Genome Assembly

Position and Type

 
 
 
 

Consequence Type

HIGH             

MODERATE 

LOW             

MODIFIER             

Annotation Gene Information

 
 
 
 
 
 
 
mRNA  rRNA  miRNA
 
 

Minor Allele Frequency

  (0-0.5)

ClinVar Traits

Effect             

     Initial 

OMIM Traits

    Initial         

GWAS-Catalog Traits

Ontology             

Genotype to Phenotype

growth
drought tolerance
metabolite
agronomic traits
resistance
flowering time
forage quality
yeild

Setting Properties

limit the maximum number of items
Items  1  - 10 of 2983906       Items per page  First Prev of 298391 Next Last
All VarID
Position
Alleles
MAF
Consequence Type|Effect
Gene
dbSNP
sly26938826 chr1:20-21 GA/G G:0.2857  
sly26938827 chr1:58-239 TTTCGACGATTTTCGTGTGCTATAGCACACCATTTTTTGGGTGATCCGGATTCCGACGTCAAAAATTCCAAATTTTTTCGTGGTCGTCCGTCAAGACCTTGTCTATGCATACGGTTGGCCATCACGGCTTGTCCGACCCATTTGGAAGGTCAAACGAGCCCCGAAGCGAGCATACCCCTCCA/T T:0.0074  
sly26938828 chr1:73 TGTGCTATA/*,T *:0.0061  
sly26938829 chr1:331 AATATAT/AATATATAT,AATAT,AATATATATAT,A AATATATAT:0.1905  
sly26938830 chr1:362 T/TTATATAAAG TTATATAAAG:0.0028  
sly26938831 chr1:883-884 AG/A A:0.0029  
sly26938832 chr1:923 C/CA,CAA C:0.0583  
sly26938833 chr1:1014-1015 GT/G G:0.0009  
sly26938834 chr1:1372 T/TAATTG TAATTG:0.1607  
sly26938835 chr1:1456 G/GA GA:0.0155