(source:Araport11) |
| AT1G60220 | Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sGFP:OTS1 protein accumulates in the nucleus. Double mutant analysis with ULP1C/OTS2 indicates that these genes are involved in salt stress responses and flowering time regulation. Over-expression of 35S:OTS1 increases salt tolerance and reduces the level of SUMO-conjugated proteins. OTS1 transcript levels do not appear to change in response to salt, but, salt stress reduces the level of OTS1 protein in a proteasome-dependent manner. |
| AT2G35635 | encodes a ubiquitin-like protein that contains tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. The mRNA is cell-to-cell mobile. |
| AT3G09790 | encodes a ubiquitin-like protein that contains tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. |
| AT4G17510 | ubiquitin C-terminal hydrolase 3;(source:Araport11) |
| AT5G66240 | Encodes a WD40-repeat protein that interacts with the E3 Cullin Ring Ligase subunit DDB1a and is involved in secondary wall modification and thickening by regulating the degradation of specific proteins. RNAi-mediated silencing results in anther indehiscence and infertility. |
| AT3G08700 | ubiquitin-conjugating enzyme 12;(source:Araport11) |
| AT1G50490 | Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in diving cells, but also in other non-dividing cells. |
| AT3G15355 | ubiquitin-conjugating enzyme 25;(source:Araport11) |
| AT5G50430 | ubiquitin-conjugating enzyme 33;(source:Araport11) |
| AT3G45180 | Ubiquitin like protein that appears to play a role in pre-mRNA splicing. |
| AT5G02880 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT1G32850 | ubiquitin-specific protease 11;(source:Araport11) |
| AT4G17895 | Encodes a ubiquitin-specific protease. |
| AT3G21280 | Encodes a ubiquitin-specific protease. |
| AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
| AT5G03490 | Encodes a dihydroxybenzoic acid (DHBA) glycosyltransferase. The Col-0 enzyme is responsible for biosynthesis of 2,3-DHBA xyloside and 2,5-DHBA xyloside. The Col-0 enzyme is specific for UDP-xylose and the C24 enzyme uses both UDP-glucose and UDP-xylose. This difference in sugar donor specificity was shown to be largely due to a single amino acid change between the two isoforms. |
| AT1G63180 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development. |
| AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
| AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
| AT3G11340 | Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid. |
| AT4G23010 | UDP-galactose transporter 2;(source:Araport11) |
| AT1G14360 | UDP-galactose transporter 3;(source:Araport11) |
| AT4G31600 | Encodes a Golgi-localized UDP?glucose/UDP?galactose transporter that affects lateral root emergence. |
| AT3G29360 | Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides. |
| AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
| AT5G17310 | UDP-glucose pyrophosphorylase 2;(source:Araport11) |
| AT2G29750 | UDP-glucosyl transferase 71C1;(source:Araport11) |
| AT2G29730 | UDP-glucosyl transferase 71D1;(source:Araport11) |
| AT1G01420 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G50740 | UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism. |
| AT2G15480 | UDP-glucosyl transferase 73B5;(source:Araport11) |
| AT2G36790 | The At2g36790 gene encodes a UDP-glucose:flavonol-3-O-glycoside-7-O-glucosyltransferase (UGT73C6)attaching a glucosyl residue to the 7-O-position of the flavonols kaempferol, quercetin and their 3-O-glycoside derivatives. |
| AT3G53150 | UDP-glucosyl transferase 73D1;(source:Araport11) |
| AT2G31750 | Encodes an auxin glycosyltransferase that is likely to be involved in regulation of auxin by glycosylation. |
| AT2G26480 | UDP-glucosyl transferase 76D1;(source:Araport11) |
| AT5G59580 | UDP-glucosyl transferase 76E1;(source:Araport11) |
| AT5G59590 | UDP-glucosyl transferase 76E2;(source:Araport11) |
| AT3G21560 | Encodes a protein with sinapic acid:UDP-glucose glucosyltransferase activity. Mutants defective in this gene are hyper-fluorescent (which accumulate in their trichomes a compound that is likely to be 3',5'-dimethoxynaringenin chalcone or sinapoyltriacetic acid lactone, potential products of the concerted action of 4-coumarate CoA ligase and chalcone synthase on sinapic acid). Also shown to be required for Arabidopsis nonhost resistance to the Asian soybean rust pathogen Phakopsora pachyrhizi. |
| AT3G16520 | UDP-glucosyl transferase 88A1;(source:Araport11) |
| AT4G34135 | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position. |
| AT5G59290 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT3G55700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G21070 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G42420 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G05820 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT2G28760 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. |
| AT1G06890 | UXT3 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and functions as a UDP-Xyl transporter. |
| AT4G02500 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile. |
| AT4G37180 | UIF1 is a nuclear and cytoplasmically localized myb-domain containing member of the GARP G2-like subfamily of transcription factors. Interacts with ULT1 and binds to the WUS promoter. UIF1 binding domains are also found in CUC and AG promoters suggesting they are also direct targets. This locus was also identified as a putative cytoskeletal protein in a yeast screen. |
| AT5G41150 | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT1G14140 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT2G22500 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). |
| AT1G33430 | UPEX1 is arabinogalactan b-(1,3)-galactosyltransferase involved in the formation of pollen exine. Belongs to GT31 family. Mutants have reduced levels of AGPs. GALT8 has some but not complete functional overlap with KNS4/UPEX1. |
| AT1G29300 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
| AT4G26330 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT1G49320 | Encodes USPL1, a BURP domain protein targeted to the protein storage vacuoles. Overexpression of USPL1 affects seed development, protein storage vacuoles and lipid vesicles morphology and function. |
| AT2G20100 | Together with PFA1 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G30950 | Required for the proper identity of the floral meristem. Involved in establishing the whorled pattern of floral organs, in the control of specification of the floral meristem, and in the activation of APETALA3 and PISTILLATA. UFO is found at the AP3 promoter in a LFY-dependent manner, suggesting that it works with LFY to regulate AP3 expression. UFO may also promote the ubiquitylation of LFY. |
| AT5G43580 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Functions in resistance to necrotrophic fungi and insect herbivory. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
| AT2G26230 | Encodes a urate oxidase that is involved in peroxisome maintenance. |
| AT1G67550 | Encodes a nickel-containing urea hydrolase involved in nitrogen recycling. It requires three urease accessory proteins for its activation. The mRNA is cell-to-cell mobile. |
| AT2G35035 | Encodes a urease accessory protein which is essential for the activation of plant urease. |
| AT2G03590 | Encodes a member of a class of allantoin transporters. |
| AT1G26440 | Encodes a ureide permease, uptake assays in yeast mutants indicated the longer splice variant is a cellular importer for allantoin, uracil and xanthine. Encodes 2 splice variants, UPS5L and UPS5S, which under nonstress conditions may function in allantoin degradation for nutrient recycling, whereas under stress, both genes may be involved in vesicular export allowing allantoin translocation from roots to shoots. |
| AT3G27190 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT2G36310 | Encodes a cytoplasmic nucleoside hydrolase. It has the highest levels of activity with uridine followed by xanthosine. It shows little activity with inosine and none with cytidine. Mutant analyses indicate that it plays a role in purine and pyrimidine catabolism. |
| AT2G37450 | nodulin MtN21-like transporter family protein |
| AT5G13670 | nodulin MtN21-like transporter family protein |
| AT1G21890 | nodulin MtN21-like transporter family protein |
| AT1G25270 | nodulin MtN21-like transporter family protein |
| AT3G30340 | nodulin MtN21-like transporter family protein |
| AT5G40230 | nodulin MtN21-like transporter family protein |
| AT5G40240 | nodulin MtN21-like transporter family protein |
| AT5G40210 | nodulin MtN21-like transporter family protein |
| AT2G45620 | Nucleotidyltransferase family protein involved in transcript polyadenylation. TUTase which connects decapping activators and prevents the accumulation of excessively deadenylated mRNAs to avoid siRNA biogenesis. |
| AT3G15620 | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
| AT2G42260 | Encodes a novel plant-specific protein of unknown function. The UVI4 gene is expressed mainly in actively dividing cells. The hypocotyl cells in mutant seedlings undergo one extra round of endoreduplication. The uvi4 mutation also promoted the progression of endo-reduplication during leaf development. |
| AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2. |
| AT4G38510 | One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. |
| AT1G20260 | One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. The mRNA is cell-to-cell mobile. |
| AT3G03090 | Encodes a vacuolar membrane-localized glucose transporter that can also transport fructose. Mutations in these gene have effects on seed germination and time to flowering. |
| AT1G78920 | Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves. |
| AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
| AT5G53530 | Homolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. |
| AT1G08190 | Might be involved in protein sorting to the vacuole. The mRNA is cell-to-cell mobile. |
| AT4G39080 | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. The mRNA is cell-to-cell mobile. |
| AT2G34940 | VACUOLAR SORTING RECEPTOR 5;(source:Araport11) |
| AT1G30900 | VACUOLAR SORTING RECEPTOR 6;(source:Araport11) |
| AT4G20110 | VACUOLAR SORTING RECEPTOR 7;(source:Araport11) |
| AT2G38020 | necessary for proper vacuole formation and morphogenesis in Arabidopsis |
| AT3G60600 | Encodes VAP27 (for Vesicle-Associated Protein). VAP27 has high homology to the VAP33 family of SNARE-like proteins from animals. May be involved in vesicular transport to or from the ER. Located exclusively in limiting membrane of protein storage vacuoles. Binds SRC2. |
| AT5G46510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G02120 | Encodes VAD1 (Vascular Associated Death1), a regulator of cell death and defense responses in vascular tissues. VAD1 is a putative membrane associated protein and contains a GRAM domain. vad1 is a lesion mimic mutant that exhibits light conditional appearance of propagative HR (hypersensitive response)-like lesions along the vascular system. The mRNA is cell-to-cell mobile. |
| AT1G79620 | VRLK1 is a LRR kinase involved in switching between cell elongation and secondary cell wall thickening.VRLK1 is a member of a gene family that includes a small number of recently duplicated paralogs. |
| AT5G54790 | CTD small phosphatase-like protein;(source:Araport11) |
| AT5G24780 | encodes an acid phosphatase similar to soybean vegetative storage proteins. Gene expression is induced by wounding and jasmonic acid. |
| AT4G29260 | VSP3 is a secreted acid phosphatase. |
| AT3G24440 | Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM. |
| AT5G57380 | Encodes a plant homeodomain protein VERNALIZATION INSENSITIVE 3 (VIN3). In planta VIN3 and VRN2, VERNALIZATION 2, are part of a large protein complex that can include the polycomb group (PcG) proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE), CURLY LEAF (CLF), and SWINGER (SWN or EZA1). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. |
| AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
| AT2G32670 | member of Synaptobrevin -like protein family |
| AT3G54300 | Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal. |
| AT5G05550 | Encodes trihelix-domain transcription factor VFP5. Interacts with agrobacterium virulence protein VirF. |
| AT1G14000 | Encodes a protein with similarity to members of the C1 subgroup of MAP kinase kinase kinases. Interacts physically with the receptor kinase BRL2/VH1 and appears to be involved in auxin and brassinosteriod signaling. The mRNA is cell-to-cell mobile. |
| AT3G57410 | Encodes a protein with high homology to animal villin. VLN3 is a Ca2+-regulated villin involved in actin filament bundling. |
| AT3G49480 | F-Box Gene regulated by Agrobacterium virulence protein VirD5 and essential for Agrobacterium-mediated plant transformation. |
| AT1G43700 | Encodes a VirE2-interacting protein. VIP1 mediates nuclear translocation of VirE2 via its amino half, and interacts with histone H2A via it carboxyl half. Involved in osmosensory response. The mRNA is cell-to-cell mobile. |
| AT5G28040 | Member of the GeBP/GPL family of leucine zipper transcription factors. VPF4 interacts with the F-box proteins from A.tumefaciens VirF and VBF. Over expression results in decreased tumor formation upon Agrobacterium infection. Mutants show changes in the level of expression of defense response genes. |
| AT5G55120 | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
| AT4G32770 | Tocopherol cyclase involved in tocopherol (vitamin E)synthesis. VTE1 over-expressing plants have increased tocopherol indicating VTE1 is a major limiting factor in tocopherol synthesis. Mutants defective in this gene accumulate high amounts of zeaxanthin in conditions of high light or low temperature. Plays a role in the adaptation to low temperature stress, notably phloem loading. |
| AT3G01280 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile. |
| AT3G18360 | Member of VQ gene family. VQ proteins are named for the VQ motif (FxxxVQxxTG), a conserved amino acid region. Interacts with members of WRKY gene family, involved in pollen development. |
| AT2G44340 | VQ18 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ26, it is involved in negative regulation of ABA responses during early seedling development. |
| AT3G60090 | VQ26 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ18, it is involved in negative regulation of ABA responses during early seedling development. |
| AT1G16260 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G16130 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16150 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile. |
| AT1G16160 | WAK-like kinase The mRNA is cell-to-cell mobile. |
| AT1G16110 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall. |
| AT1G21270 | cytoplasmic serine/threonine protein kinase induced by salicylic acid. mutant plants exhibit a loss of cell expansion and dependence on sugars and salts for seedling growth, affecting the expression and activity of vacuolar invertase. |
| AT1G58070 | WALLIN is an actin binding protein involved in ROP11 mediated xylem pit patterning. |
| AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
| AT5G65683 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT2G41420 | proline-rich family protein;(source:Araport11) |
| AT3G49845 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT1G11060 | Encodes one of two redundant proteins (the other is WAPL2) that are involved in prophase removal of cohesion during meiosis. Double mutants with wapl2 exhibit reduced fertility due to defects in meiosis and also some abnormal embryo development in rare cases where embryos are formed. |
| AT2G34150 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT5G58350 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT2G39900 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
| AT3G55770 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
| AT2G01830 | Histidine kinase: cytokinin-binding receptor that transduces cytokinin signals across the plasma membrane |
| AT5G50200 | Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-independent wound signal transduction. |
| AT4G26455 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
| AT5G11390 | Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells. |
| AT1G55600 | member of WRKY Transcription Factor; Group I. It has WRKY domain at its N terminal end and zinc-finger like motif. |
| AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT1G30650 | member of WRKY Transcription Factor; Group II-e |
| AT2G23320 | Encodes WRKY DNA-binding protein 15 (WRKY15). |
| AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT4G31800 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Constitutive expression of WRKY18 enhanced resistance to P. syringae, but its coexpression with WRKY40 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
| AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
| AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
| AT5G52830 | Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum. |
| AT5G24110 | member of WRKY Transcription Factor; Group III |
| AT4G22070 | member of WRKY Transcription Factor; Group II-b |
| AT2G38470 | Member of the plant WRKY transcription factor family. Regulates the antagonistic relationship between defense pathways mediating responses to P. syringae and necrotrophic fungal pathogens. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. Regulates cytochrome P450 gene CYP94B1 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT2G34830 | member of WRKY Transcription Factor; Group II-e |
| AT1G69810 | member of WRKY Transcription Factor; Group II-b |
| AT1G80840 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Coexpression with WRKY18 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
| AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
| AT5G43290 | member of WRKY Transcription Factor; Group II-c |
| AT5G26170 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
| AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
| AT2G40740 | member of WRKY Transcription Factor; Group III |
| AT3G01080 | member of WRKY Transcription Factor; Group I |
| AT2G25000 | Pathogen-induced transcription factor. Forms protein complexes with itself and with WRKY40. Coexpression with WRKY18 or WRKY40 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. |
| AT5G01900 | member of WRKY Transcription Factor; Group III |
| AT4G24240 | Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family. |
| AT1G29860 | member of WRKY Transcription Factor; Group II-c |
| AT5G15130 | member of WRKY Transcription Factor; Group II-b; contribute to basal immunity. The mRNA is cell-to-cell mobile. |
| AT5G46350 | member of WRKY Transcription Factor; Group II-c |
| AT5G12420 | WSD7 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
| AT1G20710 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
| AT1G46480 | Encodes WOX4, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. This protein also contains an acidic domain approximately 10 residues upstream of the WUS box. Part of the TDIF-TDR-WOX4 signaling pathway that plays a crucial role in the maintenance of the vascular meristem organization during secondary growth. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation. |
| AT4G34890 | Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance. |
| AT4G14365 | hypothetical protein;(source:Araport11) |
| AT5G64530 | xylem NAC domain 1;(source:Araport11) |
| AT5G33290 | Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis. |
| AT4G14130 | xyloglucan endotransglycosylase-related protein (XTR7) |
| AT1G65310 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G13090 | xyloglucan endotransglucosylase/hydrolase 2;(source:Araport11) |
| AT5G48070 | putative xyloglucan endotransglycosylase/hydrolase, expressed primarily in the stele of mature non-elongating regions of both the main and the lateral root. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
| AT1G14720 | member of Glycoside Hydrolase Family 16 |
| AT4G18990 | xyloglucan endotransglucosylase/hydrolase 29;(source:Araport11) |
| AT1G32170 | xyloglucan endotransglycosylase-related protein (XTR4) The mRNA is cell-to-cell mobile. |
| AT2G35610 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
| AT5G17630 | Phosphate translocator family member which resides in the plastid inner envelope membrane. Retrieves excessive pentose phosphates from the extra-plastidial space and makes them available to the plastids. |
| AT4G00180 | YABBY gene family member, likely has transcription factor activity, involved in specifying abaxial cell fate. Along with FIL, involved in patterning of the fruit. GUS reporter gene expression in seedlings is observed in the young leaves and as the leaf matures, expression is restricted to the abaxial tissues of leaves, expression is also observed on either side of the leaf margin in the younger tissues of leaf blades. |
| AT2G26580 | plant-specific transcription factor YABBY family protein;(source:Araport11) |
| AT4G05410 | Encodes a nucleolar protein with seven WD40-repeats that plays a role in embryo sac development and is critical for the correct positioning of the division plane of zygote and the apical cell lineage in Arabidopsis. YAO may act by modulating nucleolar function, such as rRNA biogenesis, during early embryogenesis and gametogenesis. |
| AT3G54380 | SAC3/GANP/Nin1/mts3/eIF-3 p25 family;(source:Araport11) |
| AT5G53550 | YELLOW STRIPE like 3;(source:Araport11) |
| AT5G41000 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT1G65730 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT1G63700 | Member of MEKK subfamily, a component of the stomatal development regulatory pathway. Mutations in this locus result in embryo lethality. |
| AT1G04610 | Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root. |
| AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
| AT1G04180 | YUCCA 9;(source:Araport11) |
| AT5G11320 | Belongs to the YUC gene family. Encodes a predicted flavin monooxygenase. YUC4 is part of a pathway linking auxin biosynthesis and gynoecium development. It is expressed in the stigma and the apical meristem and is ethylene inducible. |
| AT5G43890 | Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype |
| AT5G57360 | Encodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1. |
| AT2G37430 | Encodes a member of the zinc finger family of transcriptional regulators. It is expressed in many root tips, primary roots, cotyledons and hypocotyl. The protein is localized to the nucleus. Overexpression of ZAT11 causes increased root growth and increased sensitivity to nickel ions. The mRNA is cell-to-cell mobile. |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT1G66140 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT2G41940 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G31260 | member of Fe(II) transporter isolog family |
| AT3G20870 | ZIP metal ion transporter family;(source:Araport11) |
| AT2G32270 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. also response to iron deficiency. |
| AT1G05300 | member of Fe(II) transporter isolog family |
| AT5G45105 | zinc transporter 8 precursor;(source:Araport11) |
| AT1G49590 | Encodes a novel nucleic acid-binding protein that is required for both RdDM (RNA-directed DNA methylation) and pre-mRNA splicing. |
| AT5G67450 | Encodes zinc-finger protein. mRNA levels are elevated in response to low temperature, cold temperatures and high salt. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT1G80730 | Encodes a zinc finger protein and is expressed at high levels in the shoot apex, including the apical meristem, developing leaves and the developing vascular system. expression induced three days post germination. T-DNA insertion mutant has a dominant phenotype in leaf initiation. |
| AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT5G59520 | encodes a metal ion transporter whose expression is regulated by copper. |
| AT5G65930 | encodes a novel member of the kinesin superfamily of motor proteins. recessive mutations have reduced number of trichome branches. |