Download variation files or useful tools in GVM

Variation Data

All genomic variation data are publicly available. Variation data files in VCF and FASTA formats are tabulated as below.

Note:
   Brief VCF is the vcf format file without individual genotype;
   Detailed VCF is the vcf format file with individual genotype.
Organism (version) SNP (VCF) SNP (VCF) SNP (FASTA) Short INDEL (VCF) Short INDEL (VCF) Short INDEL (FASTA)
Ailuropoda melanoleuca (AilMel1) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Anas platyrhynchos (BGI_duck_1.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Bos taurus (UMD_3.1) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Brassica napus (Bra_napus_v2.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Canis familiaris (CanFam3.1) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Capra hircus (CHIR_2.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Cucumis sativus (B10v2) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Daucus carota (Dcarota_388_v2.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Equus caballus (EquCab2.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Equus ferus (EquCab2.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Gallus gallus (Gallus_gallus-5.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Glycine max (Wm82.a2.v1) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Gossypium hirsutum (Ghir.BGI) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Hevea brasiliensis (reyan7-33-97) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Homo sapiens (GRCh37) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Manihot esculenta (Manihot esculenta v6.1) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Orcinus orca (Oorca1.1) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Oryza sativa (IRGSP1.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Ovis aries (Oar_v4.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Phaseolus vulgaris (Pvulgaris_442_v2.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Phoenix dactylifera (DPV02) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Phyllostachys heterocycla (P.heterocycle 1.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Populus trichocarpa (JGI v3.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Prunus mume (P.mume_V1.0) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Solanum lycopersicum (SL2.50) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Sorghum bicolor (Sorbi3) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Sus scrofa (Sscrofa10.2) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Triticum aestivum (TGAC v1) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Vitis vinifera (IGGP_12x) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA
Zea mays (RefGen_v4) Brief VCF Detailed VCF FASTA Brief VCF Detailed VCF FASTA

About the data

VCF (Variant Call Format) is a simplified text file format containing information about a position in the genome. More details about its format and specifications are listed below.
1. #CHROM is short for chromosome number
2. POS is short for chromosome position
3. ID is variation identifier in GVM system
4. REF is short for reference allele
5. ALT is short for alternate allele
6. QUAL is variants quality
7. FILTER is filter status
8. INFO is additional information for each variant
More detail information of vcf. format can be found in http://samtools.github.io/hts-specs/VCFv4.1.pdf

FASTA format provide 50nt flanking sequences for each variants (50nt for each flank) which is typically useful for BLAST applications. e.g.
>OSA01S123 class=1|alleles="A/G"|version=1
AGGTCCAGGCTGCCAAGCTTGAACTCCGTCTCCCAGACGACGACGGCCGC
R
GGAGGAAGGCGGACCATGTCGCCGGTGAGGTTGTTGCAGACAGACACGCA

Useful tools

1. Variants calling tools:
2. Genome alignment tools:
3. Variants annotation tools: