|
|
|
|
| smRNA ID |
siR469 |
| Category |
siRNA |
| Stage |
G-to-M |
| Gene ID |
AT2G00000 |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
GTCTGGAGAAGCGTCCTCAGC |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 2.37 |
1.87 |
1.48 |
1.26 |
1.02 |
0.82 |
0.67 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| siRNA | G-to-M | AT1G54100 | AT1G54100.2 | response to endogenous stimulus,response to abiotic stimulus,response to osmotic stress,response to salt stress,oxidation reduction |
|
