Basic information
Locus name	AT2G47585
Alias	miR164A
Organism	Arabidopsis thaliana
Taxonomic identifier	[NCBI]
Function category	Transcription regulation:MircoRNA
Effect for Senescence	delay
Gene Description	Encodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. Mature sequence: UGGAGAAGCAGGGCACGUGCA
Evidence	Genetic evidence:Transgene and mutant [Ref 1]
References	1: Kim JH, Woo HR, Kim J, Lim PO, Lee IC, Choi SH, Hwang D, Nam HG Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis. Science 2009 Feb 20;323(5917):1053-7
Sequence	AT2G47585.1 | Genomic | mRNA
Mutant information
Mutated 1 Mutant name miR164Aox Mutant/Transgenic transgenic Ecotype Ws Mutagenesis type transgene
Mutated 2 Mutant name mir164a-4 Mutant/Transgenic mutant Ecotype Col-0 Mutagenesis type T-DNA insertion_knock out
Mutated 3 Mutant name mir164abc Mutant/Transgenic mutant Ecotype Col-0 Mutagenesis type cross