Genome Assembly

Position and Type

 
 
 
 

Consequence Type

HIGH             

MODERATE 

LOW             

MODIFIER             

Annotation Gene Information

 
 
 
 
 
 
 
mRNA  rRNA  miRNA
 
 

Minor Allele Frequency

  (0-0.5)

ClinVar Traits

Effect             

     Initial 

OMIM Traits

    Initial         

GWAS-Catalog Traits

Ontology             

Genotype to Phenotype

growth
drought tolerance
metabolite
agronomic traits
resistance
flowering time
forage quality
yeild

Pfam

 
 
 

Setting Properties

limit the maximum number of items
Items  1  - 10 of 1484245       Items per page  First Prev of 148425 Next Last
All VarID
Position
Alleles
MAF
Consequence Type|Effect
Gene
dbSNP
apl8213046 KB742382.1:843-847 GCGCC/G GCGCC:0.0000  
apl8213047 KB742382.1:850-855 GGTGGT/G GGTGGT:0.0000  
apl8213048 KB742382.1:857-885 AGTGGCCCTGGGACGGGGGTGCTGTGGGG/A AGTGGCCCTGGGACGGGGGTGCTGTGGGG:0.0000  
apl8213056 KB742382.1:1950 T/TG T:0.0000  
apl8213061 KB742382.1:3015 G/GACGGCACCGC G:0.0000  
apl8213065 KB742382.1:4644-4653 CCTCCTGCAG/C CCTCCTGCAG:0.0000  
apl8213082 KB742382.1:11492-11493 CT/C CT:0.0000  
apl8213160 KB742382.1:34477-34478 TA/T TA:0.0000  
apl8213172 KB742382.1:38160-38161 CA/C CA:0.0000  
apl8213178 KB742382.1:39972-39990 CCAGAGCAGCTTCCACTCT/C CCAGAGCAGCTTCCACTCT:0.0000