Genome Assembly

Position and Type

 
 
 
 

Consequence Type

HIGH             

MODERATE 

LOW             

MODIFIER             

Annotation Gene Information

 
 
 
 
 
 
 
mRNA  rRNA  miRNA
 
 

Minor Allele Frequency

  (0-0.5)

ClinVar Traits

Effect             

     Initial 

OMIM Traits

    Initial         

GWAS-Catalog Traits

Ontology             

Genotype to Phenotype

growth
drought tolerance
metabolite
agronomic traits
resistance
flowering time
forage quality
yeild

Setting Properties

limit the maximum number of items
Items  1  - 10 of 19861824       Items per page  First Prev of 1986183 Next Last
All VarID
Position
Alleles
MAF
Consequence Type|Effect
Gene
dbSNP
ptc19861838 chr1:1203 A/AGTT A:0.0000  
ptc19861839 chr1:1211-1248 TTGGCAGTCGATGAAGCTTCACTGCAGCTAGTAAAAGC/T TTGGCAGTCGATGAAGCTTCACTGCAGCTAGTAAAAGC:0.0000  
ptc19861841 chr1:1429 T/TGGAATACGGAAGGGGACA T:0.0000  
ptc19861842 chr1:1431 G/GAAAACACAAAAAAAAAGAGA G:0.0000  
ptc19861843 chr1:1434 T/TAAAGTTAGAATG T:0.0000  
ptc19861881 chr1:7727-7728 GT/G GT:0.0000  
ptc19861950 chr1:12352-12356 CTCGG/C CTCGG:0.0000  
ptc19861969 chr1:12714 A/ATCCTTTTCC A:0.0000  
ptc19862178 chr1:25078-25079 CA/C CA:0.0000  
ptc19862179 chr1:25259 A/AGAAG A:0.0000