Accession SAMC021109
Sample name RtcB-delta 3' end RNA-Seq s2
Title rtcb-delta 3' end RNA-Seq s2
Sample type Microbe
Organisms Escherichia coli K-12
Description rtcb knockout ceftriaxone stress 2h, 3' end labeling RNA-Seq, DNA adapters (5 rApp GATCGGAAGAGCACACGTCT -NH2 3).
Attributes
Strain Escherichia coli str. K-12 substr. MG1655
Isolation source Laboratory
Collection date 2017-11-27
Geographic location China:Beijing,Chaoyang
Altitude
Biomaterial provider
Collected by
Culture collection
Depth
Environment biome
Genotype
Host
Host tissue sampled
Identified by
Lab host
Latitude and longitude
Mating type
Passage history
Sample size
Serotype
Serovar
Specimen voucher
Temperature
Release Date 2018-10-10
Accession PRJCA000771
Submitter shi  xing  (shixing@big.ac.cn)
Organization Beijing Institute of Genomics, Chinese Academy of Sciences
Submission Date 2018-02-26

Sample Data

Resource Name Description
GSA (1) -
CRA000773 3' end labeling RNA-Seq
-