Genome Assembly

Position and Type


Consequence Type





Annotation Gene Information


Minor Allele Frequency


ClinVar Traits



OMIM Traits


GWAS-Catalog Traits


Genotype to Phenotype

drought tolerance
agronomic traits
flowering time
forage quality



Setting Properties

limit the maximum number of items
Items  1  - 10 of 114594       Items per page  First Prev of 11460 Next Last
All VarID
Consequence Type|Effect
tae2922 TGACv1_scaffold_177392_2DS:50034 A/AG AG: downstream_gene_variant|MODIFIER TRIAE_CS42_2DS_TGACv1_177392_AA0575430 5387127_2d
3_prime_UTR_variant|MODIFIER TRIAE_CS42_2DS_TGACv1_177392_AA0575420
tae14311 TGACv1_scaffold_193856_3AL:167289 G/GT G: upstream_gene_variant|MODIFIER TRIAE_CS42_3AL_TGACv1_193856_AA0621010 4345395_3a
3_prime_UTR_variant|MODIFIER TRIAE_CS42_3AL_TGACv1_193856_AA0621020
tae23631 TGACv1_scaffold_196244_3AL:15259 C/CTAA CTAA: upstream_gene_variant|MODIFIER TRIAE_CS42_3AL_TGACv1_196244_AA0658710 4423837_3a
3_prime_UTR_variant|MODIFIER TRIAE_CS42_3AL_TGACv1_196244_AA0658720
tae25242 TGACv1_scaffold_197129_3AL:10639 C/CTGATAATATATATAACTAATG CTGATAATATATATAACTAATG: 3_prime_UTR_variant|MODIFIER TRIAE_CS42_3AL_TGACv1_197129_AA0664970 4446356_3a
tae34580 TGACv1_scaffold_000002_1AL:458635-458636 GT/G G: upstream_gene_variant|MODIFIER TRIAE_CS42_1AL_TGACv1_000002_AA0000040 1065975_1a
3_prime_UTR_variant|MODIFIER TRIAE_CS42_1AL_TGACv1_000002_AA0000050
tae37768 TGACv1_scaffold_220772_3B:273870 T/TA TA: intron_variant|MODIFIER TRIAE_CS42_3B_TGACv1_220772_AA0718800 10494285_3
tae38752 TGACv1_scaffold_220873_3B:136787 T/TAA TAA: upstream_gene_variant|MODIFIER TRIAE_CS42_3B_TGACv1_220873_AA0722020 10525917_3
5_prime_UTR_variant|MODIFIER TRIAE_CS42_3B_TGACv1_220873_AA0722030
tae51652 TGACv1_scaffold_000410_1AL:9143 G/GT GT: downstream_gene_variant|MODIFIER TRIAE_CS42_1AL_TGACv1_000410_AA0011450 3915371_1a
synonymous_variant|LOW TRIAE_CS42_1AL_TGACv1_000410_AA0011460
tae51763 TGACv1_scaffold_223102_3B:9740 A/AT AT: 10608878_3
tae56411 TGACv1_scaffold_224058_3B:49404 G/GGGATGA GGGATGA: 10586871_3