Genome Assembly

Position and Type

 
 
 
 

Consequence Type

HIGH             

MODERATE 

LOW             

MODIFIER             

Annotation Gene Information

 
 
 
 
 
 
 
mRNA  rRNA  miRNA
 
 

Minor Allele Frequency

  (0-0.5)

ClinVar Traits

Effect             

     Initial 

OMIM Traits

    Initial         

GWAS-Catalog Traits

Ontology             

Genotype to Phenotype

growth
drought tolerance
metabolite
agronomic traits
resistance
flowering time
forage quality
yield

Pfam

 
 
 

Setting Properties

limit the maximum number of items
Items  1  - 10 of 1484245       Items per page  First Prev of 148425 Next Last
All VarID
Position
Alleles
MAF
Consequence Type|Effect
Gene
dbSNP
apla8342395 KB742833.1:96-103 GTACAGTT/G G:0.2500 upstream_gene_variant|MODIFIER ENSAPLG00000013871 (POLR1A)  
apla8342396 KB742833.1:159-168 GTAAAGAATT/G GTAAAGAATT:0.5000 upstream_gene_variant|MODIFIER ENSAPLG00000013871 (POLR1A)  
apla8342397 KB742833.1:403-434 CATGTATCTTTTGTTTTTTTATTATTTTTAAG/C CATGTATCTTTTGTTTTTTTATTATTTTTAAG:0.5000 upstream_gene_variant|MODIFIER ENSAPLG00000013871 (POLR1A)  
apla8342398 KB742833.1:423-468 ATTATTTTTAAGCTATTGATGAAACCTGTGTCTTTGTTTTTTTTGT/A ATTATTTTTAAGCTATTGATGAAACCTGTGTCTTTGTTTTTTTTGT:0.5000 upstream_gene_variant|MODIFIER ENSAPLG00000013871 (POLR1A)  
apla8342399 KB742833.1:437-450 ATTGATGAAACCTG/A ATTGATGAAACCTG:0.5000 upstream_gene_variant|MODIFIER ENSAPLG00000013871 (POLR1A)  
apla8342400 KB742833.1:919 A/ATC ATC:0.2500 intron_variant|MODIFIER ENSAPLG00000013871 (POLR1A)  
apla8342401 KB742833.1:1288-1289 AT/A A:0.2500 splice_region_variant|LOW; intron_variant|MODIFIER ENSAPLG00000013871 (POLR1A)  
apla8342402 KB742833.1:1289 T/TAAAAAAAAA TAAAAAAAAA:0.2500 intron_variant|MODIFIER ENSAPLG00000013871 (POLR1A)  
apla8342403 KB742833.1:1292-1293 AT/A A:0.2500 intron_variant|MODIFIER ENSAPLG00000013871 (POLR1A)  
apla8342404 KB742833.1:1298 A/AAT AAT:0.2500 intron_variant|MODIFIER ENSAPLG00000013871 (POLR1A)