Experiment information
Accession CRX036295
Organism Bacteria
Title JR.81 for archaea study
BioProject PRJCA001121
BioSample SAMC048421
Platform Illumina HiSeq 2500
Library
Library name Construction protocol Strategy Source Selection Layout
Total genomic DNA was extracted from soil samples using the MP FastDNA SPIN Kit for soil (MP Biomedicals, Solon, OH, USA) as per the manufacturer’s instructions. Archaeal 16S rRNA gene were PCR-amplified using primers Arch519F (CAGCCGCCGCGGTAA) / Arch915R (GTGCTCCCCCGCCAATTCCT) combined with adapter sequences and barcode sequences. AMPLICON METAGENOMIC PCR SINGLE
Processing Planned read length (bp): 373
Release date2021-02-12
Run
Run accession Run data file information
File nameFile size (MB)
CRR040862 CRR040862.fastq.gz 8.34
SubmitterShuo Jiao (js1990@nwsuaf.edu.cn)
OrganizationNorthwest A&F University
Date submitted2018-12-11
Related experiments
Experiments(248)