Genome Assembly

Position and Type


Consequence Type





Annotation Gene Information


Minor Allele Frequency


ClinVar Traits



OMIM Traits


GWAS-Catalog Traits


Genotype to Phenotype

drought tolerance
agronomic traits
flowering time
forage quality



Setting Properties

limit the maximum number of items
Items  1  - 10 of 7727010       Items per page  First Prev of 772701 Next Last
All VarID
Consequence Type|Effect
pop19861838 chr1:1203 A/AGTT A:  
pop19861841 chr1:1429 T/TGGAATACGGAAGGGGACA T:  
pop19861842 chr1:1431 G/GAAAACACAAAAAAAAAGAGA G:  
pop19861843 chr1:1434 T/TAAAGTTAGAATG T:  
pop19861881 chr1:7727-7728 GT/G GT:  
pop19861950 chr1:12352-12356 CTCGG/C CTCGG:  
pop19861969 chr1:12714 A/ATCCTTTTCC A:  
pop19862178 chr1:25078-25079 CA/C CA:  
pop19862179 chr1:25259 A/AGAAG A: