Genome Assembly

Position and Type

 
 
 
 

Consequence Type

HIGH             

MODERATE 

LOW             

MODIFIER             

Annotation Gene Information

 
 
 
 
 
 
 
mRNA  rRNA  miRNA
 
 

Minor Allele Frequency

  (0-0.5)

ClinVar Traits

Effect             

     Initial 

OMIM Traits

    Initial         

GWAS-Catalog Traits

Ontology             

Genotype to Phenotype

growth
drought tolerance
metabolite
agronomic traits
resistance
flowering time
forage quality
yield

Pfam

 
 
 

Setting Properties

limit the maximum number of items
Items  1  - 10 of 104       Items per page  First Prev of 11 Next Last
All VarID
Position
Alleles
MAF
Consequence Type|Effect
Gene
dbSNP
2019nCoV2066 2019-nCoV:2-5 TTAA/T T: intergenic_variant|MODIFIER  
2019nCoV2067 2019-nCoV:2-4 TTA/C C: intergenic_variant|MODIFIER  
2019nCoV2068 2019-nCoV:3 T/TCAAGG,TGG TGG: intergenic_variant|MODIFIER  
2019nCoV2069 2019-nCoV:3-4 TA/T T: intergenic_variant|MODIFIER  
2019nCoV2070 2019-nCoV:4-10 AAAGGTT/A A: intergenic_variant|MODIFIER  
2019nCoV2071 2019-nCoV:6 A/AAGTTGGTT,AGTTCAGACGTGTGCTCTTCC,ATCTCGTGACTGGAGTTCAGACGTGTGCTCTTCC,AGCCGGTGACTGGAGTTCAGACGTGTGCTCTTCC AGTTCAGACGTGTGCTCTTCC: intergenic_variant|MODIFIER  
2019nCoV2072 2019-nCoV:7 G/GACTGGA,ATGCTGTT,GTGACTGGA ATGCTGTT: intergenic_variant|MODIFIER  
2019nCoV2073 2019-nCoV:9 T/TTTAATCAGCACGAAGTTCTACTTGCACCA,CCAAACTGTCA TTTAATCAGCACGAAGTTCTACTTGCACCA: intergenic_variant|MODIFIER  
2019nCoV2074 2019-nCoV:10 T/CAGACGTGTGCTCTTCCGA CAGACGTGTGCTCTTCCGA: intergenic_variant|MODIFIER  
2019nCoV2075 2019-nCoV:12 A/GTTGGTTTGT GTTGGTTTGT: intergenic_variant|MODIFIER