Online Tools - 2019 Novel Coronavirus Resource

China National Center for Bioinformation
2019 Novel Coronavirus Resource

China National Center for Bioinformation
2019 Novel Coronavirus Resource (2019nCoVR)

Variation Identification

In the current version, only 2019-nCoV is supported as reference for the online variation identification. The input file must be the whole genome sequence of virus(es) in the format of FASTA. Analysis of partial sequence(s) is not supported.Parameter Specification:
1). NC - Maximum number of N's contained in the input fasta sequence, the default value is 15;
2). SC - Maximum number of the degenerate bases contained in the input fasta sequence, the default value is 50.

Upload file
NC
SC
Run
Input file format
>BetaCoV/Wuhan/IVDC-HB-01/2019 EPI_ISL_402119 ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGA TCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAG TGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAAC TCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGC ACATCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGG TTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTCGCGACGT GCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAGCT TAACGGAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGGCCCTGATGGCTA