Download variation files or useful tools in GVM

Variation Data

All genomic variation data are publicly available. Variation data files in VCF and FASTA formats are tabulated as below.
Organism (version) SNP (VCF) SNP (FASTA) Short INDEL (VCF) Short INDEL (FASTA)
Ailuropoda melanoleuca (AilMel1) VCF FASTA VCF FASTA
Anas platyrhynchos (BGI_duck_1.0) VCF FASTA VCF FASTA
Bos taurus (UMD_3.1) VCF FASTA VCF FASTA
Brassica napus (Bra_napus_v2.0) VCF FASTA VCF FASTA
Canis familiaris (CanFam3.1) VCF FASTA VCF FASTA
Capra hircus (CHIR_2.0) VCF FASTA VCF FASTA
Cucumis sativus (B10v2) VCF FASTA VCF FASTA
Daucus carota (Dcarota_388_v2.0) VCF FASTA VCF FASTA
Equus caballus (EquCab2.0) VCF FASTA VCF FASTA
Equus ferus (EquCab2.0) VCF FASTA VCF FASTA
Gallus gallus (Gallus_gallus-5.0) VCF FASTA VCF FASTA
Glycine max (Wm82.a2.v1) VCF FASTA VCF FASTA
Gossypium hirsutum (Ghir.BGI) VCF FASTA VCF FASTA
Hevea brasiliensis (reyan7-33-97) VCF FASTA VCF FASTA
Homo sapiens (GRCh37) VCF FASTA VCF FASTA
Manihot esculenta (Manihot esculenta v6.1) VCF FASTA VCF FASTA
Orcinus orca (Oorca1.1) VCF FASTA VCF FASTA
Oryza sativa (IRGSP1.0) VCF FASTA VCF FASTA
Ovis aries (Oar_v4.0) VCF FASTA VCF FASTA
Phaseolus vulgaris (Pvulgaris_442_v2.0) VCF FASTA VCF FASTA
Phoenix dactylifera (DPV02) VCF FASTA VCF FASTA
Phyllostachys heterocycla (P.heterocycle 1.0) VCF FASTA VCF FASTA
Populus trichocarpa (JGI v3.0) VCF FASTA VCF FASTA
Prunus mume (P.mume_V1.0) VCF FASTA VCF FASTA
Solanum lycopersicum (SL2.50) VCF FASTA VCF FASTA
Sorghum bicolor (Sorbi3) VCF FASTA VCF FASTA
Sus scrofa (Sscrofa10.2) VCF FASTA VCF FASTA
Triticum aestivum (TGAC v1) VCF FASTA VCF FASTA
Vitis vinifera (IGGP_12x) VCF FASTA VCF FASTA
Zea mays (RefGen_v3) VCF FASTA VCF FASTA

About the data

VCF (Variant Call Format) is a simplified text file format containing information about a position in the genome. More details about its format and specifications are listed below.
1. #CHROM is short for chromosome number
2. POS is short for chromosome position
3. ID is variation identifier in GVM system
4. REF is short for reference allele
5. ALT is short for alternate allele
6. QUAL is variants quality
7. FILTER is filter status
8. INFO is additional information for each variant
More detail information of vcf. format can be found in http://samtools.github.io/hts-specs/VCFv4.1.pdf

FASTA format provide 50nt flanking sequences for each variants (50nt for each flank) which is typically useful for BLAST applications. e.g.
>OSA01S123 class=1|alleles="A/G"|version=1
AGGTCCAGGCTGCCAAGCTTGAACTCCGTCTCCCAGACGACGACGGCCGC
R
GGAGGAAGGCGGACCATGTCGCCGGTGAGGTTGTTGCAGACAGACACGCA

Useful tools

1. Variants calling tools:
2. Genome alignment tools:
3. Variants annotation tools: