| Accession |
PRJCA002747 |
| Title |
Transcriptome divergence of two new miRNAs between Drosophila species |
| Relevance |
Evolution |
| Data types |
Transcriptome or Gene expression
|
| Organisms |
Drosophila simulans
Drosophila melanogaster
|
| Description |
The Red Queen hypothesis depicts evolution as the continual struggle to adapt. According to this hypothesis, new genes, especially those originating from non-genic sequences (i.e., de novo genes), would be eliminated unless they evolve continually to adapt to a changing world. To test this hypothesis,we survery the effects of two de novo new miRNA genes(miR-983&miR-975) on the transcriptome by performing RNA-seq analysis. This data could be used to compare the number of dysregulated genes in the two species upon miRNA knockout.The adapter infomation of this dataset is:P7 adaper(read1),AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;P5 adaper(read2),AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT. |
| Sample scope |
Multispecies |
| Release date |
2020-12-02 |
| Grants |
| Agency |
program |
Grant ID |
Grant title |
| National Natural Science Foundation of China (NSFC)
|
Young Scientists Fund
|
31900417
|
|
| Guangdong Basic and Applied Basic Research Foundation
|
General Program
|
2019A1515010708
|
|
|
|
| Submitter |
Guang-An
Lu (lugasysu@163.com)
|
| Organization |
SUN YAT-SEN university |
| Submission date |
2020-05-26 |
