Genome Assembly

Position and Type

 
 
 
 

Consequence Type

HIGH             

MODERATE 

LOW             

MODIFIER             

Annotation Gene Information

 
 
 
 
 
 
 
mRNA  rRNA  miRNA
 
 

Minor Allele Frequency

  (0-0.5)

ClinVar Traits

Effect             

     Initial 

OMIM Traits

    Initial         

GWAS-Catalog Traits

Ontology             

Genotype to Phenotype

growth
drought tolerance
metabolite
agronomic traits
resistance
flowering time
forage quality
yield

Pfam

 
 
 

Setting Properties

limit the maximum number of items
Items  1  - 10 of 684176       Items per page  First Prev of 68418 Next Last
All VarID
Position
Alleles
MAF
Consequence Type|Effect
Gene
dbSNP
cros4342747 JQHZ01000007.1:92 A/AT AT:  
cros4342748 JQHZ01000007.1:176-178 CAG/C CAG:  
cros4342749 JQHZ01000007.1:247 T/TA TA:  
cros4342750 JQHZ01000007.1:474 A/AT A:  
cros4342751 JQHZ01000007.1:542-546 CTTTT/C,CT CT:  
cros4342752 JQHZ01000007.1:620-640 AATTGGCCAGCATCATTTTCG/A A:  
cros4342753 JQHZ01000007.1:951-953 ATT/A ATT:  
cros4342754 JQHZ01000007.1:966 A/AT AT:  
cros4342755 JQHZ01000007.1:1049 G/GAAA GAAA:  
cros4342756 JQHZ01000007.1:1174 T/TC TC: