Basic information   
GenBank ID HP625676
OrganismWheat (Triticum aestivum)
Taxonomic identifier[NCBI]
Function categoryOthers
Effect for SenescenceUnclear
Gene DescriptionSignificantly higher transcript level (> 1.5 fold) is found in the WT relative to the GPC-RNAi samples (up-regulated during senescence).
EvidenceGenomic evidence:microarray data [Ref 1]
References
1: Cantu D, Pearce SP, Distelfeld A, Christiansen MW, Uauy C, Akhunov E, Fahima T, Dubcovsky J
Effect of the down-regulation of the high Grain Protein Content (GPC) genes on the wheat transcriptome during monocarpic senescence.
BMC Genomics 2011;12:492

SequenceHP625676.1 | mRNA
miRNA Interaction      
Details
target: HP625676.1 
miRNA: tae-miR1135
miRNA: tae-miR1135
mfe: -47.0 kcal/mol 
p-value: 0.000000 

position: 114 
target 5' C                        A  3' 
           UCCGUUCGGAAUUACUUGUCGUAG     
           AGGCAAGCCUUAAUGAACAGCGUC     
miRNA  3'                             5'