Basic information
Locus name	AT5G03340
Organism	Arabidopsis thaliana
Taxonomic identifier	[NCBI]
Function category	Others
Effect for Senescence	unclear
Gene Description	cell division cycle protein 48, putative / CDC48, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Aspartate decarboxylase-like fold (InterPro:IPR009010), Cell division protein 48, CDC48, domain 2 (InterPro:IPR004201), ATPase, AAA-type, VAT, N-terminal (InterPro:IPR003338), ATPase, AAA-type, CDC48 (InterPro:IPR005938); BEST Arabidopsis thaliana protein match is: CDC48 (CELL DIVISION CYCLE 48); ATPase/ identical protein binding (TAIR:AT3G09840.1); Has 44402 Blast hits to 25576 proteins in 1886 species: Archae - 977; Bacteria - 15729; Metazoa - 7172; Fungi - 4080; Plants - 3020; Viruses - 56; Other Eukaryotes - 13368 (source: NCBI BLink).
Evidence	Genomic evidence:microarray data [Ref 1]
References	1: Breeze E, Harrison E, McHattie S, Hughes L, Hickman R, Hill C, Kiddle S, Kim YS, Penfold CA, Jenkins D, Zhang C, Morris K, Jenner C, Jackson S, Thomas B, Tabrett A, Legaie R, Moore JD, Wild DL, Ott S, Rand D, Beynon J, Denby K, Mead A, Buchanan-Wollaston High-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation. Plant Cell 2011 Mar;23(3):873-94
Gene Ontology	molecular function ATP binding nucleotide binding
Sequence	AT5G03340.1 | Genomic | mRNA | CDS | Protein
miRNA Interaction
Details	target: AT5G03340.1  miRNA: ath-miR5658 miRNA: ath-miR5658 mfe: -35.7 kcal/mol  p-value: 0.000092  position: 1  target 5' A                    C  3'             UUCAUCAUCAUCAUCAUCAU                 AAGUAGUAGUAGUAGUAGUA      miRNA  3' A                       5'
Ortholog Group
Ortholog Groups: OG5_126926	Accession Taxon NP_187595 Arabidopsis thaliana NP_190891 Arabidopsis thaliana NP_568114 ( AT5G03340 ) Arabidopsis thaliana CML023C Cyanidioschyzon merolae strain 10D 134171 Chlamydomonas reinhardtii NP_113208 Guillardia theta ACO68420 Micromonas sp. RCC299 NP_001048987 Oryza sativa Japonica Group NP_001061798 Oryza sativa Japonica Group e_gw1.01.00.70.1 Ostreococcus tauri e_gw1.217.6.1 Physcomitrella patens subsp. patens estExt_fgenesh1_kg.C_2960002 Physcomitrella patens subsp. patens estExt_fgenesh1_pg.C_1330006 Physcomitrella patens subsp. patens estExt_fgenesh1_pm.C_2130006 Physcomitrella patens subsp. patens estExt_fgenesh2_pg.C_1150002 Physcomitrella patens subsp. patens fgenesh2_pm.scaffold_99000009 Physcomitrella patens subsp. patens 30078.m002298 Ricinus communis 30078.m002300 Ricinus communis 30147.m013906 Ricinus communis estExt_gwp_gw1.C_chr_40361 Thalassiosira pseudonana CCMP1335 estExt_gwp_gw1.C_chr_50296 Thalassiosira pseudonana CCMP1335 estExt_thaps1_ua_kg.C_chr_10066 Thalassiosira pseudonana CCMP1335 thaps1_ua_kg.chr_5000207 Thalassiosira pseudonana CCMP1335 XP_002946301 Volvox carteri f. nagariensis
Cross Link
Database Entry ID E-value Start End InterPro ID Description PANTHER PTHR23077 0.0 1 790 No hit NA SUPERFAMILY SSF50692 3.5E-28 25 109 IPR009010 Aspartate decarboxylase-like domain Pfam PF02359 2.8E-23 29 111 IPR003338 CDC48, N-terminal subdomain SMART SM01073 4.3E-31 29 112 IPR003338 CDC48, N-terminal subdomain TIGRFAM TIGR01243 1.2E-264 30 767 IPR005938 ATPase, AAA-type, CDC48 SUPERFAMILY SSF54585 9.8E-34 111 203 No hit NA SMART SM01072 9.3E-16 129 195 IPR004201 CDC48, domain 2 Pfam PF02933 1.7E-11 131 194 IPR004201 CDC48, domain 2 SUPERFAMILY SSF52540 3.5E-67 203 465 IPR027417 P-loop containing nucleoside triphosphate hydrolase SMART SM00382 2.8E-23 240 376 IPR003593 AAA+ ATPase domain Pfam PF00004 1.1E-47 244 373 IPR003959 ATPase, AAA-type, core ProSitePatterns PS00674 NA 344 362 IPR003960 ATPase, AAA-type, conserved site SUPERFAMILY SSF52540 2.8E-74 475 764 IPR027417 P-loop containing nucleoside triphosphate hydrolase SMART SM00382 1.7E-24 513 652 IPR003593 AAA+ ATPase domain Pfam PF00004 5.0E-47 517 650 IPR003959 ATPase, AAA-type, core ProSitePatterns PS00674 NA 620 638 IPR003960 ATPase, AAA-type, conserved site
Subcellular Localization
Localization	cytosol
Evidence	SUBAcon
Pubmed ID	23180787