Accession SAMC021113
Sample name rtcb-wild 3' end RNA-Seq s1
Title rtcb-wild 3' end RNA-Seq s1
Sample type Microbe
Organisms Escherichia coli K-12
Description rtcb wild ceftriaxone stress 1h 3' end labeling RNA-Seq, DNA adapters (5 rApp GATCGGAAGAGCACACGTCT -NH2 3).
Strain Escherichia coli str. K-12 substr. MG1655
Isolation source Laboratory
Collection date 2017-11-27
Geographic location China:Beijing,Chaoyang
Biomaterial provider
Collected by
Culture collection
Environment biome
Host tissue sampled
Identified by
Lab host
Latitude and longitude
Mating type
Passage history
Sample size
Specimen voucher
Release date 2018-10-10
Accession PRJCA000771
Submitter shi  xing  (
Organization Beijing Institute of Genomics, Chinese Academy of Sciences
Submission date 2018-02-26

Sample Data

Resource name Description
GSA (1) -
CRA000773 3' end labeling RNA-Seq